key: cord- -n h e authors: olson, ann louise; perlman, stanley; robillard, jean e title: developmental regulation of angiotensinogen gene expression in sheep date: journal: pediatr res doi: . / - - sha: doc_id: cord_uid: n h e abstract: it has been suggested that the liver is not the main source of angiotensinogen during fetal life in rats, but that the kidney is an important site of fetal angiotensinogen synthesis. in an effort to determine if this phenomenon is specific to the rat or applicable to other species, we compared the ontogenic changes in hepatic and renal angiotensinogen mrna expression in fetal ( , , , and d of gestation, term being d), newborn ( d postnatal), and adult sheep. total rna was extracted, subjected to northern blotting and hybridized using a full-length rat radiolabeled antisense rna. angiotensinogen mrna sequences were detected in all fetal liver samples and appeared to increase -fold from to d gestation and then to decrease after birth. in contrast, angiotensiogen mrna could not be detected in renal cortical tissue of or d fetuses, or newborn or adult sheep. we conclude that, unlike in the rat, liver angiotensinogen gene expression is detectable during the nd trimester of gestation in sheep and is developmentally regulated. furthermore, in contrast to the fetal rat, angiotensinogen mrna sequences were undetectable in fetal sheep kidney. the existence of a functional renin-angiotensin system during fetal life has been documented ( ) and developmental aspects of this system have been recently reviewed ( ) . it has been shown that fetal plasma levels of renin, angiotensinogen, angiotensin i, and angiotensin i are elevated when compared with adult values ( ) , and that the kidney is the primary source of circulating renin in near-term fetus ( ), as it is in the adult. it has also been demonstrated that the primary source of angiotensinogen synthesis in the adult is the liver ( ) . on the other hand, recent studies by gomez et al. ( ) suggest that the liver may not be the main source of angiotensinogen during fetal life, but that the kidney and possibly brown fat and brain are also important sites of angiotensinogen synthesis in the fetal rat. interestingly, they have also observed that the expression of liver angiotensinogen increases rapidly in the first h after birth in the rat, suggesting that the developmental regulation of angiotensinogen is tissue-specific. in an effort to determine if this phenomenon is specific to the rat or applicable to other species, we compared the ontogenic received january , ; accepted april , changes in hepatic and renal angiotensinogen gene expression during the last trimester of gestation in fetal sheep. we demonstrated that, unlike in the rat, hepatic angiotensinogen gene expression in sheep is detectable early during the last trimester of gestation and increases as the fetus approaches birth. furthermore, in contrast to the rat, renal angiotensinogen mrna sequences were undetectable in fetal sheep. animals. pregnant mixed-breed dorset-suffolk ewes and newborn lambs ( d postnatal) were obtained from a local source; the gestational age was known based on the induced-ovulation technique ( ) . pregnant ewes were anesthetized with a mixture of . - . % halothane, % oxygen, and % nitrous oxide given by an endotracheal tube ( ) . the uterus was exteriorized to gain access to fetuses. liver and kidney cortex samples were obtained from fetuses at , , , and d gestation, term being d. newborn lambs were similarly anesthetized before tissue harvest. all procedures were approved by the university of iowa animal care and use committee. rna isolation. rna was isolated using a minor modification of the guanidinium isothiocyanate-csc method of chirgwin et al. ( ) . with our modification, . g of fresh tissue was homogenized in m guanidinium isothiocyanate in a buffer consisting of mm na acetate buffer, ph . , mm edta, ph . , . % sarcosyl, and . % -mercaptoethanol. cscl was added to the tissue homogenate at a final concentration of . g/ml, and this mixture was layered over a cushion of . m csc , mm na acetate buffer, ph . , mm edta. the rna was pelleted by centrifugation at rpm for h at °c. the rna pellet was purified by extraction with chloroform:butanol and ethanol precipitated in the presence of . m na acetate buffer, ph . . rna was quantified spectrophotometrically by absorbance at nm. rna samples were stored as an ethanol precipitate at - °c until further analysis. preparation of probes. a clone containing full-length rat angiotensinogen cdna (prang ) ( ) was obtained from k. r. lynch. this cdna, when linearized with ecori, yields the antisense mrna upon transcription from the t promoter. a . -kb fragment of p-actin cdna ( ) that had been subcloned into psp (promega, madison, wi) as described ( ) was obtained from p. rubenstein. after linearization of this plasmid with ecori, transcription from the sp promoter yields the antisense mrna. p-labeled antisense mrna were transcribed according to the method of melton et al. ( ) using ~u-~~p-uridine triphosphate (amersham corp., arlington heights, il). northern blot hybridization. aliquots of or pg of rna as measured by absorbance at nm were fractionated by % agarose-formaldehyde gel electrophoresis ( ) . after electrophoresis, rna was transferred to nytran filters, . fm (schleicher and schuell inc., keene, nh). the filters were prehybridized for h at °c in a solution of % deionized formamide, x sspe, x denhardt's reagent, . % sds and pg/ml denatured fractionated salmon sperm dna. hybridization of filters with either p-labeled angiotensinogen or p-actin mrna was done with fresh prehybridization buffer solution containing x lo cpm/ml of the appropriate radio-labeled probe. the hybridization reaction was carried out at °c - h. filters were washed according to manufacturer's specifications. briefly, this included three low-stringency washes ( x sspe, . % sds) at °c and a high stringency wash ( . x sspe, . % sds) at °c followed by treatment with ribonuclease a ( pg/ml in x sspe) at °c for min. the washed filters were exposed to kodak xar film at - °c. the autoradiographs from northern blots were quantitated using a soft laser scanning densitometer, model slr- d (biomed instruments, inc., fullerton, ca). results of separate northern blots were normalized by calculating all bands to a single d fetus sample, which was run on each northern blot. this band was considered % expression. all data were subsequently expressed as a percent of this sample. individual liver samples were analyzed in duplicate or triplicate and the mean value for each analysis was then used to calculate the grand mean for livers within each age group. age-related changes in angiotensinogen mrna expression were analyzed by one-way analysis of variance ( ). changes in the level of angiotensinogen mrna in the liver of fetal sheep are shown in figure . using northern blot hybridization, we observed a progressive increase in hepatic angiotensinogen mrna during gestation. moreover, the size of the angiotensinogen message did not appear to change during gestation. among the fetal and newborn sheep, it appeared that the highest level of liver angiotensinogen mrna was expressed in the nearterm fetuses. in contrast, duplicate samples of rna analyzed for p-actin mrna expression (fig. ) showed no changes with gestation. quantitation of angiotensinogen and p-actin mrna is summarized in table . these results, expressed as percent of angiotensinogen mrna present in -d fetuses, show that angiotensinogen mrna increases about -fold from to d gestation, whereas there was no significant change in p-actin mrna. this suggests that the developmental changes seen in angiotensinogen newbor? aqe t r l day=. pnyc h r g ~:dys $changes in angiotensinogen mrna as a function of age were statistically significant (p = . ) using one-way analysis of variance. fig. . autoradiograph of northern blot analysis of fetal and newborn liver (l) and kidney (k) rna. ten-pg aliquots of total cellular rna were fractionated by gel electrophoresis and transferred to a nylon filter. the northern blot was hybridized with p-labeled antisense angiotensinogen rna. the hybridized filter was exposed to film for d. angiotensinogen c m l fig. . autoradiograph of northern blot analysis of fetal and newborn liver rna. five-pg aliquots of total cellular rna were fractionated by gel electrophoresis and transferred to a nylon filter. the northern blot was hybridized with p-labeled antisense angiotensinogen rna. the hybridized filter was exposed to film for h. age - oars age in d;ys % i i r r fig. . autoradiograph of northern blot analysis of fetal and newborn liver rna. five-pg aliquots of total cellular rna were fractionated by gel electrophoresis and transferred to a nylon filter. the northern blot was hybridized with "p-labeled antisense p-actin rna. the hybridized filter was exposed to film for h. hepatic angiotensinogen were specific rather than a reflection of generalized changes in fetal liver gene expression. in an effort to investigate the possibility that other tissues may also be important sources of angiotensinogen during fetal life, we compared angiotensinogen mrna samples from fetal and newborn liver and kidney. northern blot analysis of liver and kidney rna from fetal sheep ( and d gestational age) and newborn lamb are shown in figure . we were unable to detect angiotensinogen mrna sequences in any of the kidney rna samples at the three ages studied. even with prolonged exposure to film ( d, data not shown), no hybridized material was apparent in the kidney samples. additionally, we also determined if angiotensinogen mrna ' is found in kidney of mature sheep. total cellular rna was / isolated from kidney cortex and medulla of an adult male and probed for angiotensinogen. northern blot analysis (fig. ) shows that angiotensinogen sequences were undetectable in both kidney cortex and medulla. discussion through northern hybridization, we have shown that angiotensinogen mrna sequences are present in fetal sheep liver at least by d of gestation. the amount of angiotensinogen mrna per unit of total rna increases in the fetal liver with increasing gestational age. after birth, the amount of angiotensinogen message appears to decrease slightly. we have not determined if increases in liver angiotensinogen during gestation parallel increases in circulating angiotensinogen and plasma angiotensin i concentration. changes in angiotensinogen gene expression in liver and other tissue in response to a variety of physiologic and hormonal stimuli have been studied in adult animals ( ) ( ) ( ) ( ) ( ) . however, there is presently no data available regarding factors regulating angiotensinogen gene expression during fetal life. inasmuch as angiotensinogen mrna expression undergoes a maturational process, it is likely that gene regulatory mechanisms also undergo maturation. the results of our study suggest that the ontogeny of angiotensinogen may differ between species. the development of angiotensinogen mrna in the sheep appears to be quite different from development in the rat. this may be due to maturational differences between the sheep and rat at the time of birth, inasmuch as the newborn lamb is much more mature at birth than is the rat. liver angiotensinogen mrna sequences appear in the neonatal rat about h after birth ( ) . this may be similar to the increase in angiotensinogen mrna that we have seen between and d gestation in fetal sheep. we were unable to detect the presence of angiotensinogen mrna in either fetal, newborn, or mature sheep kidney. this was unexpected, inasmuch as angiotensinogen mrna sequences have been demonstrated in the kidney of adult rats ( - ). the relative quantity of renal angiotensinogen mrna to liver angiotensinogen mrna ranges from ( ) to approximately % ( ) per unit of total rna in rat. gomez et al. ( ) reported the presence of angiotensinogen mrna in total rna extracts from fetal rat kidney; however, angiotensinogen mrna was detectable at low levels in fetal rat liver only after poly a+ selection of liver rna. this suggests a relatively high abundance of angiotensinogen mrna in fetal rat kidney compared with fetal rat liver. our current methodology allows us to measure -fold differences in sequence abundance ( ) ; therefore, if angiotensinogen mrna is present in the sheep kidney, it is less than % the amount of angiotensinogen mrna found in sheep liver. ontogeny of the renin-angiotensin-aldosterone system in the fetal and newborn lamb neurohormonal regulation of renal function during development factors influencing plasma renin and angiotensin i in the conscious ewe and its foetus plasma renin levels in the normal and anephric fetus at birth angiotensinogen gene is expressed and differentially regulated in multiple tissues of the rat peach mj fetal expression of the angiotensinogen gene the influence of mating management on fertility in ewes following progesterone pms treatment developmental aspects of the fetal renal response to exogenous arginine vasopressin isolation of biologically active ribonucleic acid from sources enriched in ribonuclease localization of preangiotensinogen messenger rna sequences in the rat brain number and evolutionary conservation of alpha and beta-tubulin and cytoplasmic beta and gamma-actin genes using specific cloned cdna probes measurement of prothrombin mrna during gestation and early neonatal development efficient in vitro synthesis of biologically active rna and rna hybridization probes from plasmids containing a bacteriophage sp promoter boedtker h rna molecular weight determinations by gel electrophoresis under denaturating conditions, a critical re-examination the iowa state university press induction of rat liver angiotensinogen mrna following acute inflammation tissue-specific regulation of angiotensinogen mrna accumulation by dexamethasone regulation of liver angiotensinogen mrna by glucocorticoids and thyroxine sodium balance effects on renin, angiotensinogen, and atrial natriuretic polypeptide mrna levels sodium regulation of angiotensinogen mrna expression in rat kidney cortex and medulla tissue distribution of rat angiotensinogen mrna and structural analysis of its heterogeneity regional distribution of angiotensinogen messenger rna in rat adrenal and kidney intrarenal localization of angiotensinogen mrna by rna-dna dot-blot hybridization angiotensinogen mrna is expressed in both rat renal cortex and medulla a comparative study of the distribution of renin and angiotensinogen messenger ribonucleic acids in rat and mouse tissues angiotensinogen gene expression in extrahepatic rat tissues: application of a solution hybridization assay regional localization of virus in the central nervous system of mice persistently infected with murine coronavirus jhm key: cord- -slqje cq authors: orlik-eisel, gabriele; lutz, frieder; henschen, agnes; eisel, ulrich; struckmeier, martin; kräuter, josef; niemann, heiner title: the cytotoxin of pseudomonas aeruginosa: cytotoxicity requires proteolytic activation date: journal: arch microbiol doi: . /bf sha: doc_id: cord_uid: slqje cq the primary structure of a cytotoxin from pseudomonas aeruginosa was determined by sequencing of the structural gene. the cytotoxin ( , mr) lacks an n-terminal signal sequence for bacterial secretion but contains a pentapeptide consensus sequence commonly found in prokaryotic proteins which function in a tonb-dependent manner. the cytotoxin gene has a [g+c]-content of . % which is considerably lower than generally observed for genes from pseudomonas aeruginosa. the cytotoxin gene was exclusively detected in strain but not in three other clinical isolates, as determined by southern and northern hybridization. the latter technique revealed that the toxin is translated from monocistronic mrna. the promoter of the cytotoxin is inactive in escherichia coli. upon site-directed modification of the ′-noncoding region by the polymerase chain reaction the gene was expressed under control of the trcpromoter. the gene product obtained in escherichia coli was nontoxic. toxicity was induced by subsequent treatment with trypsin. [( )s]methionine-labeled cytotoxin with high specific radioactivity was obtained by in vitro transcription/translation. like [( )i] labeled material from pseudomonas aeruginosa this polypeptide bound to membrane preparations from ehrlich ascites cells, as evidenced by sedimentation through a sucrose gradient at neutral ph. offprint requests to: h. nlemann periplasm of the bacterium (kluftinger et al. ) and becomes liberated by autolysis rather than by secretion (scharmann ) . isolated from bacterial autolysates, the cytotoxin has been characterized as a protein of , to , mr which acts primarily on the plasma membranes of mammalian cells (baltch et al. ; kluftinger et al. ; lutz ) by binding to a high affinity binding sites (lutz ) . as a consequence, pores of about nm diameter are formed resulting in a breakdown of the cellular gradient for low molecular substances. the role of the cytotoxin in the manifestation of the pseudomonas aeruginosa infection, however, has not been thoroughly investigated. in this paper, we present the sequence of the cytotoxin. we show that a posttranslational activation step involving proteolytic removal of a , mr peptide from the carboxy-terminal end takes place during or after autolysis. materials. enzymes were purchased from boehringer (mannhelm, frg). [ zp]atp, ~[ s]dctp, and l-[ s]methionine were from amersham (braunschweig, frg). rabbit reticulocyte lysate was obtained from amersham or promega (heidelberg, frg), nucleotides and ribonuclease lnhibator were from pharmacia (freiburg, frg), and anti-rabbit igg from dako (copenhagen, denmark). diethylpyrocarbonate was from sigma (mfinchen, frg). bacterial stratus and plasmids. pseudomonas aerugmosa strain ( : ; h : ao, a , a , pyocin : e) was a clinical isolate from bovine mastitis milk. pseudomonas aeruginosa strains and were isolated as swab samples from horse vagina or dog ear. the strain was isolated from feces of a septicemic cow. all strains were propagated at ~ on tsa/tsb (difco. detroit). escherichia coli strains hb and jm were grown at ~ in yt or m minimal medium. plasmids puc / (messing and vieira ) , m mp / (norrander et al. ) and prn a,b,c (h. niemann, a. smid, m. rosing, and e. amann, unpublished) were used for establishing dna-libraries, for dna-sequenclng, and for combined in vitro transcription/translation, respectively. for tightly regulated expression of the cytotoxin gene in escherichia coli the iptg-inducible vector ptrc a (amann et al. ) was used. - ~ | l l , , j i l i i p i l l l (lutz ) . the n-terminal amino acid sequence of the purified cytotoxin was determined by edman degradation (edman and henschen ) . hybridization conditions with synthetic oligonucleotides. chromosomal dna was isolated from logarithmically growing cultures as described (meade et al. ) . the mixture of heptadecamere oligonucleotides [atgaa(c/t)ga(g/a)at(c/t/a)-ga(c/t)ac] was synthesized with an applied biosystems model a dna synthesizer, '-labeled using ~[ p]atp and t -polynucleotide kinase and used for hybridization according to wallace et al. ( ) . cloning procedures and dna modifications. dna modifications were performed according to standard protocols (maniatis et al. ) . the coding sequence for the n-terminus was identified with the '-labeled oligonucleotides on a kb kpni-and a . kb pstifragment. in addition, a signal was obtained with a bp sau ai/ psti-fragment. the sau a/psti-fragment was isolated from the gel and cloned under l -b biosafety containment facilities into bamhi/psti-digested puc . the insert was isolated by digestion with psti and smai, nick-translated and used to screen psti/hinciiand psti/ecorv-libraries. overlapping m clones, together spanning the entire toxin gene (fig ) , were sequenced on both strands to establish the complete structure employing the chain termination method (sanger et al. ) . computer assisted analyses were performed with the pc-gene program purchased from genofit (geneva, switzerland). annealing of the oligonucleotides was performed at ~ c for min, the polymerization reaction was at ~ for min. through this procedure a singular foki-site was introduced into the '-noncoding region. subsequent cleavage with foki generated '-catg protruding ends that allowed cloning of the amplified gene into the ncoi-site of ptrc a (amann et al. ) to yield psn as detailed in fig. . expression of the cytotoxin in escherichia coli. ml precultures of escherichia coli strain hbi harboring psn were prepared in lbmedium and used to inoculate ml of tsb and mg ampicillin per . cells were grown up to an optical density of od nm of . and synthesis of the cytotoxin was induced by the addition of ml of . mm iptg. the incubation was continued for another h at ~ when cells were harvested by centrifugation at , xg, washed once with phosphate buffered saline (pbs), ph . , and resuspended in ml of pbs. the cells were incubated for h at ~ c (autolysis step). insoluble material was removed by centrifugation ( rain at , xg) and the supernatant was stored at - ~ toxicity assays were performed according to gladstone and van heyningen ( ) . proteolytic activation of the cytotoxin was achieved by the addition of . % (w/w protein) tpck-trypsin ( u/mg, boehringer) in lysates containing mm (final concentration) of caciz. after h at ~ reactions were stopped by the addition of -fold molar excess of trypsin inhibitor from soybean in mm edta. in vitro transcription/translatlons. the coding region of the cytotoxin gene was cloned from the ecorv site ( fig. ) on the '-psti site into smai-psti digested prn c to yield poe ep . the sequence of the y-recombination site was verified by direct sequencing using the sp sequencing primer. plasmid dna was purified by two consecutive centrifugations on cscl-density gradients. transcriptions with sp -polymerase and translations in rabbit reticulacyte lysate were performed as described previously (mayer et al. ). was incubated for h at ~ and subsequently for min at ~ with plasma membrane preparations from ehrlich mouse aseites cells (kflberg and christensen ) . to assess membrane association, the incubation mixture was then placed on a sucrose cushion prepared in buffer that was either at ph . or at ph . , as described in detail previously (mayer et al. ). the pellet and the supernatant fraction were analyzed by sds-page. gel electrophorests and #nmunoprecipitation. sds-page and processing with dmso-ppo for autoradiography were performed as described (niemann and klenk ) . rabbit antibodies against cytotoxin were purified by binding the antibodies to nitocellulose carrying the purified toxin according to burke et al. ( ) . protein a bearing staphylococcus aureus, strain cowan i, was used to bind immune complexes. to establish the p r i m a r y sequence of the cytotoxin from pseudomonas aeruginosa, we have cloned a n d sequenced arrow indicates the translation start codon. note that a mutation of the aac-codon would lead to a mutation of asn and thus to a posttranslational removal of the n-terminal met residue. taq-polymerase from boehrlnger was used to introduce a singular fokisite m cycles. the products were digested with xmnl and foki, purified by agarose gel electrophoresis and cloned into the sinai/ ncoi-dlgested ptrc a (amann et al. ) domains that could be involved in catalyzing membrane integration. in addition, no signal sequence for secretion and no a-helical transmembrane domains were detected using the programs of roa and argos ( ) or klein et al. ( ) , respectively. a shine-dalgarno consensus sequence (agga) was found nucleotides upstream from the translation initiator atg-codon. the [g + c]-content of the coding region ( . %) is significantly lower than that reported for chromosomally integrated genes of pseudomonas aeruginosa (west and iglewski ) , indicating that the gene could originally stem from a different organism. this hypothesis is further supported by our finding that the cytotoxin gene is absent in three other clinical isolates of pseudomonas aeruginosa as evidenced by southern analyses (fig. a, b) . even after pcr-cycles (using oligonucleotides binding immediately upstream and downstream from the coding region and ng of chromosomal dna) these other strains failed to produce a signal in southern blotting. in addition, northern blot analyses of r n a from the individual strains also indicated the absence of cytotoxin-specific transcripts (data not shown). the open reading frame was followed by two inverted repeat structures indicated by divergent arrows in fig. . the free energy values (tinoco et al. ) of these stem-loop structures, - . k j/tool and - . kj/mol, suggest that they could function as transcription-termination signals. northern blot analyses of r n a from strain revealed that the cytotoxin-specific m r n a had a size of about nucleotides (data not shown). taken together, these data support the conclusion that the cytotoxin gene is transcribed into monocistronic mrna. to test the properties of the cloned gene product, we expressed the gene in vitro or in eseherichia coli and compared the properties of the products with those of unlabeled or [ i] labeled cytotoxin, as isolated from pseudomonas aeruginosa. for combined in vitro transcription translations, we cloned the coding region from the ecorv site (cleavage after position of the coding region) to the psti-site into a modified psp -vector system providing an atg codon for initiation of translation. the resulting construct, poe ep , yielded m r n a encoding a polypeptide of , mr which lacked the three n-terminal amino acids of the toxin and contained translation of the rna in rabbit reticulocyte lysate produced a major polypeptide of , mr (fig. a , lane ). this molecular species had an electrophoretic mobility that was indistinguishable from material isolated from intact pseudomonas aeruginosa cells (compare lanes and ). as demonstrated by western blotting, the , intracellular form of the cytotoxin (lane ) migrated clearly slower in sds-page than the , material that was isolated from autolysates (lane ). puls-chase experiments of [ s s]methionine labeled sister cultures of pseudomonas aeruginosa did not reveal a conversion of the , species into the , species (data not shown) indicating that the putative processing step had to occur during autolysis of the bacteria. expression of the cytotoxin gene in escherichia coli was inducible with iptg (compare lanes and in fig. b) , again yielding material that migrated like the non-processed form of the cytotoxin in sds-page (compare with lane ). this material was clearly nontoxic in the granulocyte lysis assay (fig. a) . as shown in lanes and of fig. b , treatment of escherichia coli lysates with tryt~sin converted the , species into two smaller species of , and , (lane ). concomitantly a rapid increase in toxicity was observed (fig. b) , indicating that the removal of the to see whether this proteolytic processing step altered the binding properties of the cytotoxin to cellular receptors, we performed binding studies of the in vitro synthesized cytotoxin derivative and compared it with iodinated cytotoxin as derived from pseudomonas aeruginosa autolysates. binding of the cytotoxin to membrane preparations was assessed by co-sedimentation of the radiolabeled cytotoxin with the membranes through a sucrose cushion of neutral ph. the results are summarized in fig. . no difference was detected in the binding properties of the in vitro synthesized full-size cytotoxin and the processed cytotoxin. in both instances binding was reversible by the addition of a -fold excess of unlabeled cytotoxin (data not shown). however, binding apparently involved only attachment to peripheral binding sites, since a significant amount of labeled material fig. . toxic]ty assays of escherlchta colt derived cytotoxin on granulocytes before (a) and after (b) treatment with trypsin eluted from the membranes, when the pellet fraction was resuspended and re-sedimented through the sucrose cushion (compare lanes and of fig. ) . furthermore, no co-sedimentation of the labeled material was observed when the sucrose was made up in buffer of ph . , again indicating that the bound material was not converted into an intrinsic membrane protein. it is clear, however, that such observations have to be confirmed by experiments involving binding to intact cells. we have established the sequence of a pore-forming cytotoxin from pseudomonas aeruginosa by determining the amino-terminal amino acid sequence of the purified protein and sequencing of the structural gene, as identified by a pool of synthetic oligonucleotides. the cytotoxin sequence did not reveal a significant sequence similarity with any other known protein. it is important to note that no proteolytic processing of the n-terminus of the protein occurs during or after bacterial autolysis. as generally observed with procaryotic polypeptide carrying an asparagine residue in position , the methionine residue is retained in the mature toxin molecule (ben-bassat and bauer ) . in agreement with a previous report ) were incubated with plasma membrane preparations and sedimented together with the membranes through a sucrose cushion at the ph indicated (mayer et al. ). the pellet fractions (lanes , , , , and ) and tca-precipitable material from the supernatant fractions (lanes . , , , and ) were analysed by sds-page. samples in lanes and , and and are derived from a second centrifugation step (scharmann ) indicating that the cytotoxin was released from the bacteria only after several days of growth, the molecule lacks a secretory signal. within the n-terminal domain, a remarkable homology to a pentapeptide consensus sequence (tonb-box), commonly found in outer membrane receptor proteins of the escherichia coli iron transport system, was detected. as yet, the tonb-box was found exclusively in all proteins that function in a tonb-dependent manner . interestingly, this group of proteins contains also some colicins known to kill closely related bacteria by pore formation. uptake of such colicins by the target cell occurs in a receptor mediated and tonb-dependent process . recent modifications of the tonb-box from the fhua receptor by site-directed mutagenesis (sch ffier and braun ) have shown that a replacement of the va residue by aspartic acid only weakened the colicin m sensitivity of the escherichia coli strain indicating that the interaction between the fhua receptor and the tonb protein was not completely abolished. at present, we do not know whether the cytotoxin serves a colicin-like function for pseudomonas aeruginosa, the molecular weight of the cytotoxin purified from bacterial autolysates was , as determined by sds-page. this material migrated clearly faster than the , mr species obtained by in vitro transcription/ translation or by expression in escherichia coli. although the in vitro synthesized material bound specifically to membrane preparations from ehrlich ascites cells, exhibiting properties indistinguishable from the mature [ i] labeled cytotoxim this non-processed form was nontoxic in the granulocyte lysis assay. cytotoxicity clearly required proteolytical processing which in autolysates was mediated by endogenous proteases. trypsintreatment of escherichia coli lysates also restored cytotoxicity. such processing could involve only c-terminal sequences, since identical n-termini were determined by edman degradation and by dna-sequencing. the mechanism by which pore formation through the cytotoxin is induced is far from being understood at the molecular level. we show here that binding to peripheral acceptor sites does not require proteolytic processing and coulton et al. sauer et al. heller and kadner/ pressler et al. lundrigan and kadner griggs et al. krone et al. k ck et al. schramm et al. mankovich et al. also does not involve the n -t e r m i n a l sequences, since the in vitro synthesized c y t o t o x i n had similar binding p r o p e m e s like the m a t u r e molecule. w i t h the c y t o t o x i n gene at h a n d and the d e v e l o p m e n t o f various deletion m u t a n t s t h e r e o f further studies on the pore f o r m a t i o n process can n o w be u n d e r t a k e n . appendix. while this manuscript was in preparation. hayashi et al. ( ) published their data on the nucleotide sequence and the expression of the cytotoxin gene. the authors also came to the conclusion that cytotoxlcity was posttranslationally generated by proteolytic cleavage. tightly regulated tac promoter vectors for the expression of unfused and fused proteins in escherichia coll production of cytotoxin by clinical strains of pseudomonas aeruginosa amino-terminal processing of proteins ed) molecular basis of viral and microbial pathogenesis a monoclonal antibody against a -k golgi membrane glycoprotein protein fusions of fi-galactosidase to the ferrichromeiron receptor of escherichm coli k- sequence determinatmn". in. needleman sb (ed) protein sequence determination heyningen we van ) staphylococcal leucocidins cloning and promoter identification of the iron-regulated cir gene of escherichla coll pseudomonas aerugmosa cytotoxin: the nucleotide sequence of the gene and the mechanism of activation of the protein nucleotide sequence of the gene for the vitamin b receptor protein in the outer membrane of escherichia coll electron-transferring enzymes in the plasma membrane of ehrlich ascites tumor cell the detection and classification of membrane-spanning proteins pseudomonas aeruginosa cytotoxin: periplasmic localization and inhibition of macrophages primary structure of colicin m, an inhibitor of murein biosynthesis characterization of the pcol v-k encoded cloacin dfi aerobactin outer membrane receptor protein ofescherichia coli: isolation and purification of the protein and analysis of its nucleotide sequence and primary structure a simple method for displaying the hydropathlc character of a protein nucleotide sequence of the gene for the ferrienterochelin receptor fepa in escherlchia coll purification ofa cytotoxic protein iyom pseudomouas aeruginosa interaction of pseudomonas aerugblosa cytotoxin with plasma membranes from ehrlich ascites tumor cells cytotoxic protein from pseudomonas aeruginosa: formation of hydrophilic pores in ehrlieh ascites tumor cells and effect on cell viability molecular cloning: a laboratory manual organization of the colicin i b gene membrane integration and intracellular transport of the coronavirus glycoprotein el, a class iii membrane glycoprotean ausubel fm ( ) physical and genetic characterization of symbiotic and auxotrophic mutants of rhizobium meliloti induced by transposon tn mutagenesis a new pair of m vectors for selecting either dna strand of double-digest restriction fl'agments ecology, clinical significance, and antimicrobial susceptibility of pseudomonas aerugo~osa coronavirus glycoprotein el, a new type of viral glycoprotein construction of improved m vectors using oligodeoxynucleotide-directed mutagenesis gen-etjcs of the iron dicitrate transport system of escherichia colt a conformational preference parameter to predict helices in integral inembrane proteins dna sequencing with chain-terminating inhibitors ferric-coprogen receptor fhue of escherichia coll. processing and sequence common to all tonb-dependent outer membrane receptor proteins formation and isolation of leucocidin from pseudomonas aeruginosa transport across the outer membrane of escherwhia coti wa the fhua receptor is regulated by the tonb protein of the cytoplasmic mernbrane nucleotide sequence of the cohcin b activity gene cba: consensus peptapeptide among tonb-dependent colicins and receptors improved estimation of secondary structure in ribonucleic acids a set of synthetic oligodeoxyribonucleotide primers for dna sequencing in the plasmid vector pbr codon usage in pseudomonas aeruginosa acknowledgements. we thank v. braun for valuable discussion and for drawing our attention to the presence of a tonb-box within the cytotoxin sequence. we are grateful to g. kielweln for supply, a. bauernfeind and r. onsorg. for typing of the pseudomonas aeruginosa strain , and r. jungblut for ehrlich ascites plasma membranes. this work was supported by the wilhelm-sander-stiftung, neustadt/donau (frg), to f. l., and by grants from the deutsche forschungsgemeinschaft (sfb and nie - / ). this work was part of the phd-thesis of g. o.-e. key: cord- -kmluql h authors: eibl, martha m.; wolf, hermann m.; fürnkranz, heinz; rosenkranz, alfred title: prophylaxis of necrotizing enterocolitis by oral iga-igg: review of a clinical study in low birth weight infants and discussion of the pathogenic role of infection date: journal: j clin immunol doi: . /bf sha: doc_id: cord_uid: kmluql h necrotizing enterocolitis, a severe gastrointestinal disease in the neonatal period, affects primarily premature infants. perinatal complications that predispose the neonate to systemic hypoxia are frequent in infants with necrotizing enterocolitis. ischemia of the intestinal mucosa may facilitate the invasion of enteric microorganisms in stressed low birth weight infants. geographical and temporal clustering of outbreaks of the disease and the termination of epidemics by standard infection control underline the importance of infectious agents in the development of this disease. several studies have established the immunoprotective effect of orally administered antibodies against infection of the gastrointestinal mucosa in children and adults. anecdotal evidence suggested that feeding of human immune globulin might have a positive effect on the incidence of necrotizing enterocolitis in premature infants. this paper reviews a prospective, randomized, controlled trial of the efficacy of an oral immune globulin preparation (published in detail in thenew england journal of medicine, vol. , pp. – , ) and discusses the pathogenic role of infection in necrotizing enterocolitis. necrotizing enterocolitis (nec) is a severe gastrointestinal disease and an important cause of morbidity and mortality among premature, low birth weight infants ( ) . the annual incidence of nec lies between . and . % of all admissions to a neonatal intensive care unit ( ) ( ) ( ) . in a retrospective study reviewing years' experience with patients, institute f immunology, university of vienna, vienna, austria. glanzing children's hospital of the city of vienna, vienna, austria. % of patients developed nec within the first days of life, the most common age of onset of nec being days, with the median at the seventh day of life ( ) . the disease has a considerable mortality which lies between and %, depending on birth weight, maturity, and coexisting medical problems ( ) . clinically, nec presents within a broad spectrum ( , ) . early unspecific signs may be recurrent unexplained apnea, bradycardia, temperature instability, lethargy, poor feeding, and irritability. specific abdominal signs indicative of nec include abdominal distension, diarrhea, gastric retention, emesis, and macroscopic or occult gastrointestinal bleeding. a benign clinical course with minimal gastrointestinal signs and symptoms may lead to complete recovery. however, in case of progression of the disease with unstable vital signs that resemble sepsis, perforation of the intestine, or obstructive pattern on abdominal radiograph, patients require aggressive medical and/or surgical therapy. the disease affects primarily the terminal ileum and ascending colon. pathological examination reveals mucosal edema, intramural hemorrhage, gangrene leading to pseudomembranous mucosal necrosis without inflammatory response, and peritonitis. histologically, the disease is characterized by transmural "bland" necrosis within the gastrointestinal tract and abnormal bacterial intestinal gas formation (i.e., intramural pneumatosis intestinales). as a confirmation of the clinical diagnosis in the absence of histologic examination, a typical abdominal roentgenogram demonstrates abnormal intestinal gas formation such as pneumatosis intestinales, intrahepatic venous gas, or free intraperito-neal gas (due to bowel perforation following distension). important risk factors for nec are prematurity and low birth weight ( , ) . eighty to % of cases of nec occur in infants less than weeks' gestation ( ) . oral alimentation has also been associated with the development of nec. ninety to % of patients have been fed formula, banked human milk, or a combination of these ( , , ) . in addition, perinatal complications such as cesarean section, birth asphyxia, respiratory distress syndrome, umbilical vessel catheters, low -or -min apgar score, patent ductus arteriosus, need for exchange transfusion, and twin birth have been described as risk factors for the development of nec ( , ). as can be seen from the multitude of risk factors for the disease, the pathogenesis of nec is most likely multifactorial. both noninfectious and infectious risk factors ( ) might be important for the development of the disease, as a variety of both bacterial and viral pathogens has been associated with outbreaks of nec (reviewed in refs. and ) . no effective prophylaxis of nec has been described. the use of antibiotics as a prophylaxis of nec has been proposed, but the results of several studies were not conclusive. reports of the possible benefit of prophylactic oral administration of aminoglycoside antibiotics (i.e., kanamycin, gentamicin) ( , ) could not be confirmed in two other studies ( , ) . the pressure of emergence of resistant microorganisms caused by the prophylactic use of antibiotics has been heavily criticized ( ) . other possible adverse effects of the aminoglycoside antibiotics include direct gastrointestinal injury and systemic side effects. this report discusses the importance of infectious factors in the development of nec and reviews the results of a prospective, randomized, controlled trial published in detail in the new england journal of medicine ( ) . there we described the effective prophylaxis of nec by administration of an oral iga-igg preparation in low birth weight infants for whom breast milk from their mothers was not available. geographical and temporal clustering of cases of nec ( , ) , evidence for nosocomial transmission of the disease ( ), and the termination of "epidemics" of nec by strict infection control measures designed to interrupt fecal oral spread of an unidentified agent ( ) strongly support the importance of infectious agents in the pathogenesis of nec. a variety of infectious organisms by their nature is likely to invade susceptible damaged bowel and/or produce large amounts of endotoxin. this probably accounts for the general experience that different infectious agents might play an important role in the development of clinical nec. although clustered cases of nec frequently show positive blood cultures in one institution, no consistent single organism could be associated with outbreaks of the disease. a wide range of bacterial [e.g., klebsiella ( ), salmonella ( ), clostridia ( - ), and nonenteropathogenic strains of escherichia coli ( )] as well as viral [e.g., human enteric coronavirus ( ), rotavirus ( )] pathogens has been associated with nec and was cultured from blood, stool, or peritoneal fluid or identified in samples of resected patient tissue. in stressed low birth weight infants, clinical conditions associated with perinatal systemic hypoxia might result in mucosal ischemia of the intestine due to a reflex redistribution of cardiac output at the expense of sympathetically innervated organs such as the intestine. together with an underdevelopmerit of gastrointestinal immune protection in newborn infants, defects in the integrity of the intestinal mucosa might facilitate the invasion of the damaged intestinal mucosa by enteric microorganisms, resulting in the clinicopathologic features seen in nec. animal experiments support this theory. in an animal model of nec (i.e., neonatal rats) induced hypoxia and cold stress produce a disease similar to neonatal nec when the experimental animals are infected with klebsiella ( ). however, rats whose enteric flora contains an insignificant number of gram-negative organisms do not develop disease when exposed to similar stress. reviews of the gastrointestinal immunologic defense mechanisms of human neonates generally describe a lack of locally produced antibodies (secretory iga, i.e., dimeric iga covalently linked to the secretory piece) in the gastrointestinal tract of full-term as well as premature neonates ( ). in this condition of inadequate local immunoprotection, alternative mechanisms must function to inhibit overgrowth of potentially pathogenic intestinal flora and prevent host invasion. strong evidence has accumulated for the antiinfectious effect of breast feeding ( , ). the intestinal flora of breast- s eibl, wolf, fi rnkranz, and rosenkranz fed and formula-fed infants differs, with a prevalence of apathogenic bacteria in the intestine of breast-fed neonates ( , ). in preterm infants gastrointestinal infection due to enteropathogenic e. coli and salmonella could be prevented by oral administration of colostrum ( ). although potentially pathogenic bacteria were isolated from the feces of some of the infants, they did not cause illness. it appears likely that while the excretion of microorganisms did not change substantially, colonization of the gut could be avoided, suggesting that the protective effect was brought about rather by avoiding colonization than by providing antitoxic immunity. e. coli antibodies have been reported to prevent intestinal disease caused by diarrheagenic e. coli. the surface of enterotoxigenic e. coli contains a heat-labile surface antigen that has pilus-like morphology and is essential for bacterial adherence and colonization of the intestinal mucosa [colonization factor antigen (cfa)]. as demonstrated by electron microscopy, specific anti-cfa antibodies agglutinate the piti and prevent diarrhea normally seen after inoculation of virulent cfa-positive e. coli into the small intestine of baby rabbits ( ). accordingly, antibodies provided by breast feeding may protect infants against clinical gastrointestinal infection. protection against cholera in breast-fed infants is correlated with the breast milk levels of iga antibodies against vibrio cholerae lipopolysaccharide and enterotoxin antigens ( ). breast milk iga inhibits v. cholerae or e. coli enterotoxin-induced diarrhea in the rabbit ileal loop model ( ). secretory iga from human colostrum can also neutralize the cytopathic effect of clostridium difficile toxins a and b both in vitro and in suckling mice ( ). consistent with the important role of gastrointestinal infection in the pathogenesis of the disease, nec has been shown to occur very infrequently in breast-fed infants. furthermore, breast feeding offered complete protection against experimental nec induced by infection with klebsiella in conjunction with hypoxia in neonatal rats, while animals receiving formula feeding developed the disease ( ). iga-igg prepar.ation previous anecdotal evidence by others suggested that feeding of human immunoglobulin (ig) intended for intramuscular use might have a positive effect on the incidence of nec in premature infants ( ). a prospective randomized clinical trial reported in detail in the new england journal of medicine ( ) was carried out in low birth weight infants for whom breast milk from their mothers was not available. the purpose of the study was to investigate whether feeding of an oral iga-igg preparation to low birth weight infants for whom breast milk is not available can effectively prevent nec. the oral iga-igg preparation was prepared from human serum, cohn fraction ii (igabulin, kindly supplied by immuno ag, vienna, austria). nine different lots were used during the study, which contained predominantly monomeric iga ( %) and igg ( %) ( table i) . as determined using standard techniques (hemagglutination inhibition, neutralization, radioimmunoassay, indirect immunofluorescence, bacterial agglutination), the preparation contained high titers of antibodies against a multitude of potential pathogens (bacterial toxins such as pertussis, tetanus, and diphtheria; viruses such as poliovirus, coxsackie virus, rotavirus, and echovirus). in addition, iga and igg antibodies against bacteria that have been associated with outbreaks of nec such as e. coli, klebsiella, salmonella, enterobacter cloacae, and clostridia could be demonstrated (for a detailed characterization of the antibody activity, see ref. ) . during a period of years all infants with a birth weight between and g who were admitted to our hospital were enrolled in the study if breast milk from their mothers was not available and if the parents gave informed consent. a total of infants was enrolled in the study and randomly assigned to one of two groups. starting within the first day of life, infants in the treatment group (n = ) received mg of the oral iga-igg preparation per day in three or more individual doses as a supplement to their feeding. infants in the control group (n = ) received infant formula alone or infant formula plus pasteurized, pooled human milk. the duration of the study was days. two hundred thirty-four infants ( in the iga-igg treatment group and in the control group) were withdrawn during the first week of the study because breast milk from their mothers became available. twenty-one control infants were excluded during weeks to of the study because of violations of the study protocol or because breast milk from their mothers became available. one hundred seventy-nine infants who completed the study ( treated infants and control infants) were evaluated in great detail. iga-igg treatment was accepted by all infants without untoward effects on pulse rate and body temperature; leukocyte, erythrocyte, and platelet counts; white-cell differential count; hematocrit and hemoglobin; serum levels of liver enzymes alt and ast; and serum levels of crp and the complement components c and c . no evidence for the transmission of viral agents or anaphylactic side effects caused by the oral iga-igg could be found. in addition, no increase in the serum levels of iga or igg resulting from resorption of oral immune globulin through the intestinal tract could be observed. for a limited period of the study, serum levels of igm and igg seemed to be lower in the iga-igg-treated infants than in the controls (table ii ) and the percentage of infants with serum iga > mg/dl also appeared to be slightly higher in the control infants ( . % in the third week of the study, as compared to . % in iga-igg-treated infants). this transient increase in serum ig levels might reflect the higher exposure of control infants to environmental antigens through the intestinal tract. as the most significant effect of iga-igg treatment, no case of nec occurred in the treated infants who completed the study. in comparison, cases of nec occurred in the control infants for whom breast milk did not become available during the study (p = . ). the clinical diagnosis of nec was confirmed by typical findings in the abdominal x rays or histopathologic examination of specimens obtained during surgery or of autopsy specimens in the two children who were deceased. among the total number of infants enrolled in the study, two assigned to the control group developed nec, whereas none of the infants assigned to the iga-igg treatment group developed the disease (i.e., cases of nec in controls, as compared to no case of nec in iga-igg-treated infants; p = . ). in addition, iga-igg feeding seemed to have a slight effect on the occurrence of pneumonia in infants who completed the study. not including infants who died with pneumonia (two controls and one treated infant), the total number of days with clinical symptoms of pneumonia compared to the total number of days of observation in the study group was / in four iga-igg-treated infants with pneumonia. in comparison, seven control infants with pneumonia had clinically symptomatic days in days of observation (p < . ). furthermore, iga-igg feeding seemed to have a beneficial effect on thriving in infants with tow birth weight; e.g., the time required to regain birth weight was . +-- . days in iga-igg-treated infants with a birth weight between and g, as compared to . +__ . days in the controls (mean -se; p < . ). the different incidence of nec in the two groups is most likely due to the administration of the oral iga-igg preparation in the treatment group. the distribution of several risk factors for nec was comparable between treated and control infants: low birth weight, incidence of perinatal complications such as low -min apgar score, cesarean section, respiratory distress syndrome, need for oxygen therapy after birth, incidence of twin birth, use of umbilical venous catheters, the infants' ages at the start of enteral feeding, the rate of progression of feedings, the choice and amount of feeding substance (pasteurized, pooled human milk or infant formula), and the use of antibiotics. that the iga-igg feeding prevented nec in our study has been further confirmed by the experience that, after termination of the study, the incidence of nec among all low birth weight infants admitted to our hospital was again comparable to the incidence observed in the control group. several studies have established the immunoprotective effect of orally administered homologous or heterologous antibodies against infection of the gastrointestinal mucosa in children and adults. bovine milk immune globulin has been used successfully to treat infantile diarrhea due to enteropathogenic e. coli, rotavirus, and cryptosporidium ( - ). oral administration of bovine, e. coli-specific ig is an effective prophylaxis against traveler's diarrhea caused by enterotoxigenic e. coil ( ). in our study, examination of fecal ig in iga-iggtreated infants demonstrated that substantial amounts of orally administered iga and igg lacking a secretory component can resist proteolytic degradation in the gastrointestinal tract ( ) . furthermore, the finding of comparable concentrations of fecal iga in the feces of iga-igg-treated and breast-fed infants (data not shown) suggests that we administered "physiologic" amounts of iga-igg as a substitution for the ig normally provided by breast feeding. these data confirm and extend previous reports by others who noted the recovery of undigested and partially digested, functionally active oral igg in the feces ( , ). analogous to the function of antibodies normally provided by breast feeding, the immunoprotective effect of oral ig (iga and/or igg) on the intestinal mucosa can best be explained by the formation of antigen-antibody complexes in the bowel lumen or on the mucosal surface. this hypothesis is supported by the finding of immune complexes formed between orally administered human serum ig and endogenous rotavirus in immunodeficient patients with viral gastroenteritis ( ). binding of functionally intact oral ig (iga and/or igg) to the antigen (e.g., a bacterial or alimentary constituent) may cause intraluminat agglutination of potentially pathogenic microorganisms, thereby interfering with the colonization of the intestinal epithelial surface and neutralizing bacterial virulence factors or preventing toxic effects of an excess of alimentary protein (i.e., formula feeding) on the intestinal mucosa. dr. padilla lugo: you have good comparative groups in terms of risk factors but i worry about how many of these infants really underwent severe perinatal asphyxia with apgar scores of less than at and minutes and underwent severe metabolic acidosis during the first hours of life? dr. eibl: the apgar scores were comparable in both groups. a little less than half the children had low apgar scores during the first minute. we did not monitor acidosis in these patients, but with respect to the clinical experience, the two groups were absolutely comparable. dr. padilla lugo: i am concerned because we are introducing enteric feeding of this preparation and we are not sure how severely acidotic the babies are before this. eibl, wolf, fidrnkranz, and rosenkranz dr. eibl" we had a long discussion as to whether we should introduce enteric feeding at that early stage, but when we did, we did not see any complications. especially in the beginning we were very careful to watch those babies and we had decided that if we saw any side effects we would change the protocol. we did not see any adverse reactions and i think that early feeding is extremely important because, as you know, most patients develop nec very early in life, before the third day in many cases. i am not sure whether we really need to go on for the days and we are now planning to perform studies of feeding oral immune globulin for shorter periods of time. dr. sorensen: i realize your control group and patient group were the same with regard to the factors you mentioned, but if you look at the six patients in the control group who developed nec, was there anything different about them or were they just run-of-the-mill patients? dr. eibl: although we tried very hard to find some predictive characteristics in these patients, we could not. dr. polmar: in the course of this study, did you have the opportunity of systematically looking at the virology and bacteriology of the stools in the treated and untreated groups and is there any modification and colonization in these patients? dr. eibl: in the course of this study we did not look at these parameters. we were uncertain whether this type of treatment would work when we started this study and we decided that we would conduct additional evaluations once we determined that this type of treatment is effective. we have no data on that as yet. dr. wasserman: this study was not blinded. is that correct? dr. eibl" that is correct. dr. wasserman: there was no control treatment, just a control group? dr. eibl" yes. dr. wasserman: many people have the impression that the type of infant feeding in the first week of life can impact on the development of nec, specifically the quantity of each individual feeding or perhaps the rate of the feeding. since your study was not blinded, how were you able to assure that both groups were fed in comparable ways? dr. eibl" we have tried to analyze the quantity of feeding and also the addition of pooled human milk, and we could not find any difference between the two groups, but i agree that blinded studies have to follow. from the data we obtained with respect to the feeding, no difference was found. dr. ballow: did you notice any difference in the two groups in terms of residuals in the stomach, abdominal girth, bloating, number of stools, and so forth? dr. eibl: we looked at these factors very carefully and we did not find any differences. the babies tolerated the feeding. dr. steihrn: did you give just a single dose of iga? dr. eibl dr. eibl: we divided it into at least three doses, and in some of the babies we divided it into six doses. dr. steihm: do you think that the serum iga from which this material is derived gives it any advantage over igg? we all know that secretory iga resists digestion, but does serum iga resist digestion, so that if one were to do a second study, maybe igg could be used rather than an iga/igg preparation? dr. eibl: we believe but we cannot yet prove that iga has an advantage, and i think a great advantage, over igg because it is known that iga eliminates the infectious agents without causing inflammation. i think that this point is extremely important but we have no proof at the moment except that the iga goes through the intestine, at least in part. i think this was a very important point to demonstrate and we looked at a fairly large number of babies on repeated occasions and showed that our preparation goes through the entire intestinal tract, which proves that at least part of it is not digested. dr. golclblum: i was interested to see that you had so much polymeric iga in the preparation that you gave. presumably some of that could be converted into secretory iga in the gastrointestinal tract because the infant does produce a lot of presecretory component as well as (probably) secretory igm. so some of those molecules could be converted and one could look at the fecal samples to see if there were selective survival of the secretory over nonsecretory iga. another selective advantage might be for iga and iga . iga is more susceptible to bacterial proteolysis or specific iga proteolysis, and presumably since your material came from serum, it would be about % iga , whereas human milk would contain an approxi-mately equal mixture of iga and iga . that could also be looked at in the fecal samples. how did you evaluate the iga in the fecal samples? there is a real potential for technical bias there because if you used radial immunodiffusion, for instance, the cleaved molecules would be overread by a large factor. dr. eibl: we used radial immunodiffusion and we have clearly noticed several circles of precipitate in this system. we have also checked the size of the molecules and found that there is a number of cleaved molecules but we could also find intact molecules. dr. kamani: what were the immunoglobulin levels in the two groups of patients? dr. eibl: the immunoglobulin levels in both groups were comparable. if anyttiing, they were minimally lower in the control group than in the treatment group, but there was no significant difference. we did not get any indication of absorption into the cell. dr. heiner: my understanding is that if you include iga in cohn fraction ii, you have to alter the usual isolation procedures, and that opens the door a little bit to including viruses. certainly igg that is pooled would contain antihepatitis virus and that may protect against hepatitis, but what about the possibility of hiv or some other viruses getting into that preparation? i wonder how this is prepared and whether they really looked for the inclusion of viruses. dr. eibl: at the beginning of our study we did not worry because there was a very strong feeling that cohn fraction ii was safe as a starting material. during the middle s some reports of viral transmission did cause worries, and for this reason an additional step of viral inactivation was added to the preparation of the product. that is why we did not treat babies for about a -year period, and in this -year period we saw the same incidence of nec that we had seen before. we started iga/igg treatment again at the beginning of this year with the preparation that has the additional step, which has been very well proven to inactivate both hiv and a number of model viruses. in following the babies from this study we did not observe any indication of viral transmission in any single case. we did not see hiv antibodies and we did not see pathological levels of liver enzymes. necrotizing enterocolitis neonatal necrotizing enterocolitis: a nine-year experience. i. epidemiology and uncommon observations necrotizing enterocolitis necrotizing enterocolitis epidemiology of necrotizing enterocolitis: a case control study acute necrotizing enterocolitis in infancy: a review of cases perinatal events and necrotizing enterocolitis in premature infants necrotizing enterocolitis: controlled study of years' experience in a neonatal intensive care unit neonatal necrotizing enterocolitis how contagious is necrotizing enterocolitis? pathogenesis and prevention of necrotizing enterocolitis: a hypothesis based on personal observation and a review of the literature a prospective controlled trial of oral kanamycin in the prevention of neonatal necrotizing enterocolitis oral gentamicin therapy in the prevention of neonatal necrotizing enterocolitis: a controlled double-blind trial alterations in stool flora resulting from oral kanamycin prophylaxis of necrotizing enterocolitis gentamicin in prophylaxis of neonatal necrotising enterocolitis necrotizing enterocolitis (editorial) prevention of necrotizing enterocolitis in low-birth-weight infants by iga-igg feeding clustering of necrotizing enterocotitis: interrup key: cord- -jcj nqfu authors: tutschka, peter j. title: the use of immunoglobulin in bone marrow transplantation date: journal: j clin immunol doi: . /bf sha: doc_id: cord_uid: jcj nqfu the role of bone marrow transplantation is to restore lymphohematopoietic function of a recipient whose marrow has been destroyed, either by disease or by the preparative therapy employed in an attempt to eradicate the patient's lymphohematopoietic malignancy. the restoration of lymphohematopoietic function through the donor graft occurs in stages, requires several months, and is often not completed until to years after transplantation. these sequential steps of immuno-reconstitution are associated with a number of definable and predictable immune deficiencies and seem to be responsible for the pattern of complications that emerges after transplantation. most of these complications are either the result of, or associated with, infections that also occur in an almost predictable pattern. in the various phases of immune deficiency following sequentially after transplantation, the humoral immune system is greatly affected, thus raising the possibility that passively administered antibodies in the form of immune globulin therapy might be beneficial in all phases of the marrow transplant procedure. this paper attempts to summarize the use of immune globulin preparations in clinical bone marrow transplantation, showing the rationale for and some of the results of therapeutic immune globulin administration. intravenous immune globulin (iv g) is now widely used in bone marrow transplantation, despite the fact that critical randomized, controlled studies necessary to permit utilization on a scientific basis have largely not been done yet. this paper attempts to give an overview of the use of immune globulins and the rationale for their use in clinical marrow transplantation. prior to bone marrow transplantation the recipient's marrow must be completely eradicated. the hematopoietic system and the immune system are s then rebuilt, almost in their entirety. this rebuilding of the lymphohematopoietic system does not occur immediately; instead, it goes through several separate, sequential phases which are associated with an almost predictable pattern of complications, especially infectious complications. in the preengraftment phase, pancytopenia is the most important event. this is followed by an early postengraftment phase, characterized immunobiologically by acute graft-vs-host disease (gvhd) and severe combined immunodeficiency. the late postengraftment phase is characterized by chronic gvhd and immunodeficiency but of a more humoral type. almost predictably we first see bacterial infections followed by nonbacterial, viral infections, particularly interstitial pneumonias. later, there are some well-defined infections with encapsulated organisms, the latter sometimes even very late after bone marrow transplantation. in the preengraftment phase there is complete aplasia with absolute neutropenia and a severe lymphopenia. immunoglobulin levels decrease to less than % of normal about weeks after bone marrow transplantation. the patient's defenses have also been weakened by severe impairment of the physical barrier functions due to the very aggressive preparative therapy necessary for bone marrow transplantation. this gives rise to infections derived primarily from the bacterial microflora reservoirs of the patient, such as gram-negative bacteria from the gastrointestinal tract and grampositive bacteria from the integument such as staphylococcus epidermidis from the skin. in recent experience gram-positive bacteria have replaced gram-negative bacteria as the dominant sources of infection. in to % of patients in the preengraftment phase bacteremia is present, usually associated with sepsis and circulatory collapse. there are several theoretical ways to prevent those early infections. first, one could try to develop less toxic preparative regimens so that the barrier function was less impaired. the preparative regimen that we developed in our center is one in which total-body irradiation (tbi) is replaced by a seemingly less toxic agent such as busulfan ( ). such a regimen permits a very short period of aplasia (for only to days), which markedly reduces the danger to the patient. second, one could try to reduce the patient's own microflora reservoirs by providing a gnotobiotic, highly restricted environment. it has been shown that patients with aplastic anemia who were placed in such an environment had a significantly increased probability of survival following bone marrow transplantation ( ) . third, one could try to bolster the humoral immunity by passively administering antibodies against the relevant microorganisms. commercially available immune globulin preparations do indeed contain antibodies against a wide range of pathogens and toxins, in fact against virtually all the pathogenic organisms that are important for infections in the transplant setting. the activation of the complement system by the administration of immune globulins will lead to increased phagocytosis and an increased granulocytochemotaxis. immune globulins may also prevent bacterial attachment on the mucosal surfaces because the receptor sites will be occupied by the infused antibodies. furthermore, some reasonably wellcontrolled studies have shown that passive immune globulin therapy is effective for burn patients as well as for trauma patients ( , ) . in our own program we have tried to utilize all the accepted measures for infectious prophylaxis. we studied consecutive transplant patients for whom we substituted busulfan in place of tbi. we used selective body decontamination in an ultraclean environment and administered ivig at a dose of mg/kg every weeks for a total of months. with this regimen the incidence of bacteremia was only . % and almost half of the patients developed no fever during aplasia. unfortunately, this study was not a controlled one and the important question if ivig given systemically wilt reduce infectious complications during aplasia remains unanswered. several placebo-controlled trials are under way in a number of transplant centers to resolve this matter. from the viewpoint of the immunobiologist, phase ii, the phase early after marrow engraftment, is the more important period. a number of critical immune events take place in this second phase. by this time host b-cell immunity has disappeared completely but donor b-cell immunity has not yet been reestablished. adoptive t-cell donor immunity (due to mature cells that were transferred with the bone marrow) has disappeared as well. the function of the helper t cells is markedly impaired, either because the stem cells have not yet developed into the appropriate mature t cells or because the patients are receiving immunosuppressive agents. the cytotoxic effector function is also impaired in these patients. in addition to these difficulties, the donor immune system must reorient itself in a different mhc-restriction setting. furthermore, nonspecific suppressor cells will appear to days after transplantation, resulting in a global impairment of the immune defense system. acute gvhd might be present, markedly worsening the already present immune defect in the second phase of transplantation. an oversimplified definition of gvhd describes it as an immune attack by donor t lymphocytes on certain host target cells in the gastrointestinal tract, the liver, and particularly, the skin. the resultant cutaneous disease is characterized by discoloration and desquamation followed by severe erythema together with epidermal lysis in which the entire integument is affected. a number of infectious complications are associated with acute gvhd, especially those due to resistant gram-negative bacteria, but also candida infections and gram-positive infections caused by corynebacteria. interstitial pneumonia, a very important infection which is often associated with acute gvhd, is discussed shortly. there is an intricate relationship between gvhd and infections, germ-free rodents which are transplanted in a germ-free environment will not develop gvhd even if they receive a mismatched transplant. conversely, intentional contamination of these chimeric animals will cause gvhd ( ). patients in germ-free environments have a reduced incidence of severe gvhd. furthermore, cutaneous gvhd will develop in areas which have tissue damage, especially if this damage is caused by a virus. finally, viral infections are known to trigger gvhd in rats ( ) . could ivig have a role in preventing gvhd? animal studies, including some from our laboratory, indicate that when antibody against escherichia coli is given systemically to rats, it will reduce gvhd in matched bone marrow transplants. this suggests that ivig might have some influence on gvhd. it is possible that ivig could act as an immune modulator. an fcdependent blockade of reticuloendothelial structures by ivig has been described and studies in animal models have shown that immune globulins can induce antiidiotypic regulation. also on the basis of animal models, we know that suppressorcell function can be restored with the use of ivig. since specific suppressor cells are important in counteracting gvhd, this is another instance in which ivig may play a role, at least in theory. the most important effect of ivig, however, might be an indirect one by which prevention of infections will, in turn, avert the trigger for gvhd. although at the present time gvhd is no longer a major problem in most transplant programs, gvhdassociated viral infections are still of great importance. the two major viral infections in phase i express themselves either as interstitial pneumonia or as a hemorrhagic gastroenteritis not unlike the necrotizing enterocolitis in the pediatric population which is described elsewhere in this issue. the interstitial infiltrate of the early pneumonia quickly spreads over both lungs, often resulting in a complete whitening ~f the lungs which is accompanied by severe adult respiratory disease syndrome (ards). in at least half the cases, cytomegalovirus (cmv) is associated with ards. the incidence of this disease varies between and %, with cmv being responsible for about half of the cases. when cmv is the agent, mortality can range from to as much as %. there are several risk factors for the development of interstitial pneumonia such as tbi (if the lung dose exceeds rads), acute gvhd, increased age of the patient, cmv seropositivity of the patient before the transplant, transfusion of blood products from cmv-positive donors, inability to generate an antiviral cytotoxicity (which is very common in the postengraftment phase), and inability to mount a humoral antibody response. the latter defect is quite important and suggests a potential rote for passive therapy with antibodies. historically bone marrow transplant recipients who have high titers of complement-fixing antibodies to cmv prior to transplant have had a better prognosis for overcoming such a severe viral pneumonia. in the murine model, it could be shown that passive immunization can modify cmv infection. several studies have been carried out to see if passive immunization with antibodies against cmv would prevent interstitial pneumonia. investigators from ucla, minnesota, and sloan-kettering all showed, in reasonably well-controlled studies, that the incidence of cmv interstitial pneumonia was reduced in patients given high-titered antibody preparations compared to that in the control group. this finding triggered numerous other studies, mostly uncontrolled, which can be summarized as follows. ivig is effective in preventing cmv infections in cmv-seronegative recipients who receive cmvseronegative grafts. it is likely to be ineffective in preventing the development of interstitial pneumonia in seronegative recipients who receive seropositive grafts. furthermore, it is likely to be ineffective in cmv-seronegative recipients who receive cmv-seropositive blood products; however, the latter statement is not fully substantiated and a number of studies are in progress to delineate that point. it is likely that immunoglobulin is ineffective in cmv-seropositive recipients who receive either cmv-seropositive or cmv-seronegative blood products. we conducted our own trial with ivig in which patients were enrolled ( ) . slightly more than half of the patients were cmv seronegative. the median observation time was months. all the patients received cmv-negative blood products and were given mg/kg of ivig every weeks for eight administrations. there were no cmv infections and there was no cmv pneumonia in the first group of patients, who were cmv seronegative and had received a graft from a cmvseronegative donor. in the next group of cmvseronegative recipients, who were given a graft from a cmv-seropositive donor, of patients developed viremia or viruria but none of them developed pneumonia. the low incidence of cmv interstitial pneumonia in this group indicated that ivig might be effective in the cmv-seronegative patient even when receiving a seropositive donor graft. unfortunately, ivig was largely ineffective in seropositive patients. of the seropositive recipients, ( %) developed a positive cmv culture and developed cmv pneumonia, which was fatal in cases. when all groups are combined the overall effect of ivig appears impressive: a % incidence of cmv infection and a % incidence of cmv pneumonia, suggesting that ivig was able to reduce the incidence of cmv pneumonia, perhaps even in cmv-seropositive patients. we tried to obtain more definitive information about the role of ivig in seropositive recipients. we were unwilling to do a randomized, placebocontrolled study since we had ethical problems with not treating all our patients with ivig. we speculated that if we were to give ivig to seropositive patients in higher doses and more frequently, we might prevent not only cmv excretion (such as viremia or viruria) but also the development of cmv infection. for these reasons we limited our study to cmv-seropositive recipients and stratified them between two ivig schedules, giving either mg/kg every weeks for months or mg/kg every week for months. if patients became excretors of the virus, they received a dose of mg/kg daily for days. there were patients in the standard group and in the high-dose group. we observed no difference in the number of patients who became excretors-- in the standard-dose group and in the high-dose group. there was no difference in the number of patients that developed systemic disease or in the number of fatalities observed. thus, a higher dose of antibody does not appear to be more beneficial than a lower dose in preventing cmv disease. new strategies need to be developed to overcome the severe problem presented by the cmv-seropositive patient. the treatment of established cmv pneumonia is not very effective. we have learned that ara-a, acyclovir, and tft are not effective in the therapy of this disease, although acyclovir might be effective as a preventive agent. ivig alone is as effective as (l, -dihydroxy- -proxymethyl) guanine (dhpg) alone in treating established cmv pneumonia, but surprisingly, the combination of ivig and dhpg is quite effective, and in a number of studies it has reduced the mortality rate from to - % ( , ) . hemorrhagic gastroenteritis is the other major viral complication in the early postengraftment phase ( ) . the mortality is relatively high ( %) even in the absence of acute gvhd. a number of viruses (such as rotavirus) are associated with hemorrhagic gastroenteritis, but recently cmv is becoming prevalent. about half of the cases of hemorrhagic gastroenteritis in our own patient population are now due to cmv; the remainder are split between rotavirus and adenovirus. effective measures to prevent this syndrome might include the following: strict isolation, effective prevention of gvhd (since gvhd might well set the stage for hemorrhagic gastroenteritis), and possibly therapy with orally administered immune globulin. there might be a rationale for such a therapy if we consider that the gastrointestinal tract is severely injured after transplantation. the preparative therapy as well as gvhd have caused severe mucosal injury. the peyer's patches and other gutassociated lymphoid tissues have been destroyed and must be rebuilt. in the lamina propria iga-and igm-producing plasma cells have disappeared. most importantly the degradation of igg when administered orally is much impaired in such a devastated gut. it has been shown that igg antibody survives passage through the gastrointestinal tract and emerges as an intact molecule. this led us to consider administering ivig orally to patients at risk for hemorrhagic gastroenteritis. we conducted a pilot trial in which patients were given ivig orally at a dose of mg/kg for weeks. prior to administration of ivig we could not demonstrate any igg in the stool. after oral administration of ivig, of patients had considerable amounts of igg, up to mg/dl, in the stool. eighteen patients had greater than mg/dl. only of the patients developed a positive adenovirus culture and patients remained afebrile ( ) . we have just completed a double-blind, randomized study comparing orally administered ivig to placebo. hopefully, the analysis of the study will show that the concept of oral administration of immune globulin has some merit. the immunobiology of phase iii, the late postengraftment phase, is characterized by a continuous impairment of the t helper-cell function, a continuous defect in humoral immunity, and, in particular, the development of chronic gvhd. a number of infections are seen in this posttransplant phase, especially sinopulmonary infections with encapsulated organisms such as streptococcus pneumoniae. initially we thought that the hyposplenism associated with chronic gvhd was responsible for these infections ( ) . however, we considered that there might also be an association with an iggsubclass deficiency and we conducted a small study. igg subclasses were determined in patients. one group of patients showed a marked igg -subclass deficiency with a very high infection rate. twelve of these patients developed infections with gram-positive organisms. another group of patients with no igg -subclass deficiency had a very low infection rate, with only of being infected. studying these patients further we could show that the patients continued to show subclass deficiency even after they resolved the infections. however, it is not only igg but also igg subclass which was markedly reduced ( ). to prevent these late infections one could maintain coverage against gram-positive organisms beyond day i and should maintain gram-positive coverage for an even longer period in patients who demonstrate chronic gvhd. most importantly, one should maintain ivig supplementation beyond day for the first year. in our transplant center we continue ivig supplementation as long as the subclass deficiency persists, not unlike a patient with an inborn iggsubclass deficiency syndrome. utilizing this strategy one can virtually eliminate late gram-positive infections. since there are a number of sequential events in the immunobiology after transplantation which correlate with infectious patterns, it should be possible to develop rational strategies to counteract the various immune defects. the prophylactic and therapeutic use of ivig might have a central role because it is likely to affect all phases of bone marrow transplantation. we know that immune globulins have a beneficial effect in both the prevention and the treatment of viral interstitial pneumonia. it is likely that immune globulin will also have a beneficial effect in the prevention of viral enteritis and in counteracting late subclass deficiency. there may also be some modulating influence on the entire immunobiology of bone marrow transplantation. bone marrow transplantation for leukemia following a new busuifan and cyclophosphamide regimen graft versus host disease and survival in patients with aplastic anemia treated by marrow grafts from hla-identical siblings: beneficial effect of a protective environment clinical use of intravenous immunoglobulins antibody therapy in gram-negative bacterial disease the role of microflora in development of graft versus host disease graftvs-host disease and sialodacryoadenitis viral infection in bone marrow transplanted rats cytomegalovirus (cmv) infection in bone marrow transplant recipients: use of intravenous gammaglobulin as prophylactic and therapeutic agents successful treatment of serious cytomegalovirus disease with ( , -dihydroxy- -propoxymethyl) guanine in bone marrow transplant (bmt) patients the diagnostic, prophylactic and therapeutic uses of monoclonal antibodies to human cytomegalovirus infectious gastroenteritis in bone marrow transplant recipients oral administration of igg in marrow transplant recipients functional asplenia in patients with chronic graftversus-host disease: concise communication igg subclass deficiency and pneumococcal pneumonia following allogeneic marrow transplantation dr. gulati: what has been your experience with autologous transplants? do you need to do all this with patients who are undergoing autologous transplants?dr. tutschka: i do not think so. the incidence of interstitial pneumonia as well as hemorrhagic gastroenteritis is much reduced in autologous transplants-perhaps a quarter of that seen in allogeneic transplants. furthermore, the immune system recovers much more readily after autologous bone marrow transplantation. on the other hand, autologous transplantation patients might provide an excellent target population in which to study more nonspecific effects, such as the reduction of infections during aplasia, because we do not have the compounding variables of gvhd, immune modulation phases, and so on. we are currently not using ivig to the same extent in autologous transplants as we do in auogeneic transplants but i think it is a good study population. key: cord- -oxbquzeg authors: dwenger, a.; beychok, c.; schweitzer, g.; pape, h. c.; röllig, g.; nerlich, m. l.; jonas, e.; funck, m.; zimmermann, t.; albrecht, s.; schuster, r.; lauschke, g.; jaroß, w.; kaever, v.; schmitz, e.; resch, k.; brandl, h.; böhm, w. -d.; beckert, r.; köstler, e.; menschikowski, m.; kacian, d.; lawrence, t.; sanders, m.; putnam, j.; majlessi, m.; mcdonough, s.; ryder, t.; santana rodríguez, j. j.; sosa ferrera, z.; afonso perera, a.; gonzález díaz, v. title: bioluminescence, chemiluminescence date: journal: fresenius j anal chem doi: . /bf sha: doc_id: cord_uid: oxbquzeg nan in the recent years the essential role of granulocytes in the initiation and amplification of the pathomechanisms resulting in the adult respiratory distress syndrome (ards) has been documented [ , - ] . on the contrary, there is only little information about the participation of alveolar macrophages in the ards pathogenesis [ ] and no report on alterations of macrophage functions during the development of the ards. bronchoalveolar lavage fluid (balf) of multiply traumatized patients (injury severity score > points; ards and non-ards patients) and of controls (co) was centrifuged at x g, min, °c [ , ] . the supernatant was analysed for/ln-acetyl-gtucosaminidase (fl-nag) spectrofluorimetrically and for elastase by enzymeimmunoassay [ ] . the cell pellet was resuspended in phosphate buffered saline and the cell count was determined after staining with tfirk's solution and the cell pattern by the use of a cytospin [ ] . for the separation of granulocytes (pmnl) and alveolar macrophages (am ) the cell resuspension was centrifuged on percoll ( . g/ ml) at x g, min, ° c. from citrated blood granulocytes were isolated by a two-step discontinuous percoll gradient ( . / . g/ml) centrifugation at x g, min, ° c. the zymosan-induced and luminol-enhanced chemiluminescence response (cl) of granulocytes and macrophages, respectively, was determined with a six-channel biolumat lb [ , ] . urea was determined enzymatically in the plasma and the balf [ ] and the concentration of proteins/cells in the epithelial lining fluid (elf) was calculated according to cel f : cbalf " curea_plasma/curea_balf statistical analyses were performed by the student's nonpaired t-test. for calculation and graphical presentation the results of each days were combined. the posttraumatic courses of alveolar neutrophil and macrophage counts as well as the cell patterns of the bronchoalveolar lavage fluids for ards and non-ards patients are listed in table . figure depicts the chemiluminescence response of isolated blood and alveolar neutrophils (a) and alveolar macrophages (c) of multiply traumatized patients as well as the secretion activity of alveolar neutrophils (b) and alveolar macrophages (d) for ards and non-ards patients after multiple trauma. in the posttraumatic course the total alveolar cell count increased for ards patients and decreased for non-ards patients for up to days, predominantly caused by the neutrophil influx. there was an early (days / ) pathological elevation of the neutrophil fraction above normal values ( < % neutrophils) that further increased for ards patients and decreased for non-ards patients, whereas the alveolar macrophage fraction ( % for normals) exhibited the corresponding inverse behaviour. concerning the chemiluminescence response against zymosan, blood neutrophils were hyperactive and balf derived _+ sem n = (pmnl) n = (am~b), * p < . posttraumatic enzyme secretion activity ( + sem) of alveolar neutrophils b as gg elastase/ pmnl (calculated from gg elastase/ elf/pmnl count/ elf) and alveolar macrophages d as mu fl-nag/ amg~ (calculated from mu fl-nag/ elf/ am~b count/ elf) for ards and non-ards patients neutrophils were hypoactive from the beginning up to day after trauma, whereas alveolar macrophages developed a hyperactive state not before days or . on the contrary, alveolar macrophages were already active in enzyme secretion in the initial posttraumatic course (days / ), especially of ards patients. alveolar neutrophils showed an initially increased enzyme secretion, especially in non-ards patients. the secretory reactivity decreased for both cell types and for both patient groups up to days after trauma. after multiple trauma alveolar macrophages responded with different cellular reactions in different time courses, whereas alveolar neutrophils seemed to have lost most of their metabolic capacity before they invaded into the alveoli. polymorphonuclear leukocytes (pmnl, neutrophils) hyperactivated by multiple trauma release oxygen derived radicals and lyosomal enzymes. these inflammatory mediators can damage endothelial structures of capillaries and, therefore, contribute to the development of multi-organ failure including the adult respiratory distress syndrome (ards) [ , ] . one therapeutical approach to prevent the ards is based on the inhibition of neutrophil functions by prostaglandin e (pgei) [ ] . citrated blood was obtained from donors, pmnl were isolated by percoll gradient centrifugation [ , ] . the oxygen radical production was measured by luminol ( . mmol/ test) and/or lucigenin ( . retool/ test) enhanced chemiluminescence response (cl) (biolumat lb , berthold) in absence or in presence of different stimuli, n-formyl-l-methionyl-l-leucyl-l-phenylalanine (fmlp, sigma; . • - tool/ test), zymosan a (sigma; . mg/ml test), latex (unisphere latex , . gin, serva; gl/ml test), lipopolysaccharide (lps from e. coli serotype no. :b , sigma; ng/ml test), /~-phorbo /%myristate a-acetate (pma, sigma; • ] - tool/ test) and nylon fiber (from leuko-pak leukocyte filter, fenwal, travenol laboratories; rag/test) [ ] [ ] [ ] . all parameters have been measured in dependency on the pge concentration (alprostadil, schwarz pharma ag). the enzyme release was determined by the measurement of the intra-and extracellular elastase activity by the kinetical enzyme test with methoxysuccinyl-l-ala-l-ala-l-pro-l-val-pnitroanilide (bachem) as a substrate and of the /~-n-acetylglucosaminidase (/%nag) activity determined spectrofluorimetrically [ , ] . briefly, neutrophils were isolated from citrated blood and resuspended in minimal essential medium .) and cl response (%; g ..... q) of neutrophils in citrated blood in dependency on the pge concentration. stimulus: mg of nylon fiber (lucigenin-enhanced cl). ± sem; n = . % = cl response ( cpm/ pmnl of the peak maximum) in the presence of the lowest pge concentration. * p < . values vs % values (boehringer) with . % bovine serum albumin to ~ pmnl/ ml. pge was added ( ; ; , and ng/ml) and after min at °c the stimulation was started with fmlp ( . - - tool/ test). after rain at °c the reaction mixtures were centrifuged and the supernatants were analysed for elastase and fl-nag. additionally, an aliquot of the original pmnl suspension was lysed and the enzymes were determined [ , ] . the neutrophil count in blood and of isolated cells was performed by the use of a neubauer hemocytometer after staining with tiirks solution [ , ] . the significance between groups of values were tested by the tests according to wilcoxon and mann-whitney, respectively, and accepted if p < . . the dose-dependent inhibition by pgei of the cl response of isolated neutrophils after stimulation with different stimuli is shown in fig. i the dose-dependent inhibition by pgei of adherence and cl response is shown in fig. d. the correlation coefficient between adherence and cl values was r = . . the fmlp-induced enzyme release (elastase/fl-nag) was %/ . % without pge ; %/ % with ng/ml; . %/ . % with ng/ml; . %/ . % with ng pge /ml test volume ( % = total intracellular enzyme activities). the values represent the means of experiments. the production and the release of oxygen derived radicals and lysosomal enzymes from stimulated polymorphonuclear leukocytes were inhibited by prostaglandin e in a dose-dependent manner. furthermore, regarding the nylon fiber system as an artificial but relevant model for endothelial cell adherence [ ] the observed inhibition by pge of adherence and cl response seems to be of marked pathophysiological importance. since the contact activation/stimulation of neutrophils was inhibited and less inflammatory mediators were produced, less endothelial cell and tissue structure damage can be produced in an in vivo system. the good correlation of adherence and cl production in absence and in presence of pge indicated that the oxygen radical production is nearly exclusively caused by adherence-mediated stimulation and can be inhibited by pge . as a result, pgei may be a drug to prevent inflammationinduced damage of capillary endothelial structures in different disorders, e.g. the adult respiratory distress syndrome. the present study is based upon the theory that polymorphonuclear leukocytes (pmnl, neutrophils) play an important role in inflammatory reactions [ ] . further investigations hypothesize that affection of endothelial cells (ec), mediated by lipopolysac-% control charide (lps)-stimulated neutrophils, is rather caused by oxygen derived metabolites than by lysosomal enzymes [ , ] . in- vestigations, performed with endothelial cells, have shown a respiratory burst stimulation of neutrophils during adherence of neutrophils to ec and amplification of this process by previous lps-priming of neutrophils [ ] . the aim of the present study was to examine, if pge might influence injury to ec, caused by lps-primed neutrophils, and furthermore, if this effect could be explained by a diminished oxygen radical production, measured by chemiluminescence (cl). human umbilical cord vein endothelial cells were harvested according to [ ] . after reaching confluence in rm-medium containing % human serum, endothelial cells were trypsinized onto cover slips (lux scientific corporation) for measurement of chemiluminescence response and were split onto microtiter wells (greiner co) for measurement of cell injury. neutrophils. blood of healthy donors was preincubated for rain at °c with ng lps/ml blood (lps: e. coli serotype : b , sigma co). neutrophils were prepared using percoll density gradient centrifugation according to [ ] , and were resuspended in phosphate buffered saline. , neutrophils were added to , endothelial cells/test. varying concentrations of prostaglandin e (donation of schwarz pharma, monheim, frg) were prepared in . % nac solution. concentrations were , , , , and ng/ml test. chemilumineseenee measurements. production of oxygen derived metabolites by neutrophils was measured by lucigenin enhanced chemiluminescence, which has been measured simultaneously in a six channel biolumat (lb c, berthold, wildbad, frg). chemiluminescence measurements (cpm of peak maximum) of lps-primed neutrophils were performed in the absence and presence of varying concentrations of pge . injury assay. the evaluation for ec damage was based upon in_release from labeled endothelial cells, as described [ ] . statistical analysis. for statistical analysis u-test according to mann-whitney was used. values represent mean ÷/-sem of experiments performed in duplicate. ( l ( ) ( ) ]- the release of toxic oxygen metabolites from sensitised polymorphonuclear leukocytes is an important pathogenetic factor in a series of diseases (ards, mof, myocardial infarction). moreover, toxic oxygen metabolites seem also to play an important part in the formation of necroses in acute haemorrhagic-neerotising pancreatitis. kelemen et al. [ ] found excessive production of toxic oxygen metabolites (mda) accompanied by loss of tissue antioxidative capacity (sod, gsh) in experimentally induced haemorrhagic-necrotising pancreatitis in rats. besides the liver, the pancreas is known to surpass all other organs with respect to radical formation and its antioxidative potential. however, to what extent toxic oxygen metabolites are responsible for the development of mof as a consequence of acute pancreatitis has scarely been investigated as yet. the present study is intended to clarify the question, whether the activation of granulocytes takes place in the pancreas and whether these activated granulocytes are capable of releasing toxic oxygen metabolites which substantially contribute to endothelial cell damage in the respective organs (lung, kidney, liver, small intestine, heart). in addition, the antioxidative effect of mdtq-da was studied in a first in vitro test. following anaesthetization with pentobarbital (nembutal®), acute haemorrhagic-necrotising pancreatitis was induced in dogs by injection of , ml/kg bw of autologous bile. catheters for selective blood sampling were placed in the portal vein (via splenic vein) and in the coeliac artery (via femoral artery). samples were taken within min after placing the catheters, at the moment of bile injection and within , , , and h after the injection of bile. at these times cl response was determined in whole blood and separated granulocytes from the portal vein (i. e. after passage through the pancreas) and the coeliac artery as appears from fig. , whole blood and especially separated granulocytes from the portal vein (to a much lower degree also from the coeliac artery) show a sharp increase in spontaneous (only luminol-enhanced) cl already within i h after injection of bile. the maximum is reached within h after injection, with cl response being much higher in blood and granulocytes from the portal vein than in samples taken from the coeliac artery. within h after injection of bile cl response of granulocytes from the coeliac artery surpasses that of granulocytes from the portal vein. there was no difference in cl response between whole blood from the portal vein and the coeliac artery after h. stimulation with zymosan-activated plasma results in a -fold increase in cl response of whole blood and a , - , -fold increase in cl response of granulocytes. at the same time we found massive activation of complement in the blood, accompanied by the formation of complement split products and their deposition throughout the pancreas. addition of . gg of radical trap (mdtq-da) to each zymosan stimulated whole blood sample reduced cl response by - p.c. following induction of haemorrhagic-necrotising pancreatitis, high quantities of toxic oxygen metabolites are released from pancreatic tissue, contributing to the development of mof. granulocytes are obviously sensitised by activated complement deposited in excessive quantities in pancreatic parenchyma. later on, the release of toxic oxygen metabolites from activated granulocytes persists in a systemic circulation level and becomes independent of the inflammatory process in the pancreas. stimulating agents, such as zymosan, zymosan-activated plasma, or endotoxin drastically increase the release of toxic oxygen radicals from sensitised granulocytes, causing an even greater damage to the organs. that is why chemiluminescence response of granulocytes is much higher in systemic blood than in blood from the portal vein after h. our study gives rise to the assumption that complement-induced activation of granulocytes and the release of toxic oxygen metabolites are essential pathogenetic factors in the development of mof as sequela of acute pancreatitis. we believe that the prognosis of this disease can be considerably improved by therapeutic use of antioxidants. macrophages are crucially involved in the regulation of various immune reactions. they represent a heterogeneous group of cells not only due to their different tissue origin but even more attributable to distinct activation stages during which they acquire additional receptors, metabolic functions and capacities. reactive oxygen intermediates (roi) such as the superoxide anion radical (oy) or hydrogen peroxide (h oz) contribute to the development of cytotoxic and antimicrobial activities and also play an important role in inflammatory processes [ ] . the amount of roi production strongly correlates with macrophage activation where-at fully activated cells are the most effective producers after addition of appropriate stimuli [ , ] . roi decay leads to the emission of small amounts of light but this chemiluminescence (cl) is enormously intensified in the presence of chemical amplifiers such as luminol and lucigenin [ ] . in the report we describe a method for the determination of lucigeninenhanced cl of resident or in vivo preactivated mouse peritoneal macrophages using a -well microtiter system (amerlite research luminometer). resident macrophages were obtained by peritoneal lavage of untreated dba/ mice [ ] . elicited or fully activated cells were . in a total volume of gl x l s cells were preincubated in white well microtiter plates (microfluor ~, dynatech) with lucigenin ( , '-dimethyl-bis- , '-acridinium nitrate) (sigma) at a concentration of _ mol/ for min at °c. after addition of mg/ml of the phagocytic stimulus zymosan (sigma) cl was repeatedly measured in an amerlite research luminometer (amersham buchler) in the scan only program with a dwell time of s for each sample. figure i shows that by use of amerlite research luminometer the roi production of differentially preactivated macrophages could easily be measured. where-as thioglycolate-elicited or response to zymosan after about min no difference to background cl was observed with resident macrophages. addition of superoxide dismutase ( u/ml) during the preincubation time totally inhibited the zymosan-induced cl response (data not shown) indicating that the lucigenin- amplified cl predominantly resulted from o -production by nadph oxidase. the applied system seems suitable to study cl as a correlate of the macrophage activation stage. additionally, enhancing or inhibitory properties of drugs can effectively be determined in up to samples running in parallel with only small amounts of cells required. chemiluminescent systems based on luminol, acridine, phenanthridine, and lophine derivatives as well as singlet oxygen generating hypohalogenite-peroxy compound systems have been widely used in analytical biochemistry during the last two decades. ill contrast to this, there are only few reports on the application of the currently most efficient chemiluminescent system, the peroxyoxalate chemiluminescence (cl) with cl quantum yields up to . einstein/mol in aprotic solvents. oxalic acid esters or oxamides which are poorly soluble in protic environment and/or susceptible to solvolysis are predominantly used in micellar or reversed micellar systems for the detection (also as hplc-detector) of h or fluorescent compounds [ ] . moreover, there are attempts at using specially substituted dioxetanes as labels for cl-immunoassay technique [ ] . one of the most interesting recent papers describes the peroxyoxalate cl as an extraordinarily favourable alternative to the haematoporphyrin sensitized phototherapy for tumours without light in animal experiments [ ] . in the following the applicability of the cl system oxalic acid/fluorescer/dehydrator/peroxy compound is described with regard to biochemical analysis in protic solvents. in , rauhut described bright, strongly visible cl of an oxalic acid/carbodiimide/fluorescer/h system in aprotic solvents [ ] . our own experiments showed intensive short-time cl at ph = with a maximum within . s after the start of reaction also in protic environment (ethanol/h ). monoperoxyoxalate is formed as an intermediate which, f* ~ f + hv ( ) (f* = fluorescer in excited electronic singlet or triplet state). the quantification of oxalate, fluorescer and peroxy compound with the above-mentioned system is described in the following. all chemiluminometric measurements were made on a clinilumat lb (berthold, frg). dosed by injector, gl of a solution of bis(cyclohexyl)-carbodiimid (dcc) in abs. ethanol ( g/l) were added to ktl of aqueous sample adjusted to ph = . h was, if necessary, admixed to the sample ( t~ of a . mol/ aqueous solution of h ). the fluorescer was, depending on what was to be determined, either added to ethanol ( , -diphenylanthracene (dpa) in case of determina- fig. a, b . sensitization of the chemiluminescent system oxalic acid/dcc/hz by a free and b protein-bound rhodamineisothiocyanate contained in gl of sample ( mol/ oxalate solution, ph ) tion of oxalate and h ) or used together with the oxalate solution as sample, measurement was started immediately after injection and continued for s. quantification of oxalate in urine. we previously reported on chemiluminometric quantification of oxalate in urine after precipitation of calcium oxalate by means of a lkb luminometer [ ] . as further studies with the clinilumat lb have shown, oxalate concentration can be directly determined in native urine under optimized preanalytic conditions, concentration of reagents and timing of measurements, because all in-terfering organic substances in urine are inferior to oxalate by several orders of magnitude with regard to their reaction kinetics and cl quantum yield. a mol/ oxalic acid or alkali oxalate solution (adjusted with hc to ph = ) used as sample, a sensitization of the system by to orders of magnitude depending on the concentration of fluorescer can be achieved regarding the cl measuring signal. however, many of the common fluorescent dyes cannot be employed because of insufficient fluorescence quantum yield at ph = . apart from polycondensed carbohydrates (e.g. diphenylanthracene), brillant sulfoflavine, rhodamine and porphyrins (except complexes of metals with several stable valence states, e.g. iron and cobalt) are, among others, known as excellent sensitizers. covalent bounding to protein of the fluorescer will decrease cl quantum yield in comparison to an adequate quantum of free fluorescer. yet, few nanogrammes per ml can still be detected. we labeled human low density lipoprotein (ldl) and anti-ldl-igg (sheep) with rhodamineisothiocyanate (ritc), the limit of detection for proteins appearing from fig. . this offers the possibility of a cl immunoassay with a fluorescent dye instead of luminogen used as label. first in vitro studies as to the interaction between ritc-ldl and isolated human leucocytes admit of the conclusion that this peroxyoxalate system might also be suitable for the detection of cell receptors. brandl [ ] reported on chlorophyll-sensitized peroxyoxalate chemiluminescence producing bright and strongly visible light in ethyl acetate, when aryloxalates, namely bis( , -dinitrophenyl)oxalate (dnpo), were used. on the basis of dnpo we developed a qualitative peroxyoxalate-cl-test for the determination of porphyrins in urine [ ] . its simplicity and comparable sensitivity makes it an useful alternative to the porphyrine fluorescence talc test [ ] , particularly since an analytical quartz lamp is not needed. the system oxalate/dcc/h now also permits a quantitative analysis of porphyrins in urine down to the concentration of about ~tg/ , with some problems of standardization of the procedure remaining to be solved. the use of a suitable photodetector with a maximum sensitivity within a narrow range of the fluorescence (chemiluminescence) maximum of porphyrins (about nm) is a basic requirement for sufficient high sensitivity or further enhancement of sensitivity. determination ofh oa. using dpa as fluorescer in a concentration of rag/ in ethanolic dcc-solution and in the presence of mol/ oxalic acid solution, determination of h : can be achieved down to limiting concentration of - mol/ at ph = , with peak maximum within . s and the reaction being completed to p.c. within s after start. this shows that this procedure can also be used for the determination of enzymes or substrates which are in direct relation to h (e.g. systems catalyzed by oxidase or peroxidase). acridinium esters are highly chemiluminescent molecules with high quantum yield and rapid reaction kinetics [ ] . dna probes can be labeled with acridinium esters using alkylamine linker arms to approximately the same specific activity as the free ester. we have identified conditions in which acridinium ester linked to unhybridized probe is hydrolyzed to a non-chemiluminescent form, while ester linked to hybridized probe is protected [ ] . we have incorporated chemiluminescent labeled probes into a homogeneous dna probe assay referred to as the hybridization protection assay (hpa) and applied the assay to the detection of hepatitis b (hbv) and human immunodeficiency virus (hiv) dna sequences. rapid and sensitive detection methods for screening large numbers of samples in a simple format are needed for clinical diagnoses as well as basic research endeavors, particularly in clinical syndromes in which currently available tests or serological tests cannot be used to follow the course of infection. hiv and hbv are present in levels too low to allow consistent detection by direct methods. detection of these low levels of virus is made possible by specific amplification of viral nucleic acids by enzymatic methods including the polymerase chain reaction or pcr [ ] or transcription-based amplification methods [ ] . current methods for detection of the specific amplification products include visualization after gel electrophoresis and hybridization in solution or to immobilized targets. these methods require many steps and several hours to days to complete, and often involve radioisotopic dna probes. we demonstrate that hpa is a rapid and sensitive method for detection of hiv and hbv dna amplified by pcr. dna probes were labeled as described in arnold et al. [ ] . chemiluminescence was detected following the addition of hydrogen peroxide under basic conditions. the reaction proceeds through a cyclodioxetane-like intermediate with the pro- duction of an excited acridone which emits light upon collapse to ground state. purified cloned dna was amplified with taq polymerase under conditions recommended by the enzyme supplier (cetus) for or cycles in a perkin-elmer cetus thermocycler. ten microliters of the pcr reaction were denatured at °c and hybridized to ae-labeled probe at ° c, followed by a differential hydrolysis step at the same temperature. after differential hydrolysis, remaining chemiluminescence was a direct measure of the amount of hybrid formed. detection of chemiluminescence was performed with a leader i luminometer. the results were given as a numerical reading in relative light units (rlu), allowing quantitation of the amount of target present. the hybridization assay required less than min to complete. the differential hydrolysis of hybridized and unhybridized probe forms the basis of a homogeneous dna probe assay referred to as the hybridization protection assay (hpa). the hpa format was used to detect hiv and hbv dna amplified by pcr. purified cloned hbv dna was amplified by pcr with primers from conserved regions within the hbv genome. a single band was seen on etbr-stained agarose gels, confirming the specificity of the primer sequences. when dilutions of hbv cloned dna were amplified and then analyzed by hpa, reactions containing as few as copies of input hbv dna gave chemiluminescent signals significantly above background, even when only % of the sample was analyzed. the quantitative capabilities of hpa were demonstrated by analyzing serial dilutions of hbv + serum. the assay showed a linear response over three logs of target dilution. one hbsag + serum was positive by hpa even when diluted v-fold prior to amplification. we have also applied hpa to specifically detect hiv- dna amplified by pcr using gag-region primers described in ou et al. [ ] . amplifications containing less than copies of input hiv-i dna gave signals significantly above background. hpa provides a rapid and sensitive technique, which should be useful in studies involving epidemiology, diagnosis, prevention and treatment of viral diseases. the micellar media and the fluorescence techniques have been widely used in the study of the structure and dynamics of biological systems [ ] . analytically, the micellar media present a great interest, specially to improve the sensibility and selectivity of many determinations [ , ] . in the present communication, we report the micellar enhanced spectrofluorimetric determination of a polynuclear aromatic hydrocarbon (pah), benzo(a)pyrene (b(a)p) of great toxicological interest and for its significance in pollution studies [ ] . reagents. the standards pah were ontained from sigma chemical co. and used as received. the surfactants: sodium dodecylsulfate, triton x- , bencyldimethyltetradecylammonium chloride, hexadecyltrimethylammonium bromide and cetylpyridinium bromide were obtained from aldrich chemical co. the stock solutions of pah were prepared in ethanol. apparatus. all fluorescence measurements were made with a perkin-elmer mpf- a recording spectrofluorimeter equipped with a -w osram xbo xenon arc lamp, a dscu- corrected spectra unit ( . % rodamine b in ethylene glycol as the reference), a udr- digital read-out, a selecta frigitherm ultrathermostat and -cm quartz cells. the emission intensity measuring system of the spectrofluorimeter was calibrated daily by using the perkin-elmer set of fluorescent polymer blocks. general procedure for the determination of benzo(a)pyrene. to an aliquot, containing . ng-- . pg of benzo(a)pyrene, in a ml calibrated flask add ml solution of triton x- -z tool/l, and dilute to volume with deionised water. measure the fluorescence at nm using excitation at nm. the calibration curves are obtained from solutions prepared in the same conditions. the behaviour of b(a)p in solvents of different dielectric constant and bipolar moment has been studied as well as in presence of different surfactants. the fluorescence spectra do not present significant changes at the excitation and emission wavelengths maxima, neither in the ratio of emission bands intensitiesz [ ] . however, the fluorescence intensity suffers important changes in cationic and neuter micellar media. figure shows a great increase of the fluorescence intensity of b(a)p in solutions with triton x- , due to an increase in the molar absorptivity and, above all, in the quantum yield of the hydrocarbon. among the reasons which can justify that the non-radiative processes are found less favoured in micellar medium, could be mentioned the lower facility of movement of the fluorophore molecules and the reduction of quenching effects of oxygen or other species [ ] . the fluorescence intensity changes sharply with the concentration of the surfactant when it is close to the critical micellar concentration. in concentrations of triton x- higher than - mol/ remains practically constant. increases in temperature as well as ethanol contents up to % (v-v), produce decreases in the fluorescence intensity. for different intervals of concentrations: . - ppb, - ppb and . - ppb, exist a lineal relationship -with high coefficients of correlation -between the fluorescence intensity and the concentration of b(a)p in solutions . - tool/ of triton x- . in eleven solutions containing . , . , and . ppb of b(a)p, relative errors of . , . , . %, and relative standard deviations of . , . and . % have been obtained, respectively. the method shows a detection limit of . ppb [ ] . other pah, as , -benzoperylene, crysene and perylene, do not interfere the determinations up to ratios of . / , / and / with respect to b(a)p, respectively. the method has been applied to the determination of b(a)p in sea water samples to which known hydrocarbon concentrations have been added. recoveries oscillating from . to . % have been obtained from ten samples containing between and ppb of b(a)p. xith hungarian congress of experimental surgery abteilung urologie der zentralen hochschulpoliklinik der medizinischen akademie ,carl gustav carus lessingstrasse , ddr- jena modern fluorescence spectroscopy acknowledgements. this work was supported by funds provided by the gobierno aut nomo de canarias (research project no. / . . ). key: cord- -mmdeyph authors: paton, d. j.; brown, i. h. title: sows infected in pregnancy with porcine respiratory coronavirus show no evidence of protecting their sucking piglets against transmissible gastroenteritis date: journal: vet res commun doi: . /bf sha: doc_id: cord_uid: mmdeyph eighteen litters of sucking piglets were challenged with one of two strains of transmissible gastroenteritis virus (tgev). during pregnancy, their seronegative dams had been either inoculated intranasally with porcine respiratory coronavirus (prcv), inoculated orally with tgev or left untreated. on the basis of weight gain, clinical signs and survival, no differences in response to challenge was detected when piglets suckled by prcv inoculated sows were compared with those suckled by uninoculated sows. such a difference was evident when the litters of sows successfully pre-immunized with tgev were compared with those of unicoculated or prcv-inoculated sows. the possibility of transplacental transmission of prcv was investigated in two litters born to sows that had been inoculated with this virus in late pregnancy. all sixteen live-born piglets were seronegative for the virus at birth and prcv was not isolated from tissues taken from two stillborn piglets. on the basis of weight gain, clinical signs and survival, no differences in response to challenge was detected when piglets suckled by prcv inoculated sows were compared with those suckled by uninoculated sows. such a difference was evident when the litters of sows successfully pm-immunized with tgev were compared with those of uninoculated or prcv-inoculated sows. the possibility of transplacental transmission of prcv was investigated in two litters born to sows that had been inoculated with this virus in late pregnancy. all sixteen live-born piglets were seronegative for the virus at birth and prcv was not isolated from tissues taken from two stillborn piglets. keywords: epidemiology, pigs, pregnancy, protection, respiratory coronavirus, transmissible gastroenteritis virus transmissible gastroenteritis virus (tgev) is a coronavirus which can affect all ages of pigs, although resistance to the disease increases with age. sucking piglets are the most susceptible and the disease in these animals is characterized by vomiting, watery diarrhoea, dehydration and a high mortality. pigs that recover from tge develop an immunity that protects them against re-infection. immune sows can also passively protect their sucking piglets against tge (bay et al., ) by antibodies present in milk (haelterman, % ). tgev has been isolated from a number of organs, including the respiratory tract. however, the major target organ is the gut, where multiplication of the virus leads to villous atrophy, gastroenteritis and viral dissemination in faeces. porcine respiratory coronavirus (prcv) is a new variant of tgev with an altered pathogenesis and epidemiology (pensaert er af., ): it multiplies mainly in the respiratory tract and spreads between pig herds aerogenically. there are no enteric symptoms and, in experimentally infected pigs, even the respiratory tract infection is usually asymptomatic, although an exception to this has been reported by van nieuwstadt and pol ( ) . despite the in vivo differences in the behaviour of tgev and prcv, the two viruses are closely related antigenically and antibodies raised against either virus neutralize the heterologous virus equally effectively in in vitro tests. apparent associations between the dissemination of prcv and reduction in the incidence of tgev (jestin et az., ) raise the question of whether or not this crossneutralization may have in vivo sign&axe. this study was undertaken to investigate whether or not previous exposure of sows to the now widespread but relatively avirulent prcv would cross-protect their sucking litters against the less common but more virulent disease of tge. the possibility of transplacental transmission of prcv was investigated because of anecdotal reports of herd reproductive problems associated with prcv seroconversion and because of interest in the prcv status of hysterectomy-derived piglets. and methods viral inocula prcv inocula were prepared from a uk field isolate of the virus (stopps). a study of the pathogenesis of this isolate has already been reported by o'toole et al. ( ) . the virus was shown to multiply mainly in the respiratory tract, with only isolated foci of intestinal infection. a lyophilized stock of the virus which had been passaged three times in primary pig kidney monolayers (ppkm) was passaged once more, either in ppkm or in a five-day-old colostrum-deprived piglet, to provide the virus for inoculation of the pregnant sows. the ppkm virus had a titre of lde tcid ,, ml-'. the colostrum-deprived piglet was killed h after prcv infection. a % ?ung homogenate (lh) was made in phosphate buffered saline containin units penicillin ml-', pg streptomycin ml-' and kl units mycostatin ml -? (pbsa). this had a virus titre of * tcid f ml-' in ppkm. sows received two ml doses of ppkm virus or a single ml dose o lh virus. the tgev strains used were derived from a uk field isolate ps / ( ) and the miller strain of us origin. the virus had been passaged times through secondary pig thyroid monolayers, whilst the miller virus had not been tissue culture adapted. a gut homogenate of each was prepared by the oral inoculation of one-day-old colostrum-deprived piglets. twenty-two hours after infection, the piglets were killed and the small intestine of each was removed and homogenized in pbsa. aliquots of these stocks were stored at - °c and thawed immediately before use as inocula. a % lethal dose (ld ) for neonatal pigs was determined for each gut homogenate by orally inoculating a series of tenfold dilutions into three-day-old piglets housed in isolators. six piglets were used in this way for the titration of each stock. thereafter, a ml dose of ld was used to challenge neonates. pregnant sows were given a ml dose of ld or were fed on half a small intestine from a nine-day-old piglet infected one day before with ld of the miller stock homogenate. the pigs in this study came from herds known to be free from tgev and prcv infection. before entering the experiments, sera from all pigs were shown to be free of neutralizing antibodies to tgev and prcv when tested at a : dilution in an in vitro virus neutralization (vn) test as described by paton ( ) . serum dilutions were incubated in microtitre plates at °c for h with tcid,, of tissue culture adapted tgev, strain ps / . the plates were then seeded with a dog rectal tumour cell line (a ). the neutralization titre was the highest dilution of serum which completely inhibited viral cytopathic effect after five days. the piglets used for preparing and titrating virus stocks came from the laboratory's own closed herd. eighteen pregnant sows were obtained from commercial farms, from one herd, and (sows and ) from another (table i) . they were brought to the laboratory approximately eight weeks before their expected farrowing dates and were housed in isolation thereafter. in an attempt to synchronize farrowings, pg of the luteolytic agent cloprostenol ('planate': coopers) were given by intramuscular injection to most of the sows at between and days of gestation (table ii) . sows farrowed in crates, in strawed cubicles, with piglet heat lamps to one side. two days before tgev challenge, all piglets had their teeth clipped and were given iron injections. piglet water troughs were provided from the day of challenge onwards. pregnant sows were inoculated with prcv or tgev or left untreated (table i) . five sows were given second inoculations with prcv to see if this would boost their immune responses. sows and were given virus passaged in another pig in order to more closely mimic the tgev inoculations. sows , and were given second doses of tgev in an attempt to increase the chances of their being successfully immunized. prcv inoculations were given intranasahy, whilst tgev inoculations were given intraorally after overnight fasting. for both purposes, a syringe attached to a short length of flexible plastic tubing was used. all piglets were dosed with tgev orally with a syringe. age at challenge and strain of virus given are shown in table ii . sow seroconversions were monitored by regular blood sampling. precolostral blood was collected from the umbilical cords of newborn piglets from the litters of three sows to test for in utero seroconversion. two of these sows had received prcv in pregnancy (nos. and ), whilst the other (no. ) was an uninoculated control. samples of tonsil, trachea, lung, pulmonary lymph node, submandibular lymph node, duodenum, jejunum, ileum and mesenteric lymph node were taken from two pigs which were stillborn in the litter of sow for attempted virus isolation. tissues were prepared as % homogenates in pbsa, incubated for min at room temperature, clarified at g for min and then the resulting supernatants were inoculated onto ppkm. a single passage was made after seven days. all cultures were observed daily for cytopathic effects. cultures were initially grown in a hank's based medium containing % bovine serum and antibiotics. the maintenance medium was earle's containing % bovine serum and antibiotics. all piglets were bled from the jugular vein or anterior vena cava on the day before being challenged with tgev. colostrum and milk were collected from sows, where necessary, with the aid of an intramuscular injection of iu of oxytocin ('oxytocin-s': intervet). serum, colostrum and milk were examined for prcv/tgev antibodies by the vn test (paton, ) . all the piglets were weighed daily from soon after birth. they were examined at least twice daily for signs of illness, including diarrhoea, and assigned a daily clinical score of to , based on physical appearance and demeanour (see clinical scoring criteria: table iii ). an index of illness for each litter was calculated by averaging the worst clinical score achieved by each of that litter's piglets (average worst clinical score per litter). an attempt was also made to quantify the duration of diarrhoea for each litter by calculating the percentage of piglet days on which diarrhoea was observed from to days post-challenge (percentage piglet diarrhoea days). piglet faeces samples were collected regularly and examined for tgev by elisa. the elisa method, which has been described by paton ( ) , employed a solid phase, double antibody sandwich, incorporating a monoclonal capture antibody and a peroxidase labelled polyclonal indicator antibody. any piglets that became exceptionally weak or moribund were killed humanely. the mann-whitney test with one-sided probabilities was used to compare data from different groups of sows. the serum antibody titres in the sows two days before far-rowing are shown in table i . the antibody titres in colostrum, in prechallenge piglet sera and in milk collected on the day of piglet challenge are shown in table ii . some samples could not be assayed at dilutions of less than : or : because of cytotoxicity. none of the sows inoculated with prcv showed any signs of illness but all had seroconverted prior to farrowing. where given, the second inoculation of prcv did not appear to affect the antibody response. of the three sows inoculated in pregnancy with virus, only sow showed signs of illness (anorexia and diarrhoea on days and post-inoculation) and this sow was also the only one to seroconvert. sows and , inoculated with the miller strain of tgev, showed no illness, but both seroconverted. the three tgev seropositive sows transferred broadly similar amounts of colostral prcv/tgev neutralizing antibody to their piglets, as did their prcv seropositive counterparts. reciprocal titres of neutralizing antibody levels in milk on the day of challenge of the piglets ranged from to for the three tgev seropositive sows' litters and from to for the seven prcv seropositive sows' litters. the piglets from all three litters blood sampled before ingestion of colostrum had no serum neutralizing antibodies to tgev/prcv. the two stillborn pigs from sow appeared grossly normal post mortem apart from unexpanded lungs. virus was not isolated from any of the tissues sampled. four sows (nos. , , and ) farrowed earlier than expected and before receiving cloprostenol. consequently their piglets were slightly older at the point of challenge (table ii) . following infection of the piglets with tgev, a number of nursing sows became ill. a variety of clinical signs were observed, including anorexia, pyrexia, diarrhoea and agalactia. data showing the effects of challenge on piglets and on sows are given in table iii . tgev excretion in piglet faeces was confirmed by elba for all litters except that of sow no. , where there was no diarrhoea. sow serum antibody titres at the end of the experiments are shown in table i . three sows remained seronegative, even though they had been suckling piglets challenged with the strain of tgev - days previously. results obtained for both challenge strains of tgev appeared to be similar and, for comparative purposes, they have been grouped together. the three litters born to tgev inoculated sows which had seroconverted had lower values than any of the six litters born to uninoculated sows or any of the seven litters born to prcv inoculated sows in respect of proportion of piglets scouring, percentage piglet diarrhoea days and average worst clinical score. these differences are statistically significant, with p = . for the difference between tgev seropositive and uninoculated sows andp = . for the difference between tgev seropositive and prcv inoculated sows. the proportion of piglets dying was zero in all the tgev seropositive sow litters and this was lower than in any of the prcv litters. this again is significant with p = . . one uninoculated sow litter also had no deaths, so the p value is . for the difference between tgev seropositive and uninoculated sows. in respect of all these measures, the litters born to prcv inoculated and to uninoculated sows were similar and no significant differences were found, all probabilities exceeding . . the sows infected with prcv in late pregnancy farrowed apparently normal piglets. precolostral sera from two of these litters were all prcv seronegative and the virus could not be isolated from two stillborn littermates. thus there was no evidence that transplacental transfer of prcv had occurred. the virus had a low infectivity for sows. this might have resulted from its passage in tissue culture. the variation in mortality amongst piglets within similar treatment groups might in part have been due to variable sow illness and agalactia. although tgev was excreted by most of the challenged piglets, the challenge doses were evidently low, since many piglets sucking unimmunized sows survived. the doses had been determined by titrations carried out in piglets removed from their dams and it would therefore appear that such animals are much more susceptible to tge than naturally nursed ones. one benefit of a low challenge dose should be a high sensitivity for detection of low levels of lactogenic protection which might otherwise be swamped. no evidence for cross-protection between immunity to prcv and tgev was found in this study but the number of litters was too small to be certain that none exists whatsoever. however, statistically significant protection was demonstrated in the successfully tgev inoculated group, despite this comprising only three litters, relative to both other groups, while no differences could be found between these other groups, which were both larger. thus if cross-protection does occur it is clearly of a much lesser order than that provided by the homologous virus. this study used a single strain of prcv and two strains of tgev. other strains exist and could give different results. the present association in the uk and other european countries between a high prevalence of prcv and a low incidence of tge cannot in itself be taken as conclusive evidence of cross-protection, since tge incidence has been known to fluctuate widely in the past. attenuation of tgev by tissue culture passage can produce viruses which retain their respiratory tropism, but lose their entero-pathogenic&y (furuuchi et al., ) . in this respect, they are similar to prcv. such attenuated viruses have been extensively investigated for use as possible tge vaccines, but have generally been found to be not fully effective (saif and bohl, ) . bernard et al. ( ) gave tgev to piglets sucking sows that had previously been naturally infected with prcv. they concluded that these sows did provide some lactogenic protection to their litters, although this was less than that provided by sows immunized with virulent tgev. hooyberghs et al. ( ) reported outbreaks of tge affecting sucking piglets in herds previously infected with prcv. the piglets did not seem to be protected, although recovery on a herd basis was possibly more rapid. van nieuwstadt ef al. ( ) , using experimental animals, found no evidence that prior infection of young pigs with prcv protected them from a later challenge with tgev. the lack of cross-protection observed in this study was in spite of similar levels of prcv/tgev neutralizing antibody in the serum, colostrum and milk of prcv immunized and tgev immunized sows. previous studies have shown that iga in milk is of paramount importance in protection of sucking piglets against tge (saif and bohl, ) . further work is therefore in progress to characterize with respect to class the anti-prcv/tgev antibodies from the sows in this experiment. this study failed to demonstrate any evidence that previous infection of sows with a uk prcv isolate could provide lactogenic protection against tge caused by the or miller strains of tgev. prcv infection of two sows in the last third of gestation did not result in detectable fetal infections. transmissible gastroenteritis in swine. a study of immunity we are very grateful for the assistance provided to us by mr b.n.j. parker and colleagues, the staff at grange farm and our own colleagues in the porcine section of the virology department.mr m. richards and mr a.r. sayers produced the statistical analyses and mrs r. pearce typed the manuscript. key: cord- -xk yuibj authors: belcourt, michael f.; farabaugh, philip j. title: ribosomal frameshifting in the yeast retrotransposon ty: trnas induce slippage on a nucleotide minimal site date: - - journal: cell doi: . / - ( ) -k sha: doc_id: cord_uid: xk yuibj abstract ribosomal frameshifting regulates expression of the tyb gene of yeast ty retrotransposons. we previously demonstrated that a nucleotide sequence conserved between two families of ty elements was necessary and sufficient to support ribosomal frameshifting. this work demonstrates that only of these nucleotides are needed for normal levels of frameshifting. any change to the sequence cuu-agg-c drastically reduces frameshifting; this suggests that two specific trnas, trnaleu uag and trnaarg ccu, are involved in the event. our trna overproduction data suggest that a leucyl-trna, probably trnaleu uag, an unusual leucine isoacceptor that recognizes all six leucine codons, slips from cuu-leu onto uua-leu (in the + reading frame) during a translational pause at the agg-arg codon induced by the low availability of trnaarg ccu, encoded by a single-copy essential gene. frameshifting is also directional and reading frame specific. interestingly, frameshifting is inhibited when the “slip” cuu codon is located three codons downstream, but not four or more codons downstream, of the translational initiation codon. establishment of the translational reading frame in eukaryotes occurs during initiation of protein synthesis when the first aug codon in the mrna is located by a component of the scanning s initiation complex, trnay* (cigan et al., ) . following s ribosome assembly, translation continues in nucleotide steps with a very high degree of accuracy, reflecting the fact that maintenance of the translational reading frame is essential for useful gene expression. expression of the nb gene of yeast ty retrotransposons occurs by disruption of this highly accurate translocation mechanism at levels approaching % (clare et al., ; wilson et al., ) . how is this level of "inaccuracy" achieved? the tyl and ty elements are members of a family of retrotransposons found dispersed throughout the genome of the yeast saccharomyces cerevisiae (cameron et al., ) . they consist of . kb terminal direct repeats called "delta" ( ) flanking a . kb internal region termed "epsilon" (e). along with retroviruses of higher eukaryotes (reviewed in varmus, ) the copia-like elements of drosophila species (emori et al., ; mount and rubin, ) , and llmd of mice (loeb et al., ) , ty elements are members of a family of elements that replicate via an rna intermediate. encoded by ty elements are two genes, na and nb. ty elements replicate by a retroviral-like mechanism (boeke et al., ) within a virus-like particle encoded by the products of the na gene, the analog of the retroviral gag gene (adams et al., ; garfinkel et al., ; mellor et al., b) . the nb gene includes sequence homologies to retroviral pal genes, which encode the reverse transcriptase, integrase, and protease proteins. as with many avian and mammalian retroviral pal genes, expression of nb requires ribosomal frameshifting (clare et al., ) . tyb, like pal, is expressed as a protein fusion to the product of the upstream gene, na (clare and farabaugh, ; mellor et al., a) . while retroviral frameshift events occur in the - direction in a region of overlap between the gag, pal and sometimes pro genes (jacks et al., (jacks et al., , b jacks and varmus, ; moore et al., ; wilson et al., ) , ty frameshift events occur in the +l direction in the - bp overlap between na and nb. in fact, we recently showed that a bp region of this overlap is necessary and sufficient to promote normal levels of ribosomal frameshifting (clare et al., ) . in rous sarcoma virus (rsv), mouse mammary tumor virus (mmtv), and the avian coronavirus infectious bronchitis virus (ibv), rna secondary structure in the form of a pseudoknot plays a critical role in the ribosomal frameshift event, presumably by causing the ribosome to stall at the site of frameshifting (brierley et al., ; jacks et al., jacks et al., , a moore et al., ) . the region of frameshifting in ty elements contains no obvious secondary structure. in addition, ty elements lack the characteristic homopolymeric run of nucleotides ("slippery" sequences) at the site of frameshifting that characterizes frameshift sites of retroviruses and coronaviruses (brierley et al., ; jacks et al., a) . in these systems, a simultaneous slippage of trnas in the a and p sites of the translating ribosome on the homopolymeric sequence results in a frameshift to the pro orpol reading frame and suppression of the gag frame termination codon. this appears not to be the case in ty elements. an in vivo assay for frameshifting all constructions involve the use of a his a::lacz fusion gene contained on a pm dna-based plasmid whose construction is described in experimental procedures (figure ). this plasmid is present at four copies per cell (farabaugh et al., ) . oligonucleotides containing various versions of the frameshift sequence were introduced at the bamhl site of pmb and between the bamhl and kpnl sites of pmb . transcription from the his promoter produce an mrna with two overlapping genes: the ' proximal gene derived from the first nucleotides of the his a gene and, in the +l reading frame, the 'proximal gene derived from the /acz gene of escherichia coli. production of the /acz gene product, pgalactosidase, depends upon a ribosomal frameshift event in the +l direction within the sequences introduced on the oligonucleotides. the rate of frameshifting is measured by determining the ratio of -galactosidase activity produced from a construct requiring a +l frameshift to express /acz to that of a construct in which the upstream and downstream genes are fused in frame. as shown below, the rate of frameshifting measured in this way is high, usually in the range of %; however, experimental variation in this rate occurs, both upward to the range of % and downward in the range of %. this variation results from unknown effects of the sequence context of individual constructions and slight variations in the physiology of yeast transformants. we will describe as abnormal only those transformants showing rates of frameshifting substantially lower than % (i.e., in the range of % or less). sequence is the site of frameshifting we previously demonstrated that a nucleotide sequence conserved between the tyl and ty families of ty elements supports high levels of frameshifting (clare et al,, ) . it is possible that the frameshift event occurs shortly before or after the nucleotide sequence since neither the na nor the tyb reading frame is limited by translational termination codons in the region of overlap. in the construction used, the first nb frame termination codon is bp upstream of the overlap in his a while the first na frame termination codon is bp downstream in /acz. an oligonucleotide was synthesized that contained the nucleotide frameshift sequence flanked by termination codons, upstream in the tyb reading frame and downstream in the na reading frame (table ) . the oligo-nucleotide was cloned at the bamhl site of pmb as described in experimental procedures and analyzed for its ability to promote frameshifting by assaying the expression of the downstream gene, /acz. expression of /acz requires a +l ribosomal frameshift within the sequence between the termination codons. frameshifting is unaffected by the termination codons, occurring at levels of approximately % (data not shown). this result demonstrates that the nucleotide sequence is the actual site of frameshifting. an open question in many of the site-specific frameshifting systems described in prokaryotes and eukaryotes is the degree to which the event is directional and reading frame specific. is frameshifting constrained to occur in only one direction, or can it occur in either direction? frameshifting in the human immunodeficiencyvirus (hiv- ) occurs only in the - direction (wilson et al., ) . conversely, weiss et al. ( ) demonstrated that ribosomes in e. coli may be made to frameshift both forward and backward within a sequence that incorporates a string of identical nucleotides. shifts of - , - , +l, + , + , and + were identified. will frameshifting occur only when the tya reading frame is being translated by the ribosome? changing the reading frame of e. coli frameshift sites decreases the frequency of frameshifting by about loo-fold (weiss et al., ) . changing the frame disrupts both a required frame-specific pause induced by a nonsense codon, and a frame-specific trna slippage site. removing the nonsense codon alone causes about a lo-fold decrease in frameshifting. this suggests that reading frame is important in the e. coli case, but not essential. to test explicitly if frameshifting is reading frame specific or directional, we constructed a set of plasmids all of which had a single insert of the minimal region but designed such that translation comes into the region in each of the three reading frames and exits in each of the three reading frames (table ) . to achieve all combinations required constructing nine plasmids. each minimal region was flanked by termination codons to ensure that any frameshifting that occurred was taking place within the minimal sequence. these constructions were introduced into yeast and assayed for in vivo expression of -galactosidase. in three of the plasmids (pmb -(o)fus, pmb -(+l)fus, and pmb -(-l)fus), the his a and /acz translational frames are fused. two of these constructions give high levels of -galactosidase activity (- u; table l ), but the construction in which translation occurs in the - frame of the minimal region expresses about -fold lower amounts. the latter construction has an in-frame uag termination codon partway through the frameshift region, and thus translation terminates prematurely. two - frameshift reporter constructs (pmb -( )-l, and pmb -(+l)o) do not express significant amounts of -galactosidase. we conclude that - frameshifts do not occur from either the (defined as the wild-type or na reading frame) or +l reading frame. by contrast, construct pmb- -(o)+l, in which translation enters the minimal region in the frame (tya) and exits in the +l frame (p/b), expresses high levels of -galactosidase activity, indicating about % frameshifting as expected. frameshifting from the +l reading frame to the - reading frame (pmb -(+ )-l) shows insignificant enzyme activity, indicating that + frameshifting does not occur from the +l reading frame of the minimal sequence. to test if frameshifting occurs in the +l or - direction from the - reading frame, we transformed an amber suppressor strain, l , to allow readthrough past the in-frame uag. in this background, the p/a-n/b +l frameshift reporter plasmid, pmb -( )+ , promotes about % frameshifting (table ) . frameshifting in the +l direction from the other two reading frames is not seen. likewise, frameshifting in the - direction does not occur from any of the reading frames. we conclude from these results that frameshifting in the nucleotide minimal region occurs only in the +l direction and only from the , or tya, reading frame. sequence to determine whether all nucleotides of the nucleotide frameshift site are required for frameshifting, a series of frameshift reporter constructs retaining increasingly smaller portions of the minimal sequence were made by synthesizing oligonucleotides that differ in length by sin-gle codons of the tya reading frame. the remaining sequences in each oligonucleotide were flanked by termination codons to ensure that frameshifting occurs only within the sequence. the oligonucleotides were inserted into the h/sa::/aczframeshift reporter plasmid pmb at the bamlil site as described in experimental procedures. frameshifting in the +l direction will result in -galactosidase production from the /acz gene. table shows the sequence of the deletion constructs as well as the results from each construct. deleting the first two codons from the ' end of the nucleotide sequence (including nucleotides of the nucleotide sequence) has no effect on frameshifting, demonstrating that only three codons from the nucleotide sequence are necessary to direct frameshifting. no other ty-derived sequences are present, yet frameshifting is occurring at wild-type levels. deletion of an additional codon from the ' end or deletion of one or two codons from the ' end results in a much lower frequency of frameshifting ( table ). all three constructs are at least -fold lower in expression than the plasmid retaining the first three codons of the nucleotide sequence. since no construction lacking any of the first three codons expresses significant levels of -galactosidase, we conclude that the first three codons of the nucleotide sequence, cuu-agg-cca, are necessary to direct frameshifting. this does not mean that each nucleotide is necessary, since the deletions do not allow us to map effects at a resolution of less than one codon. defines essential nucleotides the deletion analysis described above crudely defines the sequence that promotes frameshifting. to define which nucleotides are critical for frameshifting, we synthesized a series of nine oligonucleotides. mixed synthesis was done with the nucleotides corresponding to the three desired mutations at each position of the nucleotide minimal sequence defined above. the three mutations at each position were tested for their effect on frameshifting after cloning into the his a::laczframeshift reporter plasmid pmb between the bamhl and kpnl sites as described in experimental procedures. the results are depicted graphically in figure . the nucleotide immediately 'of the nucleotide minimal sequence is unimportant for frameshifting, as it can be any of the four nucleotides. the eighth and ninth nucleotides can also be changed to any base without affecting frameshifting. however, any change to the remaining nucleotides drastically reduces frameshifting. the essential bases, cuu-agg-c, include two codons of the na reading frame plus a seventh base. as can be seen from closer inspection of the data, some changes allow lower levels of frameshifting that are above background. c or g substitutions for u at the wobble position of the first codon allows approximately % frameshifting. substitution of c or u for a at the first position of the second codon and replacement of g with u at the wobble position of the second codon also allow lower levels of frameshifting. the reason for the necessity of the seventh base is unknown but can probably be attributed to a context effect on decoding of the preceding codon. context effects are known to involve the nucleotide immediately 'of a codon (bossi, ; bossi and roth, ; carrier and buckingham, ; fluck et al., ; miller and albertini, ; murgola et al., ; weiss, ; weiss and gallant, ) . occurs when peptidyl-trnabu is bound to the cuu codon and does not involve simultaneous slippage the nucleotide minimal sequence defined above includes two unusual features. first, there are overlapping leucine codons (cuu and uua) in the and +l reading frames. in nearly all organisms these two codons are decoded by distinct isoaccepting species. yeast is unusual in that it encodes a trna, trnaf& (previously known as trna:b") that decodes all six leucine codons (weissenbach et al., ) . the expanded recognition requires an unmodified uracil at the wobble position of the anticodon (randerath et al., ) . frameshifting could involve slippage of this trna between the two leucine codons. second, the next codon, agg (arg), is recognized by a low-abundance trna encoded by a single nuclear gene, trn&?,,. deletion of this gene is lethal to yeast (gafner et al., ) . two models can account for the necessity of the cuu shown boxed on the x-axis is the wild-type sequence of the frameshift site. the hatched portion indicates the essential nucleotides for frameshifting. above each boxed nucleotide are the miasense substitutions generated for each position of the sequence. the percent frameshifting for each substitution is shown graphically. if ty elements employ a peptidyl-trna slippage method of frameshifting as described in the text. a partial rna sequence from the aug codon is provided for reference. (b) predicted amino acid sequence through the nucleotide frameshift site (amino acids shown numbered) if ty elements employ the simultaneous-slippage method of frameshifting seen in retroviruses of higher cells. a partial rna sequence from the aug codon is provided for reference. (c) amino acid sequence datathrough the nucleotide frameshift site. histograms of relevant pth-amino acids through cycles of edman degradation are shown with the major amino acid present in each cycle indicated above the histograms and above the mrna sequence in (b). cycle , which is predicted to yield his according to the rna sequence, gave a weak signal, and no assignment was made. no other amino acid can be detected. the nucleotide frameshift site has a gln residue (rather than his) following gly. the amino acid sequence through the nucleotide site confirms the gln residue after gly (data not shown), supporting the notion that translation shifts to the +l reading frame by peptidyl-trna slippage on the cuu-leu codon. and agg codons. in rsv, hiv-l, mmtv, ibv, bovine leukemia virus (blv), and the simian retrovirus type (srv-l), a simultaneous slippage of two trnas causes a - frameshift (jacks et al., a (jacks et al., , b wilson et al., ) . the model requires that both the a and p sites be occupied simultaneously to accomplish the frameshift. this could be the case for ty, yet only the simultaneous slip would be in the +l direction from cuu-agg to uuaggc. this would predict a protein sequence of leu-arg-his through the frameshift site ( figure ). another model predicts that the ribosome encountering the agg codon pauses because of the low availability of trna$&. in this state, with peptidyl-trna& in the p site and a vacant a site, the peptidyl-trna$ slips from the cuu reading frame to the uua (+l) reading frame. this places the ggc (gly) codon in the a site. trna& enters the a site and translation continues in the +l reading frame. this model predicts a protein sequence of leu-gly-his ( figure a ). to distinguish between the two above scenarios as well as other models, we determined the peptide sequence through the frameshift site. the his a::lacz fusion plasmid p p has a bamhl site incorporated after the first two codons of the hi.% gene. the construction is described in experimental procedures and depicted in figure . the nucleotide frameshift site, flanked by termination codons, was cloned at the bamhl site such that /acz expression requires a +l frameshift within the minimal sequence. after purification of the his a::lacz fusion product, the protein was subjected to cycles of edman degradation. the relevant pth-amino acids through the first cycles are shown in figure c . the data clearly support the trnaktg slippage model. glycine rather than arginine is incorporated after leucine, indicating that the frameshift event occurs on the cuu leucine codon. no significant amount of arginine is detected at cycle , ruling out a cuu-agg simultaneous-slippage model of frameshifting. these data do not rule out simultaneous slippage on cuu and the codon immediately upstream of it; this is very unlikely since that codon is not from the ty overlap, and can be changed at any position with no effect on frameshifting. therefore, the most likely model is one involving slippage of a single trna bound to the cuu codon. occurs when the agg codon is unoccupied by its cognate tfina a correlation exists between the abundance of yeast trnas and the occurrence of their respective codons (ikemura, ) . the second codon (agg) of the frameshift site is recognized by a low-abundance trna encoded by a single gene. as expected, the codon agg is rare in yeast genes (aota et al., ) . the fact that the rate of aminoacyl-trna binding to the ribosomal a site is proportional to its concentration (thompson et al., ) has been taken to mean that codons recognized by abundant trnas are decoded quickly, while codons recognized by nonabundant trnas are decoded slowly. recent evidence suggests that translation rate is not strictly correlated with trna concentration, since some nonabundant trnas are decoded more quickly than some much more abundant trnas (bonekamp et al., ) . though the rule that all low-abundance trnas decode slowly may not be universal, it is true that some codons are very slowly decoded. interestingly, the trna&u of e. coli, which is also a rare trna, has a low intrinsic decoding rate (bonekamp and jensen, ) . it is possible that the very low abundance of trna@u is necessary to promote frameshifting by causing a translational pause analogous to the function of the nonsense codon and "hungry"codons in e. coli frame- shifts (weiss et al., . if this is true, then it may be possible to modulate frameshifting by modulating the amount of the rare trna. in particular, increasing the in vivo concentration of the trna should decrease the putative pause, and thus decrease the rate of frameshifting. the gene for trna@u was cloned onto a frameshift reporter plasmid, pmbs&smerwt, as described in experimental procedures. the copy number of this plasmid is approximately four per cell, increasing the total number of copies of the trna$!& gene to five per cell (including the one endogenous copy). the plasmid contains the h/s a- nucleotide frameshift site-lac;! reporter gene, which normally shows % frameshifting (table ). the -fold increase in copy number of the trna& severely inhibited frameshifting (table ). the fact that increasing the concentration of trna& causes frameshifting to decrease is incompatible with any model in which the frameshift event is stimulated in part by binding of trna& to the ribosomal a site. rather, trna& must "act" by being absent from the ribosome since increasing its ability to occupy the a site has a negative effect on frameshifting. we conclude that competition for the rare trna& induces a translational pause that is essential for the frameshift event and that frameshifting occurs when the ribosomal a site is unoccupied. depends upon trna slippage between the cuu and uua leucine codons the missense mutagenesis data demonstrate that the cuu codon is essential for frameshifting ( figure ) . we wanted to test directly if frameshifting depended upon frame slippage by a peptidyl-trnaleu. if trnakg promotes frameshifting by frame slippage, then the rate of frameshifting should be directly related to the frequency that that trna is used to decode the cuu codon. if another isoaccepting species, incapable of frame slippage, were to compete with trna$ for binding to the cuu codon, frameshifting would be reduced. have proposed a different model for ribosomal frameshifting at "hungry" codons in e. coli. the model predicts that in a situation where the a site is unoccupied during a very long pause, a trna can bind out of frame, either +l or - , in violation of the normal frame maintenance mechanism. if this model were to operate in the ty case, one would see the same peptide sequence at the frameshift site that we determined, leu-gly-his. however, the ability of the peptidyl-trnaleu to slip would be irrelevant. to test the model of peptidyl-trnaleu slippage, we constructed three novel trnas bearing modified anticodons by modifying the anticodon of a gene for the most abundant isoacceptor, trna&, also known as trnap (see experimental procedures). the first, with the anticodon aag (trna&), can decode cuu but is incapable of recognizing the overlapping uua codon. the second has the anticodon uag (termed trna&, to distinguish it from the wild-type trna$), and the third is an ochre suppressor with the anticodon uua (trna:e,",). the latter two serve as controls since neither is expected to interfere with frameshifting. changing the anticodon should have no effect on charging of the trna by leucine aminoacyl-trna synthetase for two reasons. first, leucine is encoded by six codons, the only common feature of which is the central u residue. second, functional amber and ochre suppressor forms of trnaleu exist (sherman, ) . the trna genes were cloned into the plasmid pmb - merwt (see previous section) and introduced into yeast. the rate of frameshifting was drastically lower in the presence of trna!$ but not with trna&&, while trna& had no effect (table ). the -fold decrease in frameshifting in the presence of trnafa; suggests that it has competed away % of the binding of a trna responsible for frameshifting. although the data do not directly identify trnapig as the "shifty" trna, they do demonstrate that the ability of the trna decoding the cuu codon to slip to uua is essential for ty ribosomal frameshifting. other codons decoded by rare trnas cannot substitute for agg if the agg codon of the frameshift site induces a translational pause as a result of the low availability of its cognate trna, is it possible to induce a translational pause by substituting a codon recognized by other low-abundance trnas? we replaced the agg codon with two other codons known to be recognized by trnas present in low concentration: cgg, decoded by trna&o (m. culbertson and i. edelman, personal communication); and ucg, decoded by trnap$, (etcheverry et al., ; olson et al., ) . like the trna&u gene, the trna&jo and trna&* genes are present in single copies in the haploid yeast genome and are lethal to the cell if deleted, reflecting the fact that no other trnas are capable of decoding the cgg or ucg codons. oligonucleotides containing cgg or ucg at the agg position of the frameshift site were cloned into the frameshift reporter plasmid pmb as described in experimental procedures. after introduction into yeast, the constructs were analyzed for -galactosidase production. both produced very low levels of enzyme, corresponding to . % frameshifting for cgg and . % frameshifting for ucg ( table ). the cgg construct does support a significant level of frameshifting but still is about fold below that of the wild-type construct with identical flanking sequences. a possible problem with this experiment is the elimination of the uua leucine codon in the +l reading frame. perhaps trna$& cannot slip from cuu to uuc or uuu, both phenylalanine codons recognized by a single isoacceptor, trng'&, also known as trnaphe (rajbhandary et al., ; valenzuela et al., ) . to control for this, oligonucleotides were constructed containing the same substitutions for agg as above, but with only the first position c of the cuu codon changed to u. we reasoned that trn@& should be able to shift from uuu to uuu or uuc of the +l reading frame of each construct (table ) because the hiv- frameshift event can occur in the - direction on a string of uracil residues in yeast (wilson et al., ) . as can be seen from the data, this change did not improve the ability of the sequences to support frameshifting (table ) . a more controlled experiment utilizes a well-characterized set of trna& gene deletion constructs. the uay codon is decoded by an abundant trna (trna&; also called trnatyr) encoded by eight unlinked genes in the haploid yeast genome (olson et al., ) . burke ( ) demonstrated that the sequential deletion of each of the trna@,, genetic loci results in a linear decrease in the pool of aminoacyl-trnatyr within a cell. deletion of up to four of the genes has no detectable phenotype; however, deleting five results in a % increase in doubling time, deleting six increases doubling time by /o, and deleting seven is lethal. the increase in doubling time unambiguously indicates that cell growth is limited by the availability of the trna, suggesting that competition for the trna would be severe in at least those strains. we introduced a frameshift reporter plasmid into strains containing two to eight copies of the trn@& genetic loci. this plasmid contained one of three versions of the merwt frameshift site: one with the wild-type sequence (cuu-agg-cca), one substituting a uau tyrosine codon for agg, or one substituting the codons uuu-uau for cuu-agg (table ). the second construct would require trna& to slip from cuu (leu) to uuu (phe). to make a slip more likely, the last construct requires trna& to slip from the frame uuu codon to the +l frame uuu codon to express /acz. we reasoned that as the aminoacyl-trna&, pool drops with decreasing copies of the trna&, gene, the possibility of a translational pause at the uau codon would increase because of the apparent severe competition for the trna. this pause may allow a frameshift event to occur at the upstream codon. the results are displayed in table . neither construct incorporating a uau "pause" codon allows appreciable levels of frameshifting in any of the deletion strains, while the wild-type construct shows normal amounts of frameshifting. we conclude from these data that the fact that a codon is decoded by a limiting trna in itself is not sufficient to cause a translational pause capable of inducing detectable translational frameshifting. is inhibited by proximity to the initiation codon we previously demonstrated that placing the nucleotide frameshift site in immediate proximity to the translational initiation codon inhibits frameshifting (clare et al., ) . placing the cuu codon of the frameshift site three codons downstream of the ty - aug codon abolished frameshifting. when this codon was positioned codons downstream, frameshifting was restored. this suppression could be a context effect around the ty - initiation codon (in which case the sequence around the initiation codon would suppress frameshifting even if positioned far downstream within a gene), or it could be an effect of initiation itself. to test the former possibility, we synthesized an oligonucleotide encompassing a region from bp upstream of the ty - aug, through the nucleotide frameshift site (which was fused at the ty - aug), and bp downstream. the oligonucleotide, when inserted between a na deletion bp downstream of the initiation codon and the /acz gene (in the +l reading frame), supported normal levels of frameshifting (data not shown). this suggests that proximity alone causes the suppression of frameshifting. to determine the minimal distance between the aug initiation codon and the nucleotide frameshift site, we placed the frameshift site at increasingly farther codon intervals from the hem initiation codon. bamhl sites were introduced in the his a gene at codon intervals beginning at the second codon and ending at the seventh codon as described in experimental procedures. introduction of the nucleotide frameshift sequence into each of the six "proximity constructs" allowed a measure of frameshifting into the downstream /acz gene. as we saw with the ty - construct, placement of the cuu codon of the frameshift site three codons downstream of the his aug in construction p p resulted in no frameshifting (table ) . however, construction p p, which places the frameshift site at a position four codons downstream, shows appreciable levels of frameshifting, with frameshifting occurring at about /o. placement of the site five, six, seven, or eight codons downstream of the aug codon showed frameshift activity at near wild-type levels. we hypothesize that the ribosome becomes competent to frameshift during the initial stages of elongation following initiation, apparently with an abrupt transition after the fourth codon of the gene. translation initiation in eukaryotes occurs by a mechanism fundamentally different from that in prokaryotes. the ribosome binds to the ' end of the mrna and "scans" to the initiation codon, usually the first aug codon in the message. the aug codon acts as a starting point for translation and establishes the reading frame of the message. disruption of the reading frame occurs only rarely during elongation, but several instances of reading frame shifts have been observed. the phages f and ms (beremand and blumenthal, ; kastelein et al., ) express their lysis genes through a mechanism that involves frameshifting within the upstream coat cistron. spontaneous readthrough of leaky frameshift mutations occurs within the x gene of yeast mitochondria (fox and weiss-bummer, ) . the addition of a carboxy-terminal extension onto the phage t major coat protein also occurs by a frameshift during translation (dunn and studier, ) . synthesis of the e. coli peptide release factor (rf ) requires a +l frameshift at an in-frame uga codon (craigen and caskey, ; craigen et al., ) , while some retroviruses and coronaviruses of higher eukaryotes employ a - frameshift to express the products of their pal (or pro) and f genes, respectively (brierley et al., (brierley et al., , jacks et al., jacks et al., , a jacks et al., , b jacks and varmus, ; wilson et al., ) . frameshifting in the two best-studied systems, the rf gene of e. coli and retroviruses of higher eukaryotes, have several unifying features. codon of the rf gene of e. coli is an in-frame uga termination codon, one of two codons recognized by rf (scolnick and caskey, ) . the uga codon is probably the site of an autogenous control system. instead of prematurely terminating at the uga codon, % of the ribosomes shift into the +l frame at the position of the cuu (leu) codon immediately preceding the uga (craigen and caskey, ; craigen et al., ) . in an exhaustive study, weiss et al. ( have defined the minimal requirements of frameshifting in e. coli. they find that the three things necessary for frameshifting to occur are a "slippery run:'or repeat of several identical nucleotides in the rna, followed immediately by a termination codon and preceded by a shine-dalgarno sequence (shine and dalgarno, ) a precise distance away. constructs were made that frameshifted - , - , +l, + , + , and + with varying efficiency. the proposed mechanism involves binding of a trna in the "slippery run." a translational pause, induced by the slow process of termination at the nonsense codon, allows an interaction between the shine-dalgarno-like sequence upstream of the frameshift site and the s rna. the interaction "pulls" or "pushes" the ribosome, causing the trna to slip along the slippery run. translation then continues in the new frame. the mechanism of - frameshifting in retroviruses has been shown to involve both a specific "slippery" sequence and, in some cases, a conserved secondary structure. jacks et al. ( a) showed that three subsets of repetitive nucleotides conserved among retroviruses constitute the sites of frameshifting. protein sequence analysis and sitedirected mutagenesis of the gag-pro fusion junction from mmtv (jacks et al., ) hiv- (jacks et al., b wilson et al., ) and rsv (jacks et al., a) demonstrated that the event occurs at these repetitive sequences: in mmtv at the sequence a-aaa-aac (shown as gag frame codons), in hiv-l at the sequence u-uuu-uua, and in rsv at the sequence a-aau-uua. similar sequences from ibv, blv, and srv- can also support frameshifting (jacks et al., a) . most retrovirus frameshift events also require a conserved pseudoknot structure located immediately downstream of all retroviral frameshift sites (jacks et al., a) , a requirement also seen in ibv frameshifting (brierley et al., ) . notably, hiv- does not require its pseudoknot structure for frameshifting (jacks et al., a; wilson et al., ) . this pseudoknot structure may be required to induce a translational pause (jacks et al., a) . like the translational pause in the e. coli case, the pause induced by the pseudoknot allows frameshifting to occur on the slippery sequence. unlike e. coli, frameshifting appears to involve two trnas that recognize two codons of the slippery sequence in the gag reading frame. jacks et al. ( a) showed that the frameshift event involves a simultaneous slippage of these trnas in the ribosomal a and p sites. because certain changes are allowed in the a and p site codons and because several different sites exist (see above), more than one trna (termed "shifty" trnas) is competent to frameshift. frameshifting in ty elements initially appeared to lack all of the features identified in other frameshift sites. no homopolymeric string of nucleotides is necessary in the region of the frameshift event. frameshifting requires neither a nearby termination codon nor a downstream rna secondary structure to induce a translational pause. previously, we showed that a nucleotide sequence is necessary and sufficient to induce ribosomal frameshifting even when placed within a completely heterologous context, the his gene of yeast (clare et al., ) . rna sequencing of an mrna containing this frameshift site demonstrated that the dna and rna sequences are exactly colinear, ruling out any pretranslational mechanism. in this report we show that frameshifting occurs within the nucleotide sequence. since the sequence is flanked with termination codons, upstream in the p/b reading frame and downstream in the ty reading frame, frameshifting is confined to occur within the window between the termination codons. expression of the downstream lacz gene, in the +l reading frame, is unaffected by the termination codons. we show that the frameshift event is directional and reading frame specific. three different constructs allow translation to occur into each of the three reading frames of the frameshift site. for each construct, the /acz gene is fused downstream in all three reading frames. this allows an assay for frameshifting from each of the reading frames in either the +l or - direction. translation into the frameshift sequence in the , or p/a, reading frame (the normal reading frame of the frameshift site) allows wild-type levels of frameshifting in the +l direction. however, translating the +l or - reading frames allows no frameshifting in the +l direction, demonstrating the reading frame specificity of frameshifting. frameshifting does not occur in the - direction from any of the three reading frames, indicating that frameshifting is directional. a model for ty frameshifting deletion analysis and missense mutagenesis define nucleotides essential for frameshifting. this sequence, cuu-agg-c, has some interesting characteristics. over-lapping leucine codons, cuu in the frame and uua in the +l frame, are recognized by a single isoacceptor in yeast, trna&. this trna can recognize all six of the leucine codons by virtue of an unmodified uracil in its wobble position (randerath et al., ; weissenbach et al., ) . modified uracil residues recognize only purines, whereas an unmodified uracil can recognize all four bases (heckman et al., ; sibler et al., ) ; unmodified uracil residues (and consequently, recognition of four nucleotides) is common in mitochondrial trnas ( barrel et al., ; bonitz et al., ; heckman et al., ; sibler et al., ) , where a much smaller number of trnas are sufficient to translate all the codons of the mitochondrial genome. this characteristic makes this trna an ideal candidate for a shifty trna, as it is a major isoacceptor for leucine (present at % the level of the most abundant isoacceptor, trnacaa, leu * ikemura, ) and satisfies wobble rules in both reading frames. the second unique characteristic of this sequence is the agg codon. this codon is recognized by a low-abundance trna, trna$'u, a single-copy essential gene. these two characteristics suggest a model for frameshifting that retains features of frameshift sites in other systems. a slippery sequence, cuu in the frame to uua in the +l frame, is possible because of the unique trna&. a translational pause could be induced by the low-abundance trna'$$,. pausing and frameshifting at "hungry" codons, codons whose cognate trna is in short supply, occurs in other systems (spanjaard and van duin, ; and, in ty elements, may satisfy the apparent requirement for a translational pause to induce frameshifting. the model, diagrammed in figure , states that ribosomes encountering the agg codon pause because of the low availability of trna$u. peptidyl-trna&e, in the p site of the ribosome (on the cuu codon), slips forward +l during the pause onto the uua codon. translation continues in the +l reading frame. we have provided experimental evidence to support this hypothesis. peptide sequencing through the frameshift site indicates frameshifting at the cuu codon, eliminating the simultaneous-slippage model of frameshifting seen in retroviruses. overproduction of trna$u decreases frameshifting approximately -fold, presumably by eliminating the translational pause at the agg codon. since trna'& is now abundant in this background, translation continues in the frame and terminates immediately downstream. this suggests that a translational pause is an essential component of the frameshift event in ty as it seems to be in other systems. significantly, a high copy number suppressor of ty transposition maps to the trna$ gene, a result that directly supports the importance of frameshifting in the expression of the p/b gene and hence in transposition (h. xu and j. d. boeke, personal communication) . a second result implicates trna$o as the slippery trna. since this trna may be the only trna that can decode cuu, we reasoned that overproduction of a second trna that decodes cuu exclusively would compete with trna/-& and reduce frameshifting. this second trna would not be expected the first step necessitates recognition of the cuu codon by trna&. owing to the low availability of trna'&, a translational pause at the agg codon allows time for a frameshift to occur at steo . the commitment to frameshifting occurs at step when the next + frame codon is recognized by its cognate trna. to be able to slip onto uua. changing the anticodon of trna&, to create trna& and overproducing this trna results in a -fold inhibition of frameshifting. clearly, this result demonstrates the importance of trnafze in the frameshift event. as indicated by the missense mutagenesis data, some changes in the nucleotide sequence allow frameshifting at low levels. these changes allow frameshifting at levels of approximately -to -fold below that of the wild-type sequence. it is difficult to ascertain why frameshifting can occur in some of these cases; however, the two cases showing the highest levels of frameshifting may share some features with the wild-type sequence. the a to c change at the first position of the second codon produces a cgg arginine codon in the frame and a uljc phenylalanine codon in the +l frame. cgg is a codon recognized by a rare trna, trna&. a possible reason why this sequence does not support higher levels of frameshifting is seen in the codon usage pattern for cgg. cgg appears at a level -fold below that of agg in yeast genes (aota et al., ) . the lower demand for trna$zo could reduce the length of the translational pause needed for frameshifting. this should result in a lower proportion of frameshift events occurring before translation continues by insertion of arginine at the in-frame cgg codon. the g to u change at the third position of the second codon retains the cuu to uua slippery sequence but changes the agg-arg codon to agu-ser. agu must also allow a shorter pause; the trna that decodes it has not been identified, so we do not know if it is a rare or abundant trna. thus far, attempts to create a frameshift site by replacing the ago codon with other codons recognized by nonabundant trnas have failed. an experiment that definitively tests this hypothesis uses a family of strains retaining from eight to only two of the trna$& genes, the expectation being that when the cell is limited for trna decoding the two tyrosine codons, competition for the aminoacyl-trna will be severe and a substantial translational pause should result. the fact that this, too, failed forces us to conclude either that competition for the trna&, is especially severe or that the translational pause induced by competition for the trna is not the only function of the agg codon, the second role not being satisfied by the other codons tested. a more exhaustive search for possible substitute "pause" codons may determine which possibility is correct. remarkably, frameshifting in ty elements is inhibited by the proximity of the frameshift site to the translational initiation codon. this phenomenon was first observed by placement of the nucleotide frameshift site within four codons of the initiation codon of ty - (clare et al., ) . frameshifting was completely inhibited. similarly, placement of the site the same distance from the i-/ma initiation codon inhibits frameshifting. addition of another codon between the initiation codon and the frameshift site restores frameshifting. this proximity effect has not been observed or examined in other systems and may be a general phenomenon. we hypothesize that translation immediately after initiation might be fundamentally different from that during the elongation phase. this difference could perturb the ribosome's frameshifting ability. experiments are under way to understand what elements determine the ribosome's ability to frameshift early in elongation. yeast strains, media, and general methods the s. cerevisiae strain used for this work unless otherwise indicated is - d (a hi&a um - trpl- ho/j-l). analysis of directionality plasmids was also done in strain lo (a his&z lysl- -o met -l-am sup ura - ) kindly provided by gerald fink. this strain carries a temperature-sensitive amber suppressor, suppressing at tx but not at %. analysis of tyrosine codon substitutions was done in strains kindly provided by maynard olson. the strains are deleted for one to six copies of the eight trna& genetic loci (sup - , ) and have the following genotype: maw or a a& -l-o /ys - -o trp -o leul- canlloo- ~~ - met -l-o (burke, ) . strain abl is deleted for sup ; the plasmid pmb is shown in figure . this plasmid contains the ura gene and the um origin of replication from plgsd (guarente et al., ) and a struncated /acz gene from pmc (casadaban et al., ) ; the construction of this portion of the plasmid has been described (liao et al., ) . the his .a gene was introduced as a . kb sall-bamhi fragment between the xhol and bamhl sites of pnoup (liao et al., ) . replacement of the bamhi-sacl laczfragment with the complementary fragment containing the bamhi-kpnl linker at the 'end of /a&creates pmb . the laczgene is fused via a bamhi-kpnl linker to the his a gene codons downstream of the hi.% initiation codon. missense, codon substitution, and directionality oligonucleotides containing the bp and bp frameshift sites were introduced between the bamhl and kpnl sites as described by derbyshire et al. ( ) . the sequences of directionality oligonucleotides are shown in table . missense and codon substitution oligonucleotides have the following general sequence: sgatccgctgacactt~gcca-tgaggtac- '. this oligonucleotide contains 'and 'overhangs complementary to bamhl and kpnl half-sites, respectively. this allowed cloning into pmb as described above. the underlined region was subjected to missense mutagenesis as described in the text or changed to specific nucleotides as described in the section on codon substitutions (see table ). an oligonucleotide identical to this except for an addition of nucleotides following the underlined sequence fuses the upstream and downstream reading frames in frame. this oligonucleotide (called smer-fusion; table ) allows for quantitation of the level of frameshifting. top and bottom strands of flanking terminator and codon deletion oligonucleotides, depicted in table , were annealed and cloned into the bamhl site of pmb as described in clare et al. ( ) . pmb is identical to pmb except that it lacks the kpnl site at the junction of h/wa and lacz. construction of "proximity" mutations in the his a gene was done by utilizing the polymerase chain reaction (pcr). an oligonucleotide, sal-upstream (see table ) of which the ' nucleotides are complementary to the noncoding strand of the his .a gene, primes synthesis of the coding strand beginning nucleotides upstream of the protein coding region (donahue et al., ) . downstream, six oligonucleotides, of which the ' nucleotides are complementary to the coding strand, prime synthesis of the noncoding strand at codon intervals immediately after the initiation codon. the sequences of these oligonucleotides (called p- p) are listed in table . pcr reactions were done as described by the manufacturer (cetus corporation) on plasmid psal , which contains the complete his gene. the upstream oligonucleotide incorporates a sall restriction site with the downstream oligonucleotides incorporating a bamhl site. the pcr-generated frag ments were digested with sall and bamhl and cloned into thexhol and bamhl sites of pnoup. subsequently, the bamhi-sacl laczfragment of pnoup was replaced by either the bamhi-sacl /acz fragment of pmbs&smervvt or the bamhi-sacl /acz fragment from pty al -co (clare et al., ) to incorporate the bp and bp frameshift sites, respectively. the plasmid used to overexpress trna& was pmb e merwt this plasmid contains the missense oligonucleotide depicted above with the wild-type nucleotide frameshift site. the unique tthllll site was blunted with dna polymerase i large fragment and joined to sall -mer linkers (new england biolabs). the plasmid hi (gafner et al., ) the kind gift of peter philippsen, contains a . kb xhol fragment carrying the gene for trna!&. this xhol fragment was cloned into the sall site of pmb - merwt to create the plasmid pmb -smerwt-trna$$ le" the trna genes encoding trna& trna,,,, and trna,u, "" were overexpressed on the same pmb - merwf plasmid. a gene for trna& is found immediately upstream of the leup gene. pcr was performed on a plasmid bearing the . kb xhol-sall fragment carry ing leup using the sal-downstream and enx-upstream primers (see table ). the product was a bp fragment with ecori, ndel, and xhol sites at the upstream end of the trna fragment and a sall site at the downstream end. ndel-and sallcleaved fragment was cloned into pucl between the unique ndel and sall sites. the resulting clone lacks the unique narl site of puc , but introduces a unique narl site in the insert starting bp upstream of the anticodon of trnalga. to construct the three codon replacements of trnal&, we adapted a pcr procedure in which a whole plasmid is amplified using two adjacent, divergent primers (hemsley et al., ) . the narl-opposite strand primer (table ) primes synthesis from the unique narl site in the direction away from the trnalga anticodon. three primers incorporating the novel anticodons, the aag, uag. and aau primers (table ) prime synthesis from the narl site in the opposite direction. the product is a linear form of the plasmid with narl sites at either end carrying the novel anticodons. the product is digested with narl and recircularized to recover the plasmids bearing the novel trna genes. the xhol-sal fragment encompassing each gene was transferred into the sal site of pmb - merwt and isolates of each in which the trna gene is oriented pointing toward the 'end of the /acz gene of the plasmid were selected. these plasmids are pmb -smerwt-trna&& pmb -smerwt-trnat&, and pmb & merwt-trna& pgalactosidase purification and protein sequencing the protocol for p-galactosidase purification from yeast was provided by robert weiss and is essentially as described (weiss et al., ) . yeast strain -ld, transformed with plasmid p p- merwt. was grown at % in liters of sd minimal medium supplemented with mgll of histidine and tryptophan and % glucose. at a culture density of ~'&i = , the cells were pelleted, washed with one-fourth volume of buffer a ( mm tris-hci [ph . , mm naci, mm edta. . % tween , mm &mercaptoethanol, and . mm pmsf), and then resuspended in the same buffer ( ml of buffer per gram of cells). cells were broken using g of urn glass beads (sigma) per ml of suspension by vortexing for min with min incubations on ice between each minute of vortexing. cell debris and beads were pelleted by centrifugation at x g for min. the resulting supernatant was then centrifuged for min at , x g in a beckman tlloo centrifuge to pellet organelles. a clear supernatant was collected and passed over an anti+-galactosidase immunoaffinity column (protosorb, promega biotec) equilibrated with buffer a. the eluate was concentrated with a centricon centrifuge chamber (amicon), washed four times with hplc-grade water, and then placed in the cartridge of an applied biosystems a protein sequencer equipped with an on-line applied biosystems a high performance liquid chromatography analyzer. ! -galactosidase assay and dna sequencing three transformants of each plasmid were each assayed in triplicate for f%galactosidase activity as described (farabaugh et al., ) . all constructionsdescribed in this paper were sequenced by the chain termination technique (sanger et al., ) from plasmids prepared as described by mierendorf and pfeffer ( ) . we are grateful to robert weiss for providing us with the protocol for j%galactosidase purification from yeast and for sequencing the frameshift protein. we thank i? philippsen, m. olson, and g. fink for providing the clones and yeast strains indicated above. this work was supported by u.s. public health service grant gm . the costs of publication of this article were defrayed in part by the payment of page charges. this article must therefore be hereby marked "advertisement" in accordance with u.s.c. section solely to indicate this fact. received april , ; revised may , . the functions and relationships of ty-vlp proteins in yeast reflect those of mammalian retroviral proteins codon usage tabulated from the genbank genetic sequence data different pattern of codon recognition by mammalian mitochondrial tanas ty elements transpose through an rna intermediate the agg codon is translated slowly in f. co/i even at very low expression levels codon recognition rules in yeast mitochondria context effects: translation of uag codon by suppressor trna is affected by the sequence following uag in the message the influence of codon context on genetic code translation an efficient ribosomal frameshifting signal in the polymerase-encoding region of the coronavirus ibv characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an rna pseudoknot molecular genetics of yeast chromosomes evidence for transposition of dispersed repetitive dna families in yeast an effect of codon context on the mistranslation of ugu codons in vitro galactosidase gene fusions for analyzing gene expression in escherichia co/i and yeast trnay' functions in directing the scanning ribosome to the start site of translation nucleotide sequence of a yeast ty element: evidence for an unusual mechanism of gene expression efficient translational frameshifting occurs within a conserved sequence of the overlap between the two genes of a yeast tyl transposon structure of yeast phenylalanine-trna genes: an intervening dna segment within the region coding for the trna retroviruses. in mobile genetic elements molecular model of ribosome frameshifting frameshift suppression in aminoacyl-trna limited cells slippery runs, shifty stops, backward steps, and forward hops: - , - , +l, + , + , and + ribosomal frameshifting. cold spring harbor symp reading-frame switch caused by basepair formation between the 'end of s rrna and the mrna during elongation of protein synthesis in escherichia co/i f. co/i ribosomes re-phase on retroviral frameshift signals at rates ranging from to percent on the mechanism of ribosomal frameshifting at hungry codons yeast trnalbu (anticodon uag) translates all six leucine codons in extracts from interferon treated ceils expression strategies of the yeast retrotransposon ty: a short sequence directs ribosomal frameshifting hiv expression strategies: ribosomal frameshifting is directed by a short sequence in both mammalian and yeast systems craigen, w. j.. and caskey, c. t. ( ) . expression of peptide chain release factor requires high-efficiency frameshift. nature , - .craigen, w. j., cook, r. g.. tate, w. p., and caskey, c. t. ( ) . bacterial peptide chain release factors: conserved primary structure and possible frameshift regulation of release factor . proc. natl. acad. sci usa , - .derbyshire, k. m., salvo, j. j., and grindley, n. d. f. ( ) . a simple and efficient procedure for saturation mutagenesis using mixed oligodeoxynucleotides.gene , - .donahue, t. f., farabaugh, f? j., and fink, g. r. ( ) . fox, t. d., and weiss-brummer, . ( ) . leaky +l and - frame shift mutations at the same site in a yeast mitochondrial gene. nature , - .gafner, j., de robertis, e. m., and philippsen, f? ( ) . delta sequences in the ' non-coding region of yeast trna genes, embo j. , - .garfinkel, d. j., boeke, j. d., and fink, g. r. ( ) . ty element transposition: reverse transcriptase and virus-like particles, cell , - .guarente, l., yocum, r., and gifford, t? ( ) . a gallo-cyci hybrid yeast promoter identifies the gal regulatory region as an upstream site. proc. natl. acad. sci. usa , - . f, and hall, . d. ( ) . molecular characterization of the tyrosine trna genes in yeast. nature , - .olson, m. v., page, g. s., sentenac, a., piper, f! w., worthington, m.. weiss, r. b., and hall, . d. ( ) . only one of two closely related yeast suppressor trna genes contains an intervening sequence. nature , - . rajbhandary, u. l., chang, j. h., stuart, a., faulkner, b. d., hoskinson, r. m., and khorana, h. g. ( ) . the primary structure of yeast phenylalanine transfer rna. proc. natl. acad. sci. usa , - .randerath. e., gupta, r. c., chia, l. l. s. y., chang. s. h., and randerath, k. ( ) . yeast trnabr$ purification, properties, and determination of the nucleotide sequence by radioactive derivative methods. eur. j. biochem. , - . sanger, f., nicklen, s.. and coulson, a. r. ( ) key: cord- - czkzek authors: lorentz, i t; subramaniam, s shanthi; yiannikas, c title: treatment of idiopathic spasmodic torticollis with botulinum‐a toxin: a pilot study of patients date: - - journal: med j aust doi: . /j. - . .tb .x sha: doc_id: cord_uid: czkzek nineteen patients with spasmodic torticollis, unresponsive to standard therapy, were administered local injections of botulinum‐a toxin into the affected muscles. during an average follow‐up period of . months, a more than % improvement was noted in of patients. all those with purely focal dystonia and of patients with a disease history of less than three years benefited from treatment. side effects were insignificant and transient. botulinum toxin is a very effective and safe method of treatment for spasmodic torticollis. study child was submitted. in this study, wheeze was observed for an average of . days of every loa days of rhinovirus episodes. so, within the maximum . days available for symptom reduction, we would not expect prevention of more than . days per child of wheezing throughout the six months of the study. viruses were cultured in only . of medicable and . % of non-medicable episodes in this study. this viral isolation rate is comparable to the viral yield in the earlier adult study. we do not know the contribution of coronaviruses to the present cases as they were not assessed serologically, but our adult studies suggested that contact prophylaxis was ineffective in preventing coronavirus infections. we conclude that the contact prophylaxis approach in these highrisk children does not offer theoretical benefits. our observations show that these young school-age children are more often than not the initiators of respiratory episodes within their families and therefore at these times would be unable to make use of contact prophylaxis. further, it would seem that while they experience possibly preventable rhinovirus-associated illness, this infection is not associated with substantial lower respiratory symptomatology and that for them the cost of the intranasal medication would be relatively unlikely to be balanced by clinically appreciable benefits. abstract nineteen patients with spasmodictorticollis, unresponsiveto standard therapy, were administered local injections of botulinum-a toxin into the affected muscles. during an average follow-up period of . months, a more than % improvement was noted in of patients. all those with purelyfocaldystonia and of patientswitha disease history of less than three years benefited from treatment, side effects were insignificant and transient. botulinum toxin is a very effective and safe method of treatment for spasmodic torticollis, (med j aust ; : - ) t he term "dystonia" was coined by oppenheim in in describing six patients with alterations in muscle tone, sustained posturing and involuntary movements. since then the definition of dystonia has undergone many modifications, and is now described as "a syndrome of sustained muscle contractions, frequently causing twisting and repetitive movements or abnormal postures" . dystonia is classified according to age of onset, aetiology (symptomatic or idiopathic) and distribution. thus, there are focal, segmental and generalized dystonias. where a single area is involved, such as the eye (blepharospasm), face (oromandibular dystonia), neck (torticollis), or vocal cords (spasmodic dysphonia) the condition is called focal dystonia." the commonest form of focal dystonia is spasmodic torticollis (st) with a suggested prevalence of three per . when two or more contiguous parts are involved in the disease process, such as the face and the neck, for example, it is called segmental dystonia, and generalized dystonia when one or both legs and the trunk are affected. hemidystonia involving half the body usually indicates symptomatic dystonia, with abnormality in the basal ganglia. spasmodic torticollis was first described by francois rabelais, the french humanist, author and physician, in the th century. the mean age of presentation is to years, and the female to male ratio is : . various combinations of neck posture may occur, such as laterocollis, retrocollis and antecollis. the head may be tilted onto one shoulder, and one of the shoulders may be elevated and displaced anteriorly. intermittent or continuous tremor or spasmodic movement may occur. the severity of the abnormal postures and movements can be aggravated by stress and an activity such as walking, while improvement may be achieved by the patient touching the chin, face or the back of the head. this is the so-called geste antagonistique, quite characteristic of st but lacking an adequate explanation at the present time, the involuntary movements cease during sleep. pain can be very severe, intractable and disabling. the onset may be sudden or gradual, the condition usually progressing for a few years and then becoming stationary. remissions occur in % of patients, usually in the first few years after the onset. many patients are unable to work, and even such activities as driving a car, eating, reading or watching television may become difficult or impossible. the obvious neck deformity causes a constant embarrassment, and the patient's suffering is increased by the lack of understanding and the ineffective therapies available. medical treatment and psychotherapy are usually unsuccessful. - surgical treatment may have adverse results," a significant morbidity and even a small mortality" botulinum-a toxin, a neuroparalytic agent, has recently been used in the treatment of focal dystonias. it was pioneered for the treatment of strabismus by dr alan scott'? and has been shown to be effective for the treatment of blepharospasm, - oromandibular dystonias, is spasmodic torticollis.v?? spasmodic dysphonia" and focal hand dystonias.:" clostridium botulinum produces eight distinct neurotoxins, which cause widespread muscular paralysis, characteristic of the often fatal syndrome of botulism. when botulinum-a toxin is injected intramuscularly in minute quantities local denervation and muscle weakness occur, lasting for several weeks until the nerve endings regenerate. the toxin inhibits the release of acetylcholine, probably by interfering with calcium channels." over the past two years we have used botulinum-a toxin to treat over patients suffering from st. we report the results of a pilot study of the first patients, who have been followed up for an average of . months. nineteen patients ( women and men),aged from to years (average, . ), were enteredin the study.the patients werereferred to one of us (i t l) because of st which was intractable to the usual medical and surgical measures. the duration of the torticollis before our treatment was from months to years (mean, years ii months). the follow-up ranged from months to years (mean, . months). six patients had focal dystonia, eight segmental dystonia, and five generalized dystonia (table) . all patients had had several unsuccessful trials of medical therapy, physiotherapy and/or psychotherapy. two patients had undergone accessory nerve section combined with anterior rhizotomies of the ci-c nerve roots, and one patient a unilateral thalamotomy, all with disappointing results. the associated conditions wereessentialtremor in two patients, affective psychosis in two, unilateral blindness in one, bilateral blindness in one, and haemochromatosis in one patient. after giving informed consent, the patients were offered botulinum toxin treatment. all patients remained ambulant during the therapy and continued to take their previous medications. patients were assessed clinically by one of us (i t l) and graded according to the scale of tsui et al." pain was graded on a scale of zero to . note was taken of ability to cope with activitiesof daily living. videotape recordings of each patient were made before treatment and surface electromyography of the sternomastoid, trapezius and splenius capitis muscles was performed. one week after the injection, patients reported by telephone any side effects, as well as beneficial results. the patients were reviewed at six weeks and weeks after injection and a repeat videotape recording was made. the randomized "before" and "after" videotape recordings wereassessed "blind" by two of us (s sand c y) and graded according to the torticollis scale of tsui et al." patients were asked to assess their improvement quantitatively. particular attention was paid to the amount of pain and to any changes in activities of daily living. botulinum-a toxin was obtained from the smith-kettlewell eye research institute, san francisco, usa. the toxin was supplied as a freeze-dried powder, at a temperature of - °c, in vials containing mouse units (i mouse unit = , lethal dose = . ng). immediately before use the toxin was reconstituted with i ml of . , saline, without added preservative. one millilitre of the reconstituted toxin contained mouse units. a tuberculin syringe and a or gauge needle were used to inject up to mouse units of botulinum-a toxin into each of two to three muscles affected by involuntary spasms. the musclesselectedwere those most affected clinically. the sites usually chosen were the sternomastoid opposite to the direction of rotation of the chin, and the splenius capitis and trapezius muscles ipsilateral to the rotation (figure) . the injection sites were modified according to the clinical picture or the electromyographic findings. up to mouse units of botulinum toxin were given on the first occasion. injections were repeated when the clinical effect was wearing off, usually at three-monthly intervals. when the initial effect was unsatisfactory, the dose of toxin was increased by , . the maximum given on subsequent occasions was a total of mouse units. the results are summarized in the table. an improvement of or more was noted in of the patients ( %), and the remaining five ( ) showed either no change or insignificant improvement. patients with focal dystonia had the best results, all achieving a more than % improvement; patients with generalized dystonia rarely benefited; and the results for those with segmental dystonia fell between these two groups. female sex, focal dystonia and a duration of disease of less than three years were good prognostic indicators, while male sex, generalized dystonia and chronic disease were unfavourable signs. sixteen patients suffered from pain of varying intensity - ( %) obtained relief and in four the pain remained unchanged. fourteen patients were better able to cope with activities of daily living: some were able to return to work or resume housework, ii few were again able to drive, and most became more mobile and active. in patients, the side effects consisted of pain at the injection site. the pain lasted to hours and was usually of moderate severity. muscle weakness around the neck occurred in three patients and transient lethargy for about one to two days was reported in two. improvement was never instantaneous, but occurred usually within two to ten days of the injection, reached a maximum in four to six weeks and lasted for nine to eleven weeks. repeat injections were given at approximately three-monthly intervals. four patients discontinued treatment, three because of a virtual remission in their symptoms and one because of lack of response. the following clinical records are fairly typical of the group as a whole. a -year-old female secretary developed gradual stiffening as well as twisting and jerking movements of the neck nine months before botulinum toxin treatment. her neck started to turn to the left and attempts to control it caused pain and a jerking movement. she consulted a number of specialists as well as physiotherapists and practitioners of alternative medicine. she took anti-inflammatory agents, benzhexol, dopa-depleting agents and benzodiazepines, all to no avail, and underwent an intensive course of meditation. she gave up work, became depressed and lost kg of weight. when seen in june she had moderately severe torticollis and some dystonic posturing of the trunk. she was treated with injections of units of botulinum-a toxin in the right sternomastoid muscle and units each into the left trapezius and splenius capitis muscles. improvement started within one week of treatment and continued for two months, and she has remained well for at least two years. she resumed work and all her usual activities. she is now in remission. it is possible that she is one of the % in whom spontaneous remission occurs, but her improvement coincided with the injection of botulinum toxin. a -year-old male mechanic suffering from haemochromatosis, which was treated with weekly venesections, developed spasmodic torticollis months before he was referred for botulinum toxin treatment. he saw several neurologists, and other specialists, including a psychiatrist. anticholinergics, benzodiazepines, haloperidol, tetrabenazine and clobazam were tried without success. when first seen he had violent twisting movements of the neck to the right, associated with rapid jerking of the right shoulder, and spasms of his jaw muscles, with severe pain in the neck and right shoulder. he had to giveup work and was hospitalized for two weeks to control his condition, with only partial success. he gave up driving his car. financial difficulties resulted because of his enforced unemployment and he became depressed. injections of botulinum-a toxin into the left sternomastoid, both trapezii and the right splenius capitis muscles were given on three separate occasions over a period of three months. the total amount of botulinum toxin injected was units. significant improvement occurred, and the patient was able gradually to stop most of his medications and return to casual employment. he still attends for toxin injections every three to four months, and is significantlybetter than previously. idiopathic spasmodic torticollis is the commonest form of focal dystonia. a report from rochester, minnesota, gave a prevalence rate of . per million, higher than the prevalence of such neurological diseases as muscular dystrophy and myasthenia gravis." botulinum-a toxin was first used in the treatment of torticollis by tsui in .' since then several authors have reported favourable results. ' . ' . . we obtained a better than improvement in of our patients ( %), and in ii the improvement was rated as more than % (table) . these results are similar to those of other studies reported. patients usually obtained better head control, alleviation or relief of pain and significant improvements in ability to cope with activities of daily living. objective measurements mirrored these subjective reports. understandably, patients with focal dystonia responded best of all, and those with generalized dystonia had the least satisfactory results: nine of patients with focal dystonia improved, while two of five individuals with generalized dystonia benefited from the treatment. men responded less well than women. one of the reasons for this difference may be that the relativelylarger and stronger muscles of men require higher doses of botulinum toxin to produce a paralysis equivalent to that in women. we now attempt to adjust dosages according to body weight and muscle bulk. in patients the duration of the symptoms was less than three years. nine of these patients improved. on the other hand, of nine patients whose symptoms had been present for more than three years only five benefited. we have not come across definite cases of resistance of botulinum toxin, suggesting the possible presence of antibodies. in those cases, however, where an initial good response is followed by unresponsiveness, the search for antibodies may be warranted. in % of cases there was often dramatic relief of pain, even before the muscular overactivity abated and, on a number of occasions when torticollis was successfully relieved, dystonia in other more distant parts of the body also improved. these observations suggest that botulinum toxin may modify central mechanisms of pain and motor control, perhaps through retrograde transport of the toxin to the motor nerve cell. it is unlikely that our good results are due entirely to a placebo response, as the results of treatment were often sudden and dramatic, where other modalities, even surgery, had failed. in up to % of patients with st the symptoms may remit in the first five years of the illness, so some cases of improvement may be examples of a natural remission hastened by botulinum toxin injections. we hope to confirm the validity of our present results in the near future with a controlled double-blind trial. side effects in this series were minimal; stell et al. in their recent report mentioned that seven of of their patients developed dysphagia, and took some weeks to recover. this difference in side effects is probably due to the higher dosages employed by the english investigators. when given intramuscularly in appropriate amounts, botulinum toxin appears to be an extremely safe agent. the effects of inadvertently high doses can be potentially reversed by giving intramuscular antitoxin." the main disadvantage of botulinum toxin injections is the necessity for repeated injections, given in this series at intervals ranging from one to four months. the injections cause little inconvenience or side effects, and only one patient elected to discontinue treatment on account of lack of response. three patients were relieved of their symptoms after one to three injections. at present, botulinum toxin is an investigational agent, released by the manufacturers to certain investigators under specified research protocols. once the us or british authorities approve its commercial release, it may become more widely available. botulinum toxin appears to be the treatment of choice for idiopathic spasmodic torticollis, as well as for an ever increasing number of spasmodic movement disorders. prophylactic efficacy of intranasal alpha- interferon against rhinovirus infections in the family setting prevention of natural colds by contact prophylaxis with intranasal alpha- interferon intranasal interferon alpha-z prophylaxis of natural respiratory virus infection prevention of natural rhinovirus infection by daily intranasal interferon outcome for acute bronchitis, bronchiolitis and pneumonia in infancy vitamin a status of children with a history of respiratory syncytial virus infection in infancy uber eine eigenartige krampfkrankheit des kindlichen und jugendlichen alters (dysbasia lordotica progressiva, dystonia museu/drum deformans) concept and classification of dystonia idiopathic spasmodic torticollis: pathophysiology and treatment spasmodic torticollis: clinical and biologic features and their implications for focal dystonia principles of neurology brain's clinical neurology brain's diseases of the nervous system natural history of spasmodic torticollis and effect of surgery vascular catastrophe following the dandy mckenzie operation for spasmodic torticollis pharmacologic weakening of extraocular muscles botulinum toxin in the management of blepharospasm meige syndrome and hemifacial spasm: treatment with botulinum toxin botulinum toxin in ophthalmology who needs botulinum toxin? botulinum toxin injection for the treatment of orornandibular dystonia local treatment of spasmodic torticollis with botulinum toxin double blind study of botulinum toxin in spasmodic torticollis botulinum toxin in spasmodic torticollis controlled trial of botulinum toxin injections in the treatment of spasmodic torticollis treatment of idiopathic spasmodic torticollis with botulinum a toxin jankovic . botulinum toxin injection of the vocal fold for spasmodic dysphonia treatment of focal dystonias of the hand with botulinum toxin injections clostridium botulinum toxins: nature and preparation for clinical use epidemiology of focal and generalised dystonia in antitoxin reduces botulinum side effects we acknowledge the important contribution of dianne markham. lorraine davies and bernadette roberts in maintaining regular liaison with parents, the role of the parents themselves in keeping the diaries and the research grant from schering ltd which enabled the study to be carried out. we wish to thank drs alan scott and graham pittar for helpful advice and encouragement. we are grateful to our colleagues who referred patients to us. key: cord- -ak bf gq authors: payne, h. r.; storz, j.; henk, w. g. title: bovine coronavirus antigen in the host cell plasmalemma date: - - journal: experimental and molecular pathology doi: . / - ( ) -g sha: doc_id: cord_uid: ak bf gq abstract expression of bovine coronavirus (bcv) antigen in the plasmalemma of epithelioid human rectal tumor (hrt- ) and fibroblastic bovine fetal spleen (bfs) cell lines was traced by immunofluorescence and immunoelectron microscopy facilitated by colloidal gold. cytoplasmic fluorescence was first observed at hr postinfection (h.p.i) in infected hrt- cultures. this fluorescence coincided with the appearance of cell surface antigen reacting with colloidal gold-labeled antibodies to bcv antigens. at h.p.i the amount of viral antigens at the surface of hrt- had increased, although cytoplasmic fluorescence remained constant. infected bfs cells but not hrt- cells formed polykaryons when incubated in the presence of trypsin. one viral antigen in the plasma membrane of bfs cells was thus identified as the s glycoprotein with a fusion domain. in contrast to hrt- cells, the overall amount of bcv antigens at the surface of bfs cells remained constant after the onset of fusion. analysis of the labeling characteristics established that the goldmarked-sites represented de novo expression of bcv antigen in the plasma membrane of infected cells. bovine coronavirus (bcv) infections are associated with enteric disease of viral etiology in newborn calves (mebus et al., ; doughri et al., ) . the envelope of bcv virions contains two types of morphologically and functionally distinct spikes containing glycoproteins (storz et al., ; king et al., ) . the major envelope-associated glycoprotein s has a molecular mass of kda which is cleaved into sl and s ( -l kda) while he has kda in the reduced and kda in the nonreduced form. s carries the structural sites responsible for virus attachment and fusion of host cells (collins et al., ; deregt et al., ) . hemagglutination of rodent red blood cells and acetylesterase activity is associated with he of bcv (king et al., ; vlasak et al., ; cavanagh et al., ) . the integral membrane glycoprotein m has a molecular mass of - kda. the nucleocapsid protein n is phosphorylated (king and brian, ; lapps et al., ) . the initial adaptation of wild-type strains of bcv to different cultured cells is difficult but most successful in the human rectal tumor (hrt- ) cell line which was derived from an adenocarcinoma (tompkins et al., ; laporte et al., ; . monolayers of these polarized epithelioid cells resemble enterocytes, the type of cells targeted by bcv in natural infections (doughri and storz, ) . cultures of different bovine fetal cells support noncytocidal multiplication of the cell-adapted strain of bcv (mebus et al., ) . bovine fetal spleen (bfs) cells are highly susceptible to bcv-induced cell fusion if trypsin is added to the medium of infected cultures. cell fusion depends on trypsin cleavage of the -kda precursor to the loo-to ilo-kda sl and s storz et af., ; .cavanagh et al., ) . this phenomenon implies that virally encoded macromolecules are expressed in the plasma membrane (white et al., ) . viral proteins in the host plasma membrane are not necessary for bcv maturation because coronaviral particles are enveloped by budding into intracellular compartments (sturman and holmes, ) . viral components at the cell surface contribute to intracellular spread of the infection by fusion with uninfected cells, and they serve as targets for immune surveillance. immunoelectron and immunofluorescence microscopy were used in this investigation to analyze the expression of virus-specific antigen in the plasmalemma of cells infected with bcv. monolayers of hrt- cells (tompkins et al., ) were maintained in dulbecco's modified eagle's medium (dmem) buffered with mm nahco, and supplemented with % fetal calf serum. the d strain of the bfs cell line was maintained in minimal essential medium (mem) buffered with mm n- -hydroxyethylpiperazine-n'-zethanesulfonic acid and supplemented with % fetal calf serum. working stocks of the mebus strain l of bcv (mebus et al., ) with lo to ' p.f.u. per milliliter were prepared in hrt- cells. monolayers were grown in -cm* solvent-resistant culture dishes for immunogold labeling experiments and in multiwell chamber slides for immunofluorescence studies. the cells were washed with serum-free medium, infected with bcv (m.o.i. = to p.f.u. per cell) for min at °c covered with fresh medium, and incubated for various periods. infected bfs cultures were incubated with and without the addition of . pg of trypsin (type xiii, sigma chemical co.), per milliliter. we used a polyclonal rabbit antibody against purified bcv. this antiserum had a neutralization index of . and reacted in western blots with all bcv proteins. the igg fraction was obtained by protein-a-sepharose column chromatography of antiserum and normal serum from rabbits. cultures for electron microscopy were fixed for min at °c in % glutaraldehyde in . m nap , . m nacl at ph . (pbs), washed overnight in pbs, and then treated for min with m&f glycylglycine to quench reactive aldehyde groups. the fixed monolayers were incubated at °c in rabbit anti-bcv igg or normal rabbit igg, washed in pbs, and then incubated with goat anti-rabbit igg conjugated to -nm colloidal gold (janssen life sciences products, beerse, belgium). these monolayers were tixed again in % glutaraldehyde in pbs for hr at °c posttixed for h in a solution of % osmium tetroxide and % potassium ferrocyanide in pbs, washed in . m sodium acetate buffer, ph . , and stained en bloc for h with . % uranyl acetate in acetate buffer. after being washed in distilled water, the cells were dehydrated in an ascending alcohol gradient, embedded in situ in spurr's epoxy resin % ) , and polymerized at °c. the embedded monolayers were peeled from the plastic substrate and reembedded. thin sections were cut in a plane perpendicular to the monolayer, stained with lead citrate, and viewed with a zeiss em- transmission electron microscope at kv. the density of labeling on the cell surface was quantitated by counting the number of gold particles per length of plasmalemma in thin-sectioned cells. an payne, storz, and henk image analyzing system (sigma scan, jandel scientific) was employed to measure membrane length directly from electron microscope negatives. preparations for immunofluorescence microscopy were fixed for min in % formaldehyde in pbs with . % cacl, and . m sucrose, permeabilized for min with acetone at - o"c, incubated with rabbit anti-bcv antibody, and reacted with goat anti-rabbit antibody conjugated to fluorescein isothiocyanate. the preparations were viewed with a leitz fluorescent microscope using epifluorescence. dantly at hr with . ? . gold particles bound per micrometer length of plasma membrane. bcv antigen was located on both microvilli and planar portions of the apical plasma membrane. the gold particles were spatially separated in general, but observations of clustered bcv antigen in the plasma membrane were made as well. neighboring cells without evidence of infection were practically devoid of label with fewer than . gold particles per micrometer of plasmalemma. negative control preparations included (i) uninfected hrt- cells that had been incubated with anti-bcv antibody and (ii) infected cells that had been incubated with the igg fraction of normal rabbit serum. these cells were not labeled by the gold probe, confirming that the antibody bound only to virus-specific antigen. the plasma membrane was not labeled on uninfected hrt- cells adsorbed at °c with bcv and incubated with these immunoreagents. this observation implies that binding of whole virus or subviral components to cellular receptors did not contribute to our observation of gold association with the plasma membrane. accumulation of bcv antigen in bfs cells. polykaryocytosis was evident by hr in infected bfs cells incubated in medium with trypsin but cell fusion was not observed in the absence of trypsin. we used immunofluorescence and immunogold electron microscopy to correlate the onset of cell fusion with the synthesis of viral antigen. faint fluorescence was first recognized in bfs cultures at hr postinfection (fig. a) . fluorescent cells constituted to % of the cell population at and hr postinfection in cultures incubated without trypsin. cultures that were incubated with trypsin contained large polykaryons with cytoplasmic fluorescence at hr (fig. b) while cultures without trypsin contained only mono-and binucleated cells (fig. ~) . fewer than % of the remaining single cells in trypsintreated cultures were nonfluorescent at hr. this decrease in the number of electron microscopic preparations revealed no evidence of membrane fusion in bfs monolayers fixed after h of infection in the presence of trypsin (fig. a) . at the same time, multiple sites of bcv antigen in the plasma membrane were labeled (fig. b) , indicating that antigen appearance at the plasma membrane preceded the onset of cell fusion by several hours. viral antigen did not increase in the plasma membrane after the onset of cell fusion in infected bfs cell cultures. vesicles filled with virus particles and continuous with the plasma membrane were observed as early as hr after infection in bfs cells (fig. ~ ). this event appeared to represent exocytosis of newly formed coronavirus particles. the abundance of gold binding sites on polykaryons at hr (fig. a) was approximately equal to the number seen on bfs cells not treated with trypsin (fig. b) . evidently, the addition of trypsin did not alter the amount of viral antigen at the cell surface but influenced its function. our results are in agreement with reports of viral proteins at the surface of cells infected with mouse coronaviruses. collins et al. ( ) used immunoferritin electron microscopy to demonstrate that the -kda protein of mhv- is present at the surface of infected l- cells at hr postinfection. other evidence for coronavirus-specific proteins at the cell surface relied on inhibition of virus-induced cell fusion by antibodies specific for envelope proteins sturman et al., ) and on fusion foci experiments (mizzen et al., ; tooze and tooze, ) . our immunogold procedure directly demonstrates the presence of coronaviral antigen in the plasma membrane and extends the earlier observations to include the bovine coronavirus. we found that bcv antigen was expressed at the surface of infected cells despite the intracellular mode of maturation for this virus. the gold-labeled sites were observed in areas free of attached vu-ions. control preparations indicated that these sites represent de n~vo expression of virus-specific proteins in the plasma membrane. bcv-infected bfs cells are highly susceptible to fusion in contrast to bcvinfected hrt- cells, which are relatively resistant to fusion (payne and storz, ) . this difference in fusion capacity in the two cell types probably depends on differences in membrane structure such as the respective complements of membrane proteins, glycolipids, or the composition of the lipid bilayer (sturman and holmes, ; white et al., ) . infected bfs cells failed to accumulate surface viral antigen after the onset of cell fusion, but bcv-infected hrt- cells accumulated increasing amounts of viral antigen on the cell surface yet these cells failed to fuse. the differences among infected bfs and hrt- cells in the surface expression of viral antigen and fusion might result from the kinetics and mechanisms of protein expression and the differences in the composition of the two plasma membranes. the expression of bcv antigen in the plasma membrane has important implications for host-virus interactions. the appearance of virus-specific surface components during eclipse, for example, renders the infected cell susceptible to specific antibody-dependent or cell-mediated host defense mechanisms. cell fusion induced by bcv may be an important mechanism for cell-to-cell spread of the infection (mebus et al., ) . here, we have shown that the appearance of viral antigen on the surface of bcv-infected cells precedes the onset of fusion. this fusion activity involves the s glycoprotein, which promotes fusion after trypsin cleavage of the kda precursor to the ioo-to lo-kda sl and s payne and storz, ; cavanagh et al., ) . this bcv glycoprotein was thus identified by its function as a plasmalemma antigen of infected cells. the bcv hyperimmune serum used in our studies did not permit differentiation of the bcv glycoproteins. monoclonal antibodies were not available when we initiated these investigations, which were designed to clarify whether bcv antigens are detectable at all in the plasmalemma of infected cells. recommendation of the coronavirus study group for the momenclature of the structural proteins, mrnas, and genes of coronaviruses monoclonal antibodies to murine hepatitis virus- (strain jhm) define the viral glycoprotein responsible for attachment and cell-cell fusion structural proteins of bovine coronavirus and their intracellular processing light and ultrastructural pathological changes in intestinal coronavirus infection of newborn calves morphology and morphogenesis of a coronavirus infecting intestinal epithelial cells of newborn calves evolution of a coronavims during persistent infection in vitro analysis of the functions of coronavirus glycoproteins by differential inhibition of synthesis with tunicamycin bovine coronavirus structural proteins bovine coronavirus hemagglutinin protein in vitro culture of bovine enteritic coronavirus (bec) sequence analysis of the bovine coronavirus nucleocapsid and matrix protein genes neonatal calf diarrhea: propagation, attenuation, and characteristics of a corona-like agent neonatal calf diarrhea caused by a virus that induces villous epithelial cell syncytia fusion resistance and decreased infectability as major host determinants of coronavirus persistence analysis of cell fusion induced by bovine coronavirus infection a low viscosity embedding medium for electron microscopy bovine coronavirus-induced cytopathic expression and plaque formation: host cell and virus strain determine trypsin dependence the influence of the host cell and trypsin treatment on bovine coronavirus infectivity enhancement of plaque formation and cell fusion of an enteropathogenic coronavirus by trypsin treatment the molecular biology of coronaviruses proteolytic cleavage of the e glycoprotein of murine coronavirus: activation of cell-fusing activity of virions by hypsin and separation of two different k cleavage fragments cultural and antigenic properties of newly established cell strains from adenocarcinomas of human colon and rectum infection of att murine pituitary tumour cells by mouse hepatitis virus strain a : virus budding is restricted to the golgi region the e protein of bovine coronavirus is a receptor-destroying enzyme with acetylesterase activity. .i. virology , this work was supported by grants -crsr- - , -crsr- - and - - from the united states department of agriculture. this paper contains parts of a dissertation submitted by h. r. payne to louisiana state university in partial fulfidlment of the requirements for the ph.d. degree. key: cord- -ro dl authors: wang, fun-in; stohlman, stephen a.; fleming, john o. title: demyelination induced by murine hepatitis virus jhm strain (mhv- ) is immunologically mediated date: - - journal: journal of neuroimmunology doi: . / - ( ) -w sha: doc_id: cord_uid: ro dl abstract the neurotropic mouse hepatitis viruses (mhv), in particular strain jhm (jhmv or mhv- ), cause experimental central nervous system demyelination that pathologically resembles multiple sclerosis, an important human demyelinating disease. the mechanism of jhmv-induced demyelination remains unclear, though its tropism for oligodendrocytes had led to the belief that jhmv causes demyelination by direct lysis of these myelin-producing cells. however, several studies have also implicated the involvement of immune responses in the demyelinating process. in this communication, we present evidence that generalized immunosuppression with gamma irradiation prevents jhmv-induced demyelination, a finding that was not limited to a particular strain of jhmv or to one strain of mouse. in addition, significant paralytic-demyelinating disease was restored to infected, irradiated mice after the adoptive transfer of nylon wool nonadherent splenic cells and appeared to be restricted by the major histocompatibility complex (mhc). these observations indicate that the principal mechanisms of jhmv-induced demyelination are most likely immunopathological. has been used to study demyelination experimentally. these models include experimental allergic the murine coronavirus jhmv, also desig-encephalomyelitis (eae) and infection by theiler's hated mhv- , was originally isolated from mice virus, canine distemper virus, semliki forest virus, which spontaneously developed hindlimb paralysis a coronavirus, visna virus, and others (reviewed and demyelination (bailey et al, ; cheever et by raine, ; martin and nathanson, ; dal al., ) . subsequently, jhmv infection of ro-canto and rabinowitz, ; stohlman and dents has been one of several model diseases which kyuwa, ) . for the viral models of experimental demyelination, rodriguez ( ) has outlined a use-gory of direct viral cytopathic effect on oligo-representative mice bled and tested by enzymedendrocytes, the cells which produce and maintain linked immunosorbent assay (elisa; fleming and myelin; in this mechanism, the immune system pen, ) for antibodies to murine coronaviruses plays no role or merely has a scavenging function, were seronegative. this hypothesis is supported by findings that the isolation and characterization of jhmv jhmv replicates and causes acute cytopathology antigenic variant . -v- in oligodendrocytes (lampert et al., ; and a small plaque variant jhmv-ds (stohlman ; powell and lampert, ; fleury et al., et al., ) have been described previously. ), as well as by several reports that animals viruses were propagated under serum-free condiwhich are either immunosuppressed or im-tions and quantitated by plaque assay on dbt munodeficient nonetheless develop jhmv-in-cells (stohlman and weiner, ) . prior to inocduced demyelination to a variable degree (soren-ulation, viruses were diluted in dulbecco's minimal sen et al., , ) . on the other hand, studies essential medium. mice were injected either i.c. have shown that mhv may elicit a variety of with /xl containing plaque-forming units potentially immunopathological responses, includ-(pfu) of virus or i.p. with . ml containing ing alteration in major histocompatibility complex pfu of virus. infectious virus titers in brain ho-(mhc) antigen expression (massa et al., ; mogenates were measured on l cells and by suzumura et al., ) , reactivity to myelin basic infectious center assays as previously described protein (watanabe et al., ) , anti-viral antibod- (stohlman and weiner, ) . ies (fleming et al., ) and anti-viral t cells (sussman et al., ) . despite the evidence show-gammdirradiation ing that jhmv is capable of causing ( ) direct mice were irradiated with a ~ vcs gamma verticytopathology and ( ) potentially immunopatho-cal beam source at rad/min (gamma cell , logical responses, controversy remains about the atomic energy of canada) under the experimenextent to which either of these processes actually tal conditions noted below. in experiments conpredominates in vivo. ducted to compare the effects of irradiation of the two approaches were taken to directly study central nervous system (cns) with those of systhe role of the immune system in the jhmv-in-temic compartments, mice were anesthetized using duced demyelination. first, infected animals were pentobarbital ( mg/kg; i.p.), placed in a plastic immunosuppressed by gamma irradiation early in restrainer, and protected by mm thick lead the disease course. second, immunosuppressed shields introduced above and below the mice mice were reconstituted by the adoptive transfer longitudinally to either cover the cns (systemic of spleen cells from immune donors. these experi-exposure; mm dorsal shield) or the non-cns, ments revealed that jhmv-induced demyelination systemic areas (cns exposure; ventral shield to is prevented by gamma irradiation and partially within mm of the back). mock experiments and restored by the transfer of immune splenocytes, dissections confirmed that differential irradiation providing direct evidence for a central role of the of the cns (brain and spinal cord) or systemic immune system during jhmv-induced demyelina-compartments (including spleen, lymph nodes, and tion. bone marrow) was achieved under these shielding conditions. donor mice were either not immunized (naive donors) or immunized i.p. with approximately six-week-old male c bl/ j and balb/cj pfu of virus (immune donors) at days prior to mice were obtained from jackson laboratories adoptive transfer. single-cell suspensions were (bar harbor, me, u.s.a.). mice were held for prepared from spleens of donor mice, and x v - h before intracerebral (i.c.) infection or cells were injected intravenously (i.v.) into recipiintraperitoneal (i.p.) immunization with virus. all ent mice which had received rad of irradiation immediately prior to transfer. in some experi-statistical analyses ments, donor cells were fractionated into nylon both clinical and histological scores were comwool adherent (nwa) and nylon wool non-adher-pared for statistical significance using the mannent (nwna) populations (sussman et al., ) whitney test for nonparametric samples (statsoft prior to transfer, statistical programs, tulsa, ok, u.s.a.). a probability (p) < . by this test was considered sig-clinical evaluation nificant. in instances where observers disagreed, mice were evaluated for clinical signs of de-the histological score assigned was~either the lower myelination using a scale modified from brown et grade (one-step disagreement, n = / observaal. ( ) . numerical values were assigned as fol-tions) or intermediate grade (two-step disagreelows: , normal; , minimal gait abnormality; ; ment, n = / observations). moderate paraparesis; , severe paraparesis; and , paraplegic. evaluations were scored at day postinfection (p.i.), as almost all mice that will results develop subacute or chronic disease after . -v- infection show some abnormal clinical signs at or whole body irradiation before day p.i. . to study the immunosuppressive effects of irradiation, different amounts of whole body histological evaluation gamma irradiation were administered daily mice were sacrificed at day p.i. and tissues throughout the disease course in c bl/ j mice were fixed in clarke's solution ( % absolute al-after i.c. infection with jhmv variant . -v- . cohol and % glacial acetic acid), embedded in irradiation dramatically reduced paralytic-deparaffin, and stained with hematoxylin and eosin myelinating disease if rad were administered (h&e) or luxol fast blue (lfb) counterstained at day p.i. or earlier. at day p.i. or later, with eosin . for quantitative however, disease was unaffected by as much as assessments, a single longitudinal section of h& rad. based on these data, we chose to admin-e-stained spinal cord was reviewed independently ister rad on day p.i. in subsequent experiby two observers without knowledge of the ments in which clinical and histological diseases animal's experimental group. evaluation focused were monitored quantitatively. on the degree of inflammation, edema, and dis-severe paralysis and demyelination were eviruption of tissue architecture in the white matter, dent by day p.i. in infected, untreated mice pathology was graded as follows: , normal; i, (table , group ) as reported previously (fleming slight (mild, focal) ; , moderate (mild, diffuse); , et al. , ) . fig. shows several histological marked (intense, focal) and , severe (intense, features of the demyelinating lesions observed in confluent). grade and lesions correspond to group , including inflammatory hypercellularity the fully developed plaques of acute, primary (a, b, c, e), scanty viral antigen and the presence jhmv-induced demyelination first described by of naked axons (d). in contrast, infected mice bailey et al. ( ) and weiner ( ) . using irradiated at day p.i. had a marked reduction in myelin staining and electron microscopy, we have both paralysis and demyelination (table , group previously shown that jhmv antigenic variant ; fig. b ). irradiation given to uninfected, naive . -v- produces lesions identical to those initially mice had no demonstrable clinical or histological described, in which the principal changes are effect (data not shown). to determine if the dimyelin loss and axonal preservation (fleming et minution in disease could be attributed to the al., , ) . viral antigen was detected by inhibition of virus replication by irradiation, the immunoperoxidase staining , virus titer in brains of irradiated ( rad) and using monoclonal antibody (designated j. . ) control mice were compared. fig. shows that the specific for the jhmv nucleocapsid protein as virus titer in the irradiated mice exceeded that of primary antibody, and counterstained with hema-the unirradiated controls. these data indicate that toxylin, the absence of disease was not due to an inhibi- six-week-old male c bl/ j mice were given pfu of jhmv . -v- i.c. on day , as indicated by ' +' sign. tad of whole body irradiation were given at day p.i., as indicated by ' +' sign. c clinical observations and blinded histological evaluations were performed as indicated in materials and methods ( - scales, with grade being maximal disease). the mean, standard deviation, and number (n) of mice tested are shown. underlined values indicate a statistically significant difference (p < . ) between groups and as determined by the mann-whitney test for nonparametric samples. tion of virus replication. in addition, immunohis-infected with pfu of . -v- also developed tochemical studies showed that following . -v- severe paralytic-demyelinating disease by day challenge, viral antigen was scanty or absent in p.i. disease was also prevented in these mice by unirradiated mice (fig. d ) but was very abun- rad of whole body irradiation at day p.i. dant in irradiated mice ( fig. a) . many of the (data not shown). these findings are essentially antigen-positive cells in irradiated, infected mice identical to those obtained in c bl/ j mice appeared to be oligodendrocytes ( fig. a) ; infected with . -v- , suggesting that abrogation surprisingly, these cells showed few or no morpho-of demyelination by irradiation is not dependent logical abnormalities, on an unusual characteristic of a particular jhmv in control experiments paralleling those shown strain or mouse strain. in table , mice were infected with a second jhmv strain, jhmv-ds (stohlman et al., ) , and were either irradiated or not irradiated. un-in view of the finding that whole body irradiairradiated mice demonstrated intense disease at tion at day p.i. prevents jhmv-induced paraday p.i. by contrast, mice given rad at day lytic-demyelinating disease, differential irradiation p.i. had few histological changes at day p.i. in studies were conducted to determine whether critiaddition, a second mouse strain, balb/cj mice cal radiosensitive targets reside in the systemic or a immune donor mice were -week-old c bl/ j males given pfu of jhmv . -v- i.p. days prior to transfer. naive donors were identical mice not given virus. in each group, x v spleen cells were transferred i.v. into recipient mice on day p.i. b recipient mice were -week-old c bl/ j male inoculated (virus) or not (naive) with pfu of jhmv . -v- i.c. on day . all recipient mice were given rad prior to adoptive transfer on day p.i. scoring was performed as indicated in table . underlined values are clinical or histological scores which are significantly greater than respective scores of jhmv-infected, irradiated mice not given splenocytes ( cns compartments. when rad were delivered at day p.i. to systemic regions (including spleen, to the cns only (brain and spinal cord) at day lymph nodes, and bone marrow) but not to the after . -v- infection, marked white matter pa-cns, white matter appeared normal (fig. c, d) . thology was observed (fig. a, b) . in the con-these findings are essentially identical to those verse experiment in which rad were delivered found in eae (hickey and kimura, ) and im m k ,,. ~'l_m suggest that radiosensitive cells residing in the formed, using balb/cj (h- d) donor and systemic compartment at day p.i. are essential c bl/ j (h- h) recipient mice. as shown in for subsequent lesion development. table (groups and ), allogeneic transfers did not restore disease, suggesting that mhc restric- tion is, in fact, required. to further define the characteristics of cells to jhmv-induced disease, spleen cells from donor which are active in the adoptive transfer of dismice were transferred into irradiated recipient mice ease, syngeneic immune spleen cells were sep-( table ). when . -v-l-infected, irradiated mice arated by nylon wool to yield t cell-enriched received immune spleen cells (group , table ), (nylon wool nonadherent) and t cell-depleted significant disease was restored (clinical score, p (nylon wool adherent) fractions. as shown in ta-= . ; histological score, p = . ). while this effect was often quite dramatic in individual mice (fig. a) , the mean clinical and histological scores in these animals were not as high as those of virally infected, unirradiated mice (group , oe , table ) . surprisingly, adoptive transfer of naive ~ spleen cells into infected, irradiated recipients ~ /,~/~p je (group , table ; fig. b ) also produced mod-~o , ~ .... crate disease. on the other hand, following trans-g / fer of immune splenocytes to naive, uninfected j ° / mice (group , table ) recipients were completely // normal (fig. c) the ability of spleen cells from naive mice to fig. . viral replication in the brains of c bl/ j mice induce disease in infected, irradiated mice (group inoculated with jhmv . -v- on day and sacrificed at the indicated time points, each of which represents the mean titer , table ) raised the possibility that a nonfrom a group of - mice. mice were either not irradiated (i~), mhc-restricted cell, such as a macrophage, might or subjected to rad of whole body irradiation at either day be responsible for mediating this effect. to test - (o) or at day + (o) relative to the day of viral inoculathis hypothesis, allogeneic transfers were per-tion. a allogeneic (balb/cj, h- d) or syngeneic (c bl/ j, h- b) donor mice were given pfu of jhmv . -v- i.p. days prior to transfer (immune) or not (naive), as noted in table . in groups and , x spleen cells were transferred i.v. into each recipient at day p.i. nwna indicates nylon wool nonadherent ceils, and nwa indicates nylon wool adherent cells (selected from a total of x spleen cells) transferred i.v. to recipients at day p.i. b in all groups, recipient mice were -week-old c bl/ j males given pfu of jhmv . -v- i.c. on day and irradiated on day p.i. prior to transfer. c scoring was also performed as in table . underlined values are those which are significantly greater than respective scores of jhmv-infected, irradiated mice not given splenocytes ( ble , the ability to transfer clinical disease was vestigation cannot exclude some contribution of contained in the t cell-enriched population (group direct viral cytolysis of oligodendrocytes (lampert ) . although histological scores were elevated in et al., ) to the jhmv pathogenesis. clearly, these mice relative to irradiated, infected mice not however, the role of this mechanism, if present, given spleen cells (group , table ), this value did must be minor, since it should be unaffected or not achieve statistical significance, possibly due to even enhanced by an immunosuppressive dose of the relatively small number of animals in the irradiation. in fact, infected irradiated mice show experiment. taken together, the characteristics of little or no evidence of demyelination or cell de-mhc restriction and nylon wool nonadherent struction (fig. ) , despite marked increases in suggest that spleen cells which are most active in both viral antigen-positive oligodendrocytes (fig. adoptive transfers are likely to be t lymphocytes. a) and brain viral titers (fig. ) . prior studies in athymic (sorensen et al., ), immunosuppressed (sorensen et al., zimmer and dales, discussion ) , or lethally challenged sussman et al., ) rodents have established a the major finding of this study is that ira-protective role for cellular immunity early in the munosuppression of jhmv-infected mice by jhmv pathogenesis by limiting virus infection in means of gamma irradiation abrogates viral-in-susceptible cells, such as oligodendrocytes and duced demyelination. this result strongly argues neurons. again, these studies have limited relethat jhmv causes demyelination through ira-vance to the study of jhmv-induced demyelinamunopathological mechanisms. however, our in-tion, since early challenge of animals with severe immunodeficiency or with large amounts of viru-the two jhmv strains, . -v- and jhmv-ds, lent virus primarily results in an acute, fulminant used in the present study are essentially identical panencephalitis, with little or no demyelination, to most jhmv strains in all respects except neu-further support for an immunopathological rovirulence (weiner, ; stohlman et al., ; mechanism of jhmv-induced demyelination . in terms of neurovirulence, comes from the adoptive transfer studies. these they resemble the original jhmv isolates, which experiments indicate that populations of murine in early passages primarily caused a nonfatal paradonor spleen cells, which are enriched for t lytic disease (bailey et al., ; cheever et al., lymphocytes and appear to be mhc-restricted, ) ; only after many i.c. passages did the virus restore demyelination to infected, irradiated re-acquire marked neurovirulence. most importantly, cipient mice (tables and ). two features of the the minimal neurovirulence of jhmv . -v- , adoptive transfers were unexpected, however, and jhmv-ds, and similar jhmv strains (hirano et indicate that these experiments must be interpret-al., ; knobler et al., ; dalziel et al., ) ed cautiously. first, cells from naive donors (ta-allows virus-induced demyelination to be studied ble , group ) were nearly as effective as cells directly, by minimizing the confounding fatal enfrom immune donors ( the only previous study of irradiation during p.i. this result may reflect the fact that in an jhmv infection was that of love et al. ( ), established cellular immune response within the who applied regional irradiation to the spinal cords cns, the majority of lymphocytes present locally of mice which had been infected with jhmv, may not be antigen-specific (ceredig et al., ; strain ts (knobler et al., ) months previ-fallis et al., . second, although the degree to ously. under these circumstances, irradiation had which adoptive transfers reconstituted disease was no effect on the clinical or histological course of clearly significant in the aggregate (table ) and jhmv pathogenesis. we have confirmed the reoften dramatic in individual animals (fig. a, b) , suit of love et al. ( ) , that irradiation applied the mean clinical and histological scores of recon-to the cns alone or applied after disease has stituted mice were considerably lower than those become firmly established has no effect on of the infected unirradiated mice (table , group jhmv-induced demyelination. the suggestion of ). thus, the disease was, on average, only par- love et al. ( ) , that irradiation administered at tially restored by adoptive transfer of spleen cells, an earlier time in the course of disease might have this result may reflect technical factors, such as an effect on demyelination was shown to be corthe quantity or quality of transferred cells or the rect in the present study (table ) . ability of transferred cells to reach specific targets. in conclusion, we have shown that jhmv-in-alternatively, it is possible that irradiation at day duced paralytic-demyelinating disease may be pre- p.i. irreversibly damages critical elements in the vented by immunosuppressive dose of gamma cascade leading to demyelination. in order to ad-irradiation and partially restored by the adoptive dress these questions, further experiments in which transfer of spleen cells, which are most likely t adoptive transfers performed during the early, in-lymphocytes. taken together, these findings indiductive phase of disease are in progress, cate that the primary mechanism of jhmv-in-an immunopathological mechanism has not duced demyelination is immunopathological, been established previously for jhmv-induced rather than being due to direct viral lysis of demyelination, possibly due to the use of a rela-oligodendrocytes. tively virulent virus strain coupled with cyclophosphamide-mediated immunosuppression applied simultaneously with virus infection (lampert et a murine virus (jhm) causing disseminated - . encephalomyelitis with extensive destruction of myelin myelinating disease caused by theiler's virus, mouse ( ) phenotypic analysis of the inflammatory exudate in hepatitis virus or experimental allergic encephalomyelitis. j. murine lymphocytic choriomeningitis animal models of new encephalomyelitis with extensive destruction of myelin viral med~ , - . particles induce la antigen expression on astrocytes analysis of autoimmune demyelination: its peplomer glycoprotein e results in reduced neuroviruimpact upon multiple sclerosis mechanisms of virus-induced demyelina-fallis in vivo and in bridoma supernatants and ascites in absolute units by vitro models of demyelinating disease. xvii. the infectious sensitive and reliable enzyme-linked immunosorbent assays process in athymic rats inoculated with jhm virus. microb. (elisa) pathogenesis of a murine ( ) improvements in obtaining and characterizing mouse coronavirus, strain jhm in the central nervous system of cerebrospinal fluid. application to mouse hepatitis virus-inmice - . variant of murine coronavirus jhm selected with mono-stohlman in vivo effects of coronavirus-specific t cell pathog. , - . clones: dth inducer cells prevent a lethal infection but do fleury further ultrastructural observations of virus t-cell-mediated clearance of mouse hepatitis virus duced demyelinating encephalomyelitis pathogenesis of demyelination induced by suzumura, a in vivo and in vitro models . of demyelinating diseases. xxiv. the infectious process in adoptive cyclosporin a treated wistar lewis rats inoculated with transfer of eae-like lesions from rats with coronavirus-in-jhm virus acknowledgements al., ; weiner, ) . in this setting, the majority of mice died of fulminant acute encephalitiswe are very grateful to thomas bohlmann, and did not manifest typical jhmv-induced sub-cindy fabricius-segal, wen-quiang wei and acute or chronic paralysis and demyelination.ligaya key: cord- -dm mdqhl authors: white, l. a.; freeman, c. y.; hall, h. e.; forrester, b. d. title: inactivation and stability of viral diagnostic reagents treated by gamma radiation date: - - journal: biologicals doi: . / - ( ) -y sha: doc_id: cord_uid: dm mdqhl abstract the objective of this study was to apply the pertinent findings from gamma inactivation of virus infectivity to the production of high quality diagnostic reagents. a gammacell (atomic energy of canada, ltd., ottawa, canada § § use of trade names is for identification only and does not imply endorsement by the public health service or by the u.s. department of health and human services. ) was used to subject viruses grown in either susceptible tissue cultures or embryonated chicken eggs to various doses of gamma radiation from a cobalt- source. the radiation required to reduce viral infectivity was · to · megarads (mrad). the effect of gamma treatment on the antigenic reactivity of reagents for the complement fixation (cf), hemagglutination (ha) and neuraminadase assays was determined. influenza antigens inactivated with · mrad displayed comparable potency, sensitivity, specificity and stability to those inactivated by standard procedures with beta-propiolactone (bpl). significant inactivation of influenza n and b neuraminidase occurred with > · mrad radiation at temperatures above °c. all viruses were inactivated, and cf or ha antigens were prepared successfully. antigenic potency remained stable with all antigens for years and with % after years storage. influenza ha antigens evaluated after years of storage demonstrated % stability. gamma radiation is safer than chemical inactivation procedures and is a reliable and effective replacement for bpl in preparing diagnostic reagents. gamma radiation has been used to inactivate human and animal viruses and diagnostic biological products. - this method has been described for a wide range of uses including sterilizing raw and cooked ground beef containing coxsackievirus b- ' and for sterilizing laboratory effluent before its release into the environment." large pools of animal serum used in tissue culture medium has been radiation treated to inactivate adventitious viruses (hyclone laboratories, inc., logan, utah, u.s.a.). the centers for disease control (cdc) prepares diagnostic and reference reagents for many viral diseases of public health importance. 'i reference reagents are supplied to state, county and world health organization laboratories as well as commercial manufacturers of diagnostic reagents. because of the potential hazard of shipping infectious materials, cdc supplies only inactivated reagents. historically, biologicals have been inactivated by treatment with $ to whom correspondence should be addressed. use of trade names is for identification only and does not imply endorsement by the public health service or by the u.s. department of health and human services. heat, ultraviolet light and various chemicals including beta-propiolactone (bpl). because of the potential carcinogenic hazard to the laboratorian associated with the use of bpl ' and the deleterious effects of bpl on some hemagglutinating (ha) antigens, our laboratory investigated inactivation ofviral reagents by gamma radiation from a cobalt- source. gamma radiation offers a low energy, nonpolluting method of killing viruses under controlled conditions. the resulting product is safe and radioactively inert. this report establishes the dosage levels required for inactivation and treatment of viral diagnostic reagents and discusses the long-term stability of those reagents. gamma radiation source the gamma radiation source was a gammacell (atomic energy of canada, ltd., ottawa, canada) containing cobalt- with an initial activity of l- x lo rad/h or . megarad/h (mrad). calculations were made at the time of use to account for the decay of the cobalt source. thirty-eight reference virus strains (table l) , comprising genera in seven families, were used in these studies. each virus was grown in the host system giving maximum sensitivity to infection and was used routinely in reagent production. all viruses were passed in the laboratory at least twice before use as inocula for reagent preparation. six cell lines (table ) were used as the routine culture systems for producing diagnostic reagents of the viruses under examination. these cell lines were human embryonic lung (hel), human rhabdomyosarcoma (rd), rhesus monkey kidney (llc-mka), primary rhesus monkey kidney (prrhk), african green monkey kidney (vero ), and african green monkey kidney (ma- ). cell monolayers were grown either on cm culture flasks or on cm roller bottles. when growth of the cell monolayer was confluent, the growth medium was removed, and the monolayer was rinsed with serum-free medium. the viral inoculum was added to the monolayer and adsorbed to the cells for h at °c before the maintenance medium (table ) was added. cultures were incubated at °c and harvested when maximum cytopathic effect (cpe) was observed. influenza and newcastle disease viruses were prepared in lo-day-old embryonated chicken eggs inoculated by the allantoic route (egg/ah). influenza type c virus was cultured in embryonated eggs inoculated by the amniotic route (egg/amn). the eggs were incubated at °c for h, and the appropriate fluids were harvested after overnight refrigeration. the standardized microtiter cf procedure developed at cdc and the standard hemagglutination (ha) and hemagglutination-inhibition (hi) proce-dures utilizing the proper erythrocyte suspensions were used throughout these studies. inactivated influenza reagents were evaluated by the neuraminidase inhibition (nd test. i the cdc inventoryil of reference antigens and antisera were used as test controls and for evaluating the sensitivity and specificity of all radiation-inactivated reagents. pooled suspensions of materials infected with each virus were prepared, aliquoted and stored at - °c. samples of the pooled suspensions were thawed for radiation experiments. round, screwcap glass bottles containing approximately ml of virus suspension were placed in the gammacell sample chamber and mechanically lowered into position for radiation exposure. throughout exposure, samples were immersed in crushed ice and kept at to °c. inactivation experiments were performed at time intervals corresponding to approximately mrad. individual samples were removed after radiation treatment ranging from o- to -o mrad. the samples were held at °c and assayed within a few hours for residual live virus. infectivity assays of untreated and treated suspensions were performed by inoculating viral dilutions (log,, intervals) into the host system used for antigen production. three screwcap, cell culture tubes or six embryonated eggs were inoculated per dilution. cultures were incubated at °c and examined daily for cpe for to days. embryonated eggs were incubated at °c for days and refrigerated overnight before collection of allantoic and amniotic fluids. for hemagglutinating viruses, ha tests were performed on fluids from individual eggs and culture tubes after three and seven days incubation. infectivity titers were calculated by the method of reed & muenchi' and expressed as either % egg infective doses (eid& or % tissue culture infective doses (tcidso). confh.ution of inactivation was by passage of the fluids from the apparently uninfected cultures at the ' and -l dilutions of the infectivity titrations. cell cultures were frozen and thawed before pooling the fluids from each dilution. the pooled passage fluids were inoculated onto the susceptible host and examined for cpe during to days incubation. inactivation of viruses cultured in embryonated eggs was confirmed by passage of pooled fluids from the ' and -l dilutions in eggs. after incubation, the fluids from individual eggs were tested for hemagglutinins. antigens were prepared for use in either the complement fixation (cf) or hemagglutination-inhibition (ha tests using production procedures described in the biological products procedure manual. l these procedures recommended inactivation using . % bpl. however, instead of bpl, the experimental reagents were inactivated in the gammacell at a radiation level calculated by the information obtained from the virus inactivation experiments. the volume of diagnostic reagents was to ml. the gamma inactivation procedure was identical to that described above. after innocuity was confirmed and the antigen potency was determined, the reagents were dispensed in to ml aliquots and stored at either " or - °c. initial experiments involved weekly testing of the influenza reagents. long-term stability testing for antigen potency and sensitivity was expanded to include cf and ha reagents stored at either °c or - °c over a g-year period. preliminary experiments were conducted to determine the amount of gamma radiation required to inactivate the infectivity of influenza virus strains. allantoic fluid pools of to ml were prepared for each of the influenza types a and b viruses. an amniotic fluid pool was prepared from eggs infected with influenza g/taylor/ / . the pools were dispensed in ml aliquots in glass, screwcap bottles and were exposed to five increasing amounts of gamma radiation from o- to . mrad. duplicate infectivity titrations were performed in six embryonated eggs per dilution of the untreated and treated materials. after incubation, the fluids from each egg were harvested individually and tested for hemagglutinins. positive ha was used as indication of infectivity. the rates of inactivation were determined by reduction in infectivity titers (table ) . a/new jersey was inactivated with . mrad. this was the smallest radiation dosage required for inactivation of any of the influenza viruses. four strains were inactivated with - mrad and the remaining eight viruses were non-infective after exposure to . mrad. innocuity was confirmed by titration of fluids from individual eggs at the infectivity endpoint dilution. infectivity titers decreased in direct proportion to the increase in radiation. as a quality control on the inactivated antigens, . % bpl was used to treat additional samples from each influenza pool by routine procedures. the pools were innocuity tested in embryonated eggs and all were non-infectious after treatment with . % bpl. the stabilities of untreated versus gamma-and bpl-inactivated hemagglutinins from split samples were compared (table ) . gamma and bpl concentrations used were those previously determined to effectively inactivate the influenza antigens. comparable ha titers were obtained with antigens inactivated by both procedures with the exception of b/lee/ which showed a four-fold decrease in titer following bpl treatment. the antigenic specificity was determined in hi tests with reference chicken antisera. each inactivated antigen was inhibited by reference homologous antisera to a titer within twofold of that obtained with the non-inactivated control. radiation with . mrad did not cause any change in the antigenic specificity of the antigens. their performance as reference reagents was unaffected. using the standard neuraminidase assay, the percentage of neuraminidase activity remaining in the split samples after gamma and bpl inactivation was compared with the percentage of activity in the infectious control preparations. neuraminidase activity in control and inactivated preparations was tested on at least two occasions (table ) . five bpl-inactivated and two gamma-inactivated influenza preparations showed a higher percentage of remaining neuraminidase activity than their corresponding inactivated sample. four specimens, a/japan/ / (hznz), a/ victoria/ / (h n ), a/equine/prague/ (heql neql), and a/equine/miami/ (heq neq ), exhibited < c variance between samples in the amount of remaining neuraminidase. these four specimens were considered to be comparable. greater stability of nl was observed after bpl inactivation, while neql and neq neuraminadase activity was stable after inactivation by both methods. with the exception of a/texas/ / (h n ), less inactivation of n was observed with gamma treatments. since greater inactivation of type nl and b neuraminidases by radiation was observed, additional investigations were performed by repeating the neuraminidase assay on five selected influenza antigens. influenza ainew jersey/ / (hswlnl), alussr/ / (hlnl), and b/hong kong/ / were re-evaluated. aitexas/ / (h n ) was included because of the low result previously obtained and a/equine/miami/ theq neq ) was used as a control. these antigens were exposed at five radiation doses, from . to . mrad, under three temperature conditions, unrefrigerated ( o"c), ice bath ( "- "c), and frozen (- °c) (fig. ) . inactivation of infectivity was slower in the frozen state and required . mrad as compared to . mrad at other temperatures. the neuraminidase inactivation rates increased with higher temperature and with increased amounts of radiation. at °c and above, significant inactivation of the influenza b and nl neuraminidases was confirmed, but satisfactory levels remained when treatment occurred at - °c. the n neuraminidase level of a/texas/l/ showed less inactivation than observed in the previous experiment. however, at temperature above "c, significant inactivation occurred at the higher radiation levels that was not evident with the frozen samples. the neq neuraminidase control demonstrated good stability at all temperatures. the second group of viruses investigated contained enterovirus strains. the objective was to determine the amount of gamma radiation required to inactivate these viruses grown in cell cultures. enteroviruses and required . mrad for inactivation while polioviruses and and coxsackievirus a- required . mrad. the other enteroviruses were inactivated with . mrad (table ) . innocuity was confirmed with the pooled suspensions from the endpoint dilutions as previously described. when cpe was not observed after days of incubation at "c, the innocuity was considered confirmed. six different viruses, three entero-and three myxo- in lo-day embryonated eggs. infectivity titers were determined for each pool and the antigens were gamma-inactivated while chilled in an ice bath at to °c. the serologic reactivity was compared with that obtained with non-inactivated materials (table ). innocuity tests were performed and confirmed in the same host system. the radiation dosage necessary for inactivation varied with each of the viruses. during inactivation, ha titers for measles, newcastle disease, and parainfluenza types and remained stable. reovirus types and showed a four-to eight-fold decrease in titer, but retained satisfactory potency. reovirus type ha antigen exhibited an eight-fold titer decline to an unsatisfactory potency. the ha titer of simian rotavirus was totally destroyed. in comparing the cf titers of non-irradiated and irradiated antigens, we observed that two antigens, coronavirus and respiratory syncytial showed a >two-fold decrease in potency after gamma treatment. three antigen preparations (parainfluenza , calf and simian rotaviruses) were unsatisfactory because of low potency levels in both treated and nontreated preparations. the remaining cf antigens were satisfactory. the sensitivity and specificity of the inactivated ha and cf antigens were comparable to that of the cdc reference antigens as determined in tests with homologous and heterolo-of the seven cf antigens maintained titer stability gous the cdc reference human and animal antisera. through the b-year period. the herpesvirus type cf interference from anticomplementary activity was antigen showed a four-fold decrease in titer bu still not observed with the cf antigens. maintained an acceptable potency level. the stability of stored diagnostic reagents has thirteen influenza viruses, represented by ha always been a concern of reagent manufacturers. we antigen preparations, were examined periodically examined six ha and seven cf gamma-inactivated after liquid storage at °c for periods up to years. antigens held under routine storage conditions for using : as the minimum acceptable influenza approximately years. the ha antigens for ha antigen titer, satisfactory results were observed measles, newcastle disease, parainfluenza types with all antigens during years storage and with % and , and reovirus types and were evaluated. all of the antigens over years storage ( this study sought to ascertain the effect of gamma radiation on the potency and sensitivity of viral cf and ha antigens. the findings were applied to the production of high quality diagnostic reagents. initial experiments involved allantoic fluid cultures infected with different strains of influenza virus. gamma inactivation procedures were compared to the standard technique using bpl. the antigens were evaluated by ha, hi and neuraminidase assay. the temperature during radiation had a definite effect on the stability of the influenza virus neuraminidase. the ha potency of the gamma-inactivated antigens was comparable to that obtained with the bplinactivated antigens. after determining that gamma-inactivated influenza ha antigens retained potency and specificity, we evaluated this technique on the preparation of cf and/or ha antigens for other viruses. these viruses were inactivated by gamma radiation of . to . mrad without adverse effect on the potency, sensitivity or specificity of the antigen. our results agree with other reports l that the efficacy of inactivation of viral infectivity by gamma radiation depends on the optimal radiation exposure. the radiation required for inactivation varies among virus groups. as reported by thomas et al inactivation occurs along predictable linearity of the lethal dose levels. from the kinetics of the virus inactivation, it is possible to calculate the amount of radiation required to destroy the infectivity and still retain the antigenicity of the reagent. if a given radiation dosage produces incomplete inactivation, the suspension can be subjected to a further treatment which may be calculated from the standard inactivation curve. in general, inactivated virus suspensions, either cell culture or allantoic fluids, gave results similar to noninactivated preparations in the ha and cf tests. exceptions were noted with reovirus and simian rotavirus ha antigens which after inactivation decreased to unacceptable levels. a four-fold drop was observed with the respiratory syncytial and coronavirus cf antigens. inactivation did not decrease the potency or specificity of three antigen suspensions which had a : cf titer. these antigens were already considered below acceptable titers. for a number of years the cdc viral cf and ha antigens have been inactivated with gamma radiation. an evaluation of the stability of influenza ha antigens after long-term storage is reported (table ) . results are included for antigens of several influenza strains not discussed in the preliminary experiments. the results presented show a high percentage of antigens maintaining satisfactory potency of after long term storage. laboratory workers are at considerable risk of infection from handling large volumes of infectious viral suspensions used in preparing diagnostic reagents. they also face exposure to hazardous chemicals, including bpl, used in the processing procedures. these results indicate that gamma radiation effectively and reliably inactivates high-titered virus suspensions without affecting the serologic specificity. this procedure is safer than chemical inactivation and is an effective replacement for bpl in the preparation of inactivated diagnostic reagents. inactivation of lassa, marburg, and ebola viruses by gamma irradiation gamma ray inactivation of some animal viruses inactivation of thirty viruses by gamma radiation inactivation of enteroviruses by gamma radiation inactivation of influenza virus antigens by gamma radiation inactivation of viral antigens by gamma radiation preparation of noninfectious arbovirus antigens by sucrose-acetone extraction of gamma-irradiated tissue preparation of stable noninfective influenza virus antigens for typing by hemagglutinationinhibition gamma radiation inactivation of coxsackievirus b- inactivation by gamma irradiation of animal viruses in simulated laboratory effluent production manual for viral rickettsial chlamydial mycoplasmal reagents inactivated viral vaccines complement fixation test standardized viral hemagglutination and hemagglutination-inhibition tests. ii. description and statistical evaluation concepts and procedures for laboratory-based influenza surveillance a simple method of estimating fifth per cent endpoints the use of gamma radiation for the preparation of virus vaccines we thank alan p. kendal key: cord- -vgbrwegt authors: charley, b.; lavenant, l. title: characterization of blood mononuclear cells producing ifnα following induction by coronavirus-infected cells (porcine transmissible gastroenteritis virus) date: - - journal: research in immunology doi: . / - ( ) -j sha: doc_id: cord_uid: vgbrwegt abstract porcine blood mononuclear cells (pbmc) were shown to produce interferon-α (ifnα) following incubation with cells infected by a coronavirus, transmissible gastroenteritis virus. monoclonal antibodies (mab) with specificities for leukocyte subsets and major histocompatibility complex (mhc) antigens were used to characterize ifnα producer cells. the production of ifnα was found to be a function of non-phagocytic, non-adherent, non-t, non-b, cd + (and to a lesser extent cd +) mhc-class-ii-positive cells. furthermore, addition of anti-mhc (class ii) mab during pbmc incubation with virus-infected cells reduced ifn yields, suggesting that masking of these surface antigens alters pbmc responsiveness to ifn induction. introduction peripheral blood leukocytes have been shown to produce interferon alpha (ifna) upon induction by viruses, bacterial products or tumour cells (dianzani and capobianchi, ) . in contrast to ifn beta, for which the critical inducing factor appears to be viral rna, a different mechanism seems to be involved in induction of ifna. thus, inactivated virus particles, virus-infected cells, mycoplasmas and cell membranes are capable of inducing ifna (lebon et ai., ; hughes and blalock, ; goblet al., ; capobianchi et al.., ) , which suggests that membrane interactions between the inducer structure and the leukocyte membrane is sufficient to trigger ifna produc-tion. in the case of transmissible gastroenteritis virus (tgev), a coronavirus which induces acute diarrhoea and intense ifn synthesis in newborn piglets (la bonnardiere and laude, ) , we have previously shown that early ifn~ production could result from exposure of non-immune pig lymphocytes to virus-infected cells. moreover, experiments in which ifn c production was inhibited by monoclonal antibodies (mab) directed at some epitopes of the tgev glycoprotein e suggested that a defined domain of this transmembrane viral protein played a key role in the ifn t induction process (charley and laurie, ) . the nature of ifn~ producer cells (ipc) is not clear, since several cell types appear to be involved depending upon the inducer or the induction protocol (dianzani and capobianchi, ) . thus, among non-adherent human mononuclear cells, "nuli" (non-t, non-b) lymphocytes and large granular lymphocytes (lgl) were shown to produce ifn c upon exposure to herpes, influenza or dengue virus (peter et ai., ; kirchner et al., ; lebon et al., ; djeu et al., ; kurane et al., ) . more recent reports have indicated that a common phenotypic feature for murine and human ipc in response to different stimuli is their surface expression of mhc class ii molecules (abb et al., ; reiss et al., ; perussia et al., ; kurane and ennis, ; hughes and blalock, ; capobianchi et al., ; oh et al., ; fitzgerald-bocarsky et al., ; sandberg et al., a) . in the present report, we analysed the nature of lymphocyte subpopulation(s) responsive to ifna induction by tgev-infected cell monolayers by using cell-depletion experiments with mab plus complement. in addition, ifn induction-blocking experiments conducted with anti-mhc (sla, swine leukocyte antigens) class ii mab without complement suggest a functional role for these membrane molecules in the ifn induction process. porcine peripheral blood mononuclear cells (pbmc) were obtained from heparinized blood collected from -to -month old animals. phagocytic cells were depleted by carbonyl iron ingestion (salmon, ) before pbmc isolation by ficoll density centrifugation on msl (density . , eurobio, paris). pbmc were suspended in rpmi- medium supplemented with ° o foetal calf serum. ifn = interferon. ipc = ifnqt producel cell. lgl = large granular lymphocyte. mab = monocional antibody. = major histocompatibility complex. pbmc = peripheral blood mononuclear cell, sla = swine leukocyte antigen. tgev = transmissible gastroenteritis virus. anti-pbmc _.'nab msa (anti-cd ), - - (anti-b), - - (anti-cd ) were kindly provided by j. lunney (usda, beltsville, md, usa); / (anti-cd ) mab was kindly provided by u. koszinowski (tiibingen, frg). mab - - (anti-sla class i) and msa (anti-sla class ii) were provided by j. lunney. mab th a (anti-sla class ii) was purchased from vmrd (pullman, wa, usa). other anti-sla class ii mab (th b, h a and th a) were kindly provided by w. davis (pullman, wa, usa) (table i). these antibodies were used for cell-depletion experiments as ascitic fluids, excepts for msa which was used as hybridoma cell supernatant. pbmc were incubated for min with mab and complement at °c as described previously (charley et al., ) : briefly, one-month old rabbit serum served as a source of complement at a final dilution of / and mab were used at a final dilution of / . the percentage of dead cells was determined by trypan blue dye exclusion and ceils were resuspended in the initial volume, i.e. without readjustment of the viable cell concentration, before being used in the assays. pbmc were induced to produce ifn t by overnight incubation on tgev-induced, glutaraldehyde-fixed cell monolayers as described previously (charley and laude, ) : briefly, pig kidney cells were plated in -well microplates, infected by the coronavirus tgev for h, then fixed with . % glutaraldehyde ( h at °c) and stored with % glycine. monolayers were washed before addition of pbmc ( izl/well at x /ml). supernatants were collected after h of incubation at °c and assayed for ifn activity. various dilutions of dialysed mab preparations, as indicated in "results", were added during overnight incubation of pbmc with tgev-infected monolayers or with virus particles. alternatively, pbmc were pretreated with various amounts of dialysed mab hammerberg and schurig, pescovitz et al, jonjic and koszinowski, pescovitz et al, davis et al., hammerberg and schurig, vmrd, inc., pullman wa davis et ai., davis et al, davis et al, mab preparations for min at °c, washed to remove unbound material, resuspended at × /ml and incubated overnight on t~ev-infected monolayers. supernatants were assayed for ifn. log dilutions of pbmc supernatants were assayed for ifn on bovine mdbk cells using vesicular stomatitis virus as a challenge (la bonnardi re and laude, ) . a standard porcine ifna was included in each assay. this standard was calibrated on mdbk ce!ls with the human international reference ifn b / (nih, bethesda, md, usa). in our results, u is equivalent to ilu of human ifn. we have previously shown that phagocyte-depleted porcine pbmc could secrete ifn t following incubation on tgev-infected glutaraldehyde-fixed cell monolayers (charley and laude, ) . antibody plus complement depletion experiments were conducted to characterize the ipc nature. when pbmc were pretreated with rabbit serum as a source of complement, they produced high amounts of ifn ( +_ u/ml in different experiments). table ii shows the effect of treatment with various anti-lymphocyte mab and complement on ifn production. since ifn assays are performed on log dilutions of pbmc supernatants, any reduction lower than % was considered as negligible. in fact, pretreatment of pbmc with anti-t or anti-b cell mab plus complement did not alter ifn ~ production" ifn titres obtained were ~c~p~t~vc~y equa~ to and ~o oi-"~ titres obtained with complement-treated pbmc (table ii) . in contrast, pretreatment with / (anti-cd ) mab and, no. = number of experiments. viable cells = ° o -(% dead cells after effect of mab + complement-% dead cells with complement alone). ifn production is expressed as % of ifn produced by complement-pretreated pbmc. table iii shows that pretreatment by anti-sla class i mab and complement, which destroyed almost all pbmc, completely abolished ifn production. pretreatment by anti-sla class ii mab th a plus complement markedly lowered ifn production, along with the lysis of o pbmc. these experiments therefore indicated that porcine ipc were largely sla-class-ii-positive cells. at °c), washed and incubated overnight on tgev-infected glutaraldehyde-fixed cell monolayers. ifn activity was assayed in cell supernatants. during cell-depletion experiments, controls performed in the absence of complement indicated that most mab used had no direct inhibitory effects on ifn production. however, two preparations of anti-sla class ii mab (th a and msa ) could directly block ifn induction when added during co-incubation of pbmc with i'gev-infected fixed monolayers or tge alone ( independent experiments). thus, rii a mab used as an ascitic fluid could hlhibit up to . o ifn production at a final ig concentration of ,. /ml ( fig. la) . msa hybridoma culture supernata,~t blocked up to ifn production at a final ig concentration of . [~g/ml ( fig. ib) . three other ascitic fluids, directed at sla class ii, also showed dose-dependent ias~hition of ifn production ( fig. ). in addition, the latter blocking experiment was achieved by pretreatment of pbmc with mab, followed by washing of cells before induction on tgev-infected fixed-cell monolayers, which argues for a direct effect of mab on pbmc as opposed to an antibody effect on infected cell monolayers. in addition, such inhibiting effects could not be related to toxic effects of mab on pbmc (not shown). ifn induction by other viruses such as newcastle disease virus (ndv), sendai virus and types a and b myxoviruses was also blocked by co-incubation of pbmc with th a mab (not shown). we have previously shown that phagocyte-depleted pbmc incubated with tgev-infected cells are rapidly induced to secrete ifna (charley and laude, ) . this ifn~ induction seems to result from membrane interactions between pbmc and a defined domain of the viral glycoprotein e expressed on the surface of infected cells (charley and laude, ). in the present paper, cell-depletion experiments by mab and complement-dependent lysis indicate that porcine ifna producer cells (ipc) are mostly msa -(cd or pan-t)-and - - -(b) cells, whereas depletion of cd + cells, and to a lesser extent cd ÷ cells reduced ifn yields by and ° , respectively (table ii) . in addition, ipc are also sla class i ÷ and class ii ÷ cells. furthermore, the addition of anti-sla class ii mab reduces ifn~t production. our present data on the nature of porcine ipc are in agreement with several reports about the characterization of human ipc. thus, following induction by different viruses including herpes virus, influenza virus, dengue virus or cytomegalovirus, as well as by mycoplasma membranes, human mononuclear leukocytes producing ifn~ were described as non-adherent, non-phagocytic, non-t,non-b cells (trinchieri et al, ; kirchner et al, ; peter et al, ; lebon et al, ; abb et al, ; djeu et al, ; perussia et al, ; kurane et al. ). human ipc were generally shown to lack natural killer function (lebon et al, ; abb et al., ; fitzgerald-bocarsly et al., ) , but to express mhc class ii antigens (abb et al., ; perussia et al., ; capobianchi et al., ; oh et al., ; fitzgerald-bocarsly et al, ) . a recent report using combined immunocytochemistry ,~o.,u,,a,~t ,,t on numan rt~mt; stimulated by hsvinfected cells clearly showed that ipc lacked antigens typical of t and b lymphocytes, but expressed hla-class ii antigens (sandberg et al., a) . the same laboratory observed that ipc also expressed cd antigens (sandberg et al, b) . the expression of mhc class ii antigens led to the hypothesis that human ipc could be dendritic cells (fitzgerald-bocarsly et al, ) . however, hla-dr + cells could recently be divided into two separate subsets: a loosely adherent population meeting the functional criteria of dendritic cells but distinct from ipc which were non-adherent (chehimi et ai., ) . our data therefore indicate that porcine ifna-producing cells in response to tgev-infected cells have the same properties as human ipc: porcine ipc are non-phagocytic, non-adherent (salmon et al., ) , non-t,non-b, mltc-clas~-ii-positive and cd + cells. preliminary experiments using dna-rna in situ hybridization suggested that porcine ifna-mrnacontaining cells were infrequent (around / pbmc; buseyne and charley, unpublished observations) as already described for human ipc (goblet al., ) . interestingly, one might hypothesize that a defined, albeit infrequent cell population exhibiting unusual phenotypic features could produce ifna in response to a wide range of ifn inducers. in order to further analyse these cells and their mode of activation, it will be necessary to use positive selection procedures such as cell sorting (sandberg et al., b) . blocking experiments conducted with anti-sla-class ii msa mab used as hybridoma culture supernatant revealed a reduction in ifn yield of more than ° ( fig. ). comparable inhibition was obtained with other anti-sla class ii mab used as ascitic fluids. this inhibition is not observed when virus-infected cells are pretreated with mab, then washed before pbmc are added. however, when pbmc are pretreated with mab, then washed before induction, ifn yield is still reduced, which argues for a direct effect of anti-sla class ii antibodies on pbmc. in addition, pbmc are not lysed by such treatments. therefore, these results suggest that masking of mhc class ii antigens on the pbmc membrane reduces their responsiveness to ifn induction. this anti-sla class-ii-ab-mediated blockage is observed when pbmc are induced by tgev, sendai, ndv or influenza virus. a similar observation was reported by capobianchi et al. ( ) : pretreatment of human pbmc by anti-hla-dr antibody reduced ifn t yield after induction with mycoplasma membranes. similarily, ia antigens were shown to bind cell surface glycoproteins responsible for ifn induction (hughes et al., ) . therefore, our findings suggest that, in addition to mycoplasmas and cell surface glycoproteins, viruses could also interact with mhc class ii antigens to induce ifn t synthesis. the fact that masking of mhc class ii could reduce pbmc responsiveness to several ifn inducers suggests that these surface antigens are not virusspecific receptors on lymphoid cells. in fact, anti-sla class ii mab did not block tgev replication in susceptible pig kidney cells (data not shown). the actual functional role of mhc class ii molecules in the ifn t induction process remains to be clarified" they could represent broadly reactive recogni-t~u. ~t, m.tu~e~ tto~c to omd utllcrcnt ifn-inducing components (as suggested by hughes et al., ) . alternatively, mhc class ii molecules could be involved in post-recognition events, such as internalization or recycling of membrane structures, which seem to precede activation of ifn c synthesis (lebon, ) . experiments are in progress to further define the nature of virus lymphocyte interactions leading to ifn t production. des cellules sanguines mononucl es du porc produisent de l'interf ron cx (ifn~x) h la suite de leur incubation avec des cellules infect es par le coronavirus get (gas-troent rite transmissible). les cellules productrices d'interf ron ont t caract~ris es l'aide d'anticnrps monoclonaux (acm) sp~cifiques des sous-populations leucocytaires et des antigbnes du complexe majeur d'histocompatibilit (cmh). les cellules productrices d'lfn t sont des cellules non phagocytaires, non adh&entes, ni t, ni b, cd ÷ (pour une moindre part cd +) et cmh-classe-ii÷. de plus, l'addition d'acm dirig s contre les antig nes de classe ii du cmh, au m ange d'incubation cellules mononucl es plus cellules infect es par le virus get, r duit la production d'ifn~, ce qui sugg re que le masquage de ces antig nes de surface modifie la capa-cit des cellules mononucl es/l r pondre aux signaux inducteurs d'ifn t. mots-cli~s" lnterf ron alpha, lymphocyte, cmh, coronavirus; anticorps monoclonaux, virus de la gastroent rite transmissible du pore. phenotype of human alpha interferonproducing leucocytes identified by monoclonal antibodies membrane interactions involved in the induction of interferon-alpha by mycoplasma pneumoniae inhibition of transmissible gastroenteritis coronavirus (tgev) multiplication in vitro by non-immune lymphocytes induction of alpha interferon by transmissible gastroenteritis dendritic cells and ifn-g-producing cells are two functionally distinct non-b,non-monocytic hla-dr + cell subsets in human peripheral blood the development and analysis of species-specific and cross-reactive monoclonal antibodies to leukocyte differentiation antigens and antigens of the major histocompatibility complex for use in the study of the immune system in cattle and other species mechanism of induction of alpha interferon positive self regulation of cytotoxicity in human natural killer cells by production of interferon upon exposure to influenza and herpes viruses human mononuclear cells which produce interferon-alpha during nk (hsv-fs) assays are hla-dr-positive cells distinct from cytolytic naturel killer effectors different induction patterns of mrna for ifn-a and -b in human mononuclear leukocytes after in vitro stimulation with herpes simplex virus-infected fibroblasts and sendai virus characterization of monoclonal antibodies directed against swine leukocytes ia antigen: a murine b lymphocyte receptor for transformed cell induction of interferon- t/b interferon-inducing transformed cell surface glycoproteins: purification by ia antigen affinity chromatography monoclonal antibodies reactive with swine lymphocytes.-l. antibodies to membrane structures that define the cytolytic t lymphocyte subset in the swine studies of the producer cell of interferon in human lymphocyte cultures induction of interferon-a from human lymphocytes by autologous, dengue virus-infected monocytes induction of interferon alpha and gamma from human lymphocytes by dengue virus-infected cells high interferon titer in newborn pig intestine during experimentally induced viral enteritis inhibition of herpes simplex virus type-l-induced interferon synthesis by monoclonal antibodies against viral glycoprotein d and by lysosomotropic drugs human lymphocytes involved in ~-interferon production can be identified by monoclonal antibodies directed ,o cooperation between cd (leu- lb) + nk ceils and hla-dr + cells in natural killing of herpesvirus-infected fibroblasts a leukocyte subset bearing hla-dr antigens is responsible for in vitro interf,~ron production to viruses preparation and characterization of monoclonal antibodies reactive with porcine pbl human peripheral null lymphocytes.-ii. producers of type interferon upon stimulation with tumor cells, herpes simplex virus and corynebacterium parvum interferon production by cultured murine splenocytes in response to influenza virus-infected cells surface markers of porcine lymphocytes and distribution in various lymphoi'd organs atural killer (nk) activity and interferon (ifn) production by a fraction of spleen and blood lymphocytes in swine porcine cells i i characterization of the blood mononuclear leucocytes producing alpha interferon after stimulation with herpes simplex virus in vitro, by means of combined immunohistochemical staining and in situ rna-rna hybridization cd antigen are expressed on the interferon- t-producing cells induced by herpes simplex-infected cells antiviral activity induced by culturing lymphocytes with tumor-derived or virus-transformed cells. identification of the antiviral activity as interferon and characterization of the human effector lymphocyte subpopulation we are grateful to dr. j. lunney (beltsville, md, usa), dr. u. koszinowski (tiibingen, frg) and dr. w. davis (pullman, wa, usa), who kindly provided antiporcine lymphocyte subsets and anti-sla monoclonal antibodies. we also thank dr. f. blecha (manhattan, ks, usa) for revising the manuscript. key: cord- -xri v authors: medinsky, m. a.; bechtold, w. e.; blrnbaum, l. s.; bond, j. a.; burt, d. g.; cheng, y. s.; glllett, n. a.; gulati, d. k.; hobbs, c. h.; plckrell, j. a. title: effect of inhaled azodicarbonamide on f /n rats and b c f( ) mice with -week and -week inhalation exposures date: - - journal: fundam appl toxicol doi: . /toxsci/ . . sha: doc_id: cord_uid: xri v effect of inhaled azodicarbonamide on f /n rats and b c f, mice with -week and -week inhalation exposures. medinsky, m. a., bechtold, w. e., birnbaum, l. s., bond, j. a., burt, d. g., cheng, y. s., gillftt, n. a., gulati, d. k., hobbs, c. h., and pick-rell, j. a. ( ). fundam. appl. toxicol , / . azodicarbonamide (ada), a compound used in the baking and plastics industries, has been reported to cause pulmonary sensiti-zation and dermatitis in people. two-week repeated and -week subchronic inhalation exposures of f /n rats and b c f, mice to ada were conducted to determine the toxicity of inhaled ada. the mean air concentrations of ada in the -week studies were , , , . , or . mg/m . no exposure-related mortality nor abnormal clinical signs were observed in rats or mice during or after exposure. the terminal body weights were slightly depressed in the highest exposure group. liver weights were lower in male rats exposed to mg ada/m . no significant lesions were noted on either gross or histologic evaluation of rats or mice. in the -week subchronic study, the mean air concentrations of ada were , , or mg/m . no mortality or clinical signs related to exposure were observed. the terminal body weights of exposed rats were not significantly different from those of control rats but were significantly depressed in mice exposed to or mg ada/m . no histopathological lesions were noted in mice. lung weights were increased and enlarged mediastinal and/or tracheobronchial lymph nodes were noted in rats exposed to mg ada/m . no exposure-related lesions were observed microscopically in rats exposed to or mg ada/m . all rats in the mg ada/m exposure group only had lung lesions that consisted of perivascular cuffing with lymphocytes and a multifocal type ii cell hyperplasia, suggesting a possible immune reaction to an antigen in the lung. viral titers for rats exposed to mg ada/m were negative for sendai virus and pneumonia virus of mice, which produce similar lesions. the possibility of an unknown viral antigen causing this lesion cannot be eliminated. lung tissue from male rats was analyzed for ada and biurea, the major metabolite of ada. no ada was detected. the amount of biurea in the lungs increased nonlinearly with increasing exposure concentration, suggesting that clearance was somewhat impaired with repeated exposures. however, even at the highest exposure concentration, this amount of biurea was less than % of the estimated total ada deposited over the exposure period. in summary, ada is rapidly cleared from the lungs, even when inhaled at concentrations up to mg/m . exposure to ada for up to weeks did not appear to be toxic to rodents ported by the fda, niosh, osha, and cpsc, because of ( ) the high level of occupational exposure (~ ,ooo workers) in the rubber, plastics, and baking industries; ( ) levels of production as high as million pounds per year, and ( ) structural relationships to known carcinogens such as -aminotriazole, azoethane, and hydrazine. ada is an orange crystalline compound that is produced as a condensation product of urea and hydrazine. ada is an orange crystalline compound that is produced as a condensation product of urea and hydrazine. ada is manufactured predominantly as a fine yellowish powder milled to particle sizes in the range to mm (slovak, ) . principal worker exposure occurs in factories where it is ground and in bakeries where it is used as an additive in flour. because ada is used as a flour-maturing agent, toxicity testing using oral exposures was originally recommended. however, in making dough, ada is quantitatively reduced to biurea ( , -hydrazinedicarboxylic acid diamide; h nochn-nhconh ). ada decomposes at temperatures > °c, releasing ammonia, nitrogen, and carbon monoxide and producing urazone, biurea, cyanuric acid, and cyanidine (herweh and fantazier, ) . subchronic toxicity testing of ada in rats and mice by gavage revealed only a nonspecific nephrotoxicity resulting from precipitation of ada (or biurea) in the kidneys of animals given . g/kg body wt or more. similarly, nonspecific nephrotoxicity was noted in dogs fed or % biurea in their diet for up to year (oser et al, ) . methemoglobin levels measured by oser et al. ( ) were below the limit of detection ( . mg/loog). ada has been reported to exhibit an antithyroid effect (gafford et al., \ \) and an inhibitory effect on cholinesterase activity in blood and liver (mel'nikova and selikhova, ) . anorexia, weight loss, and gross hematuria have also been observed in rats given ada intraperitoneally at a dose of mg/ kg body wt daily for week (gafford et al., ) . five out of eight rats died from this dose of ada. there were no deaths among rats given the same dose of ada orally. reports of airway constriction in workers exposed to ada suggest that ada might be an airway sensitizer or irritant. ferris et al. ( ) observed decreased forced vital capacity and forced expiratory volume in exposed workers. slovak ( ) reported the occurrence of asthma in almost one-fifth of workers in a factory manufacturing ada. whitehead et al. ( ) found symptoms similar to chronic bronchitis in workers in ada plants. one case of dermatitis, with a positive response to % ada in a patch test, was noted (bonsall, ) . studies of the effects of an acute, -hr exposure of guinea pigs to ada ( , , or mg/ m ) demonstrated minor changes in tidal volume and respiratory frequency at the two higher concentrations (shopp et al., ) . no lesions were noted in respiratory tract tissue of animals euthanized immediately after exposure or hr later. repeated exposure of guinea pigs to or mg ada/m for weeks did not result in either specific or nonspecific airway sensitization on inhalation challenge with ada or aerosolized histamine, respectively (gerlach et al., ) . the objective of the studies reported here was to describe the toxic effects in rats and mice of inhalation exposure for or weeks to airborne concentrations of ada as high as mg/m . azodicarbonamide, obtained from midwest research institute, was % pure, as determined by iodometric titration. the major impurity identified was biurea, which was from . to . % of the bulk chemical. a compound stability study was also done to confirm that the chemical composition of ada did not change upon aerosolization. filter samples were analyzed by reverse-phase highperformance liquid chromatography (hplq, using the method of bechtold et al. ( ) . contamination of ada aerosols with biurea was less than %. this was not different from the amount of contamination in the bulk samples. stainless-steel, multitiered, whole-body exposure chambers (h , hazleton systems, aberdeen, md), with a total internal volume of . m , were used in both the -week and the -week studies. the flow rate through the chambers was ± ft /min, corresponding to ± air changes per hour. chambers were maintained at a temperature between . and . *c(mean . "c). the average relative humidity ranged from to %. to reduce the spatial variation of aerosol concentration and to increase the uniformity of mixing, the aerosol was diluted in a radial diluter before entering the chamber. animal cages were rotated on a regular basis to reduce any variation in the relative levels of ada inhaled by animals over the course of the study. rats and mice were housed in the same chambers, but in different cage units, for both studies. ada aerosol was generated by a jet-o-mizer/screw feed method (cheng el al., ) . ada powder was put into the hopper of the screw feeder (model , accu-rate, whitewater, wi) and delivered to the funnel of the jet-o-mizer (model , fluid energy co., hatfield, pa) for dispersion. one generator was provided for each exposure chamber. the aerosol concentration in the exposure chamber was monitored by sampling at a flow rate of . liter/min for three, -hr periods during the -hr exposure. samples were collected on -mm fiberglass filters (type ae, gelman, ann arbor, mi). each exposure day, aerosol generation was started and sampling began after min of rise time, when the chamber concentration had reached % of equilibrium concentration (t^). therefore, the total exposure was hr plus a t^ of min. the control chamber was also sampled daily. a ram-s continuous aerosol monitor (gca, bedford, ma) was used to monitor the stability of the aerosol concentration and to adjust the aerosol generator during exposure. it was operated on each chamber at the beginning, middle, and end of the filter sampling period as described previously (cheng el al., ) . aerosol size distribution was obtained once per study by using a lovelace multijet cascade impactor (newton et al.. ) , with a flow rate of liters/min. thesanv pling period ranged from to hr, depending on the chamber concentration. two-week repeated study. four-week-old f /n rats and b c f| mice were received from frederick cancer research facility (frederick, md). the animals were acclimated two per cage for the first week and then one per cage in cage units within two hazleton chambers prior to exposure [total of days (males) or days (females)]. exposures began when animals were weeks old. animals were exposed days per week for weeks, plus an additional (males) or (females) consecutive exposure days before terminal euthanasia for a total of exposure days for both sexes. exposures of females were initiated day later than males. -week subchronic study. four-week-old f /n rats and b c f, mice were received from simonsen laboratories, inc. (gilroy, ca). rats and mice were acclimated as described for the -week study, for a total of days (males) or days (females) prior to exposure. animals were exposed by inhalation, days per week for a total of weeks, with or (males) or or (females) consecutive dose days before terminal euthanasia. the total number of exposure days was or for both males and females. the feed used in both studies was zeigler nih- open formula rat ration (zeigler brothers, inc., gardners, pa). water was provided by an automatic watering system. the light cycle was automatically controlled to provide hr of fluorescent light and hr of darkness each hr (lights on at am and off at pm). prior to study start, the rats and mice in both studies were randomly assigned by weight to treatment groups, using a computer-based system (path/tox, xybion corp.). animals within exposure groups were further randomized by use of computer-generated random numbers into groups for the basic studies or special studies and, for the -week study, into termination days (day or day ) for each group. in the -week study, serum (approximately . ml) was obtained from five male and five female rats and mice days prior to the first day of exposure, and was analyzed for antibody titers to specific bacteria and viruses (mycoplasma pulmonis, m. arth, pneumonia virus of mice (pvm), sendai virus, rat cornavirus (rcv)/sda, and mycoplasma-rats; reo , m. ad., m. pulmonis, m. arth, pvm, send, mhv, ectro, and gdvii-mice). titers were negative for these agents. in the -week study, serum was also obtained from five male and female rats and mice days prior to study start. analyses for the agents described above showed positive titers for rcv/sda in the rats and negative titers for all agents in the mice. no gross lesions were noted in the rats on necropsy. tissue sections were taken from all lung lobes, liver, both kidneys, spleen, harderian gland, and mandibular salivary glands and processed for histology. lesions were only noted in the salivary gland or harderian gland tissue of of the animals. ductal squamous metaplasia was noted in both tissues and corresponded with those animals having positive titers to rcv/sda. these lesions are consistent with lesions induced by sialodacryoadenitis virus. at the end of the -week study, serum from male and female rats from all exposure groups and controls ( rats total) were analyzed for titers to sendai virus, pvm, rcv/sda, and mycoplasma. all sera were negative for titers to sendai, pvm, and mycoplasma. twenty-five of the sera were positive for rcv/sda (> . absorbance units by elisa assay). two-week repeated study. rats and mice in the basic study group (table ) were weighed prior to study start, after week of exposure, and at terminal euthanasia. detailed clinical observations were made at these times. morbidity/mortality checks were made twice daily on all animals. evaluations of gross and microscopic pathology and organ weight changes were made on the basic study group (table ) . separate groups of rats and mice were used for evaluation of methemoglobin levels and cholinesterase levels in whole blood. thirteen-week subchronic study. rats and mice in the basic study group (table ) were weighed weekly at the time of detailed clinical examinations. mortality/morbidity checks were performed twice daily on all animals. histopathology, hematology, organ weight, sperm morphology, and vaginal cytology evaluations were also made on this group of rats. each animal assigned to the special study groups (table ) was used for the following determinations: levels of ada and biurea in lungs and kidneys, acetylcholinesterase activity in whole blood, and t and t levels in serum. necropsy and histopathology. all rats and mice in the basic study group, for both the -week and the -week studies, were given complete gross necropsy examinations. rats and mice were killed by cardiac puncture exsanguination while under halothane anesthesia and were necropsied immediately. weights of liver, thymus, right kidney, right testicle, brain, heart, and lungs (including trachea) were taken. tissues were fixed in % neutralbuffered formalin. tissues for microscopic examination were embedded in paraffin, sectioned at nm, and stained with hematoxylin and eosin. the following tissues were trimmed and sectioned for histopathology: adrenals, bone (vertebra, with bone marrow and spinal cord; femur, rib), brain, epididymus or oviduct, esophagus, heart, small intestine (duodenum, jejunum, ileum), large intestine (cecum, colon, rectum), both kidneys, larynx, liver, lung ( lobes), lymph nodes (bronchial, mandibular, mediastinal, mesenteric), mammary glands, nose ( levels), pancrease (including islets), parathyroid gland, pituitary gland, prostate or uterus, salivary glands, seminal vesicles, skin, spleen, stomach (including forestomach and glandular portions), testes or ovaries, thymus, thyroid gland, trachea, and urinary bladder. all tissues from each rat and mouse exposed to filtered air or mg ada/m , for both the -week and the week studies, were examined microscopically. in addition, lungs of rats exposed to or mg ada/m for weeks were examined. hematology. for the -week study, blood was collected at necropsy from anesthetized rats and mice from the basic study group by cardiac puncture and placed in glass vials containing edta. a coulter electronics model s- was used for analysis of erythrocyte count, mean corpuscular volume, hemoglobin concentration, hematocrit (calculated), and leukocyte count. smears were made from the blood, stained with wright's stain, and examined under a light microscope to obtain differential leukocyte counts and counts of nucleated erythrocytes. additional blood smears were stained with new methylene blue and examined for the presence of reticulocytes. sperm morphology-vaginal cytology. in the -week study, vaginal cytology samples were taken on a daily basis from basic study females for week before final termination. samples were obtained with sterile saline, placed on duplicate dakin slides, fixed with spray cyte (clay adams ), and stained with toluidine blue ( . % in % ethanol). live sperm were obtained from the cauda of the right epididymis of male rats and mice at necropsy. sperm were incubated at *c in tyrode buffer, and viability was quantitated as the percentage of motile sperm in the sample. sperm density (number of sperm per gram of caudal tissue) was quantified on a hemocytometer. the number of sperm in the sample was divided by the weight of the cauda of the epididymis to obtain the value for sperm density. evaluations of sperm morphology were done using preparations of sperm fixed in ethanol and stained with eosin y. urinary enzymes. in the -week study, week prior to termination, all rats in the basic study group were placed in metabolism cages for overnight urine collection. urine was collected on ice and analyzed for total amounts of lactate dehydrogenase (ldh), / -galactosidase -g), a'-acetylglucosaminidase (nag), and alkaline phosphatase (ap) using methods described (medinsky el aj., ). lactate dehydrogenase was quantitated by using pyruvate as a substrate; -nitrophenyiphosphate was the substrate for alkaline phosphatase; /vnitrophenol was the substrate for both tv-acetyl-js-d-glucosaminidase and -galactosidase. determinations of methemoglobin in whole blood of rats and mice exposed to ada for weeks were made to using the method of evelyn and malloy ( ) . acetylcholinesterase concentrations in whole blood of rats only in the -week study and both rats and mice in the week study were determined using the method of ellman el al. ( ) , in which acetylthiocholine is used as the substrate. serum thyroxine (t or tetraiodothyronine) and triiodothyronine (t ) levels for rats exposed to ada for weeks were measured by radioimmunoassay (tietz, ) . samples of lung and kidney from male rats exposed to ada for weeks were analyzed for ada and biurea. this procedure involved derivatization of ada with triphenylphosphine and quantitation of the resulting derivative by hplc (bechtold el al, ) . biurea in the sample was oxidized to ada using potassium permanganate in acid solution. the ada produced was then quantitated by hplc (bechtold el al, ) . all data were analyzed separately for each sex. organ and terminal body weights on animals found dead or euthanized because of a moribund condition were not included in the statistical analysis. analysis of variance techniques were used for statistical evaluation. provided bartlett's test of homogeneity of variance was not significant, exposure groups were compared to controls by using dunnett's multiple range test. when bartlett's test was significant, comparisons with the control group were made by a modified student's i test, making allowance for unequal variance. all statistical tests were conducted at a %, two-sided risk level. the overall, mean ada concentration for each chamber was within % or less of target concentration ( table ). the relative standard deviation of daily means was within %. the aerosol had an average mass median aerodynamic diameter (mm ad) of . jtm (range . to . ) with a mean geometric standard deviation {a%) of . . there were no abnormal clinical observations during the -week exposures for either rats or mice. no rats died. one male ( mg/ m exposure group) and one female ( mg/ m exposure group) mouse died of undetermined causes. the mean terminal body weights for the basic study male rats exposed to mg/m ada were significantly less than those of controls ( % of control value). the mean terminal body weights for basic study male and female mice were significantly lower ( or % of controls, respectively) for the mg/m exposure group. the mean liver weights of male rats and of male and female mice were significantly less at the mg/m exposure than those of controls ( , , and % of control values, respectively). other organ weights of either mice or rats were not influenced by ada exposure (data not shown). a complete set of tissues from rats and mice exposed to and mg ada/m was examined histologically. the two exposure groups could not be distinguished on the basis of histologic findings. because no effect was seen at the highest exposure concentration, we did not examine tissues from rats exposed to lower concentrations. for mice, the only change noted that may have been related to the ada exposure was the degree of fine vesicular vacuolation of the hepatocyte cytoplasm, which is indicative of glycogen accumulation. all of the livers examined for both groups were considered to be within normal limits. however, the degree of cytoplasmic vacuolation varied among animals. the livers from the control and highdose groups were examined blindly and sorted on the basis of cytoplasmic vacuolation. seven of the high-dose animals and one control animal showed no cytoplasmic vacuolation, indicative of glycogen depletion. when the next lowest dose group ( mg ada/m ) was compared with the controls, four treated animals and one control showed no cytoplasmic vacuolation. it must be emphasized that none of the livers were regarded as being abnormal. however, there did appear to be a correlation between ada exposure and loss of hepatocyte vacuolation. possibly the ada-exposed animals were eating " values represent means (percentage standard deviation) of daily measurements over the -or -week exposure period. although rats and mice were housed in the same exposure chamber, the starts of exposure for each species were staggered by week. * particle size was measured once during the study when both rats and mice were being exposed to ada. mmad, mass median aerodynamic diameter, <r,, geometric standard deviation. c no exposure at this target concentration. less, resulting in depletion of glycogen stored in the liver. the mice in the mg/m group had smaller body and liver weights than those of controls. there were no significant differences in methemoglobin levels or acetylcholinesterase activities in whole blood of male and female rats or mice exposed to any concentration of ada, when compared to controls. the overall mean ada concentration for each chamber was within % or less of target concentration ( table ). the relative standard deviations of daily means were within %. the aerosol had an average mmad of . mm (range . to . ), with a mean <r g of . . there were no abnormal clinical observations during the -week exposures for either rats or mice that could be attributed to exposure to ada. no deaths occurred that could be attributed to ada. one female rat ( mg/ m exposure group) was euthanized because of weight loss and dehydration. three male mice died of unknown cause, and one female mouse was accidentally killed. the mean terminal body weights for the basic study rats exposed to ada were not significantly different from those of the controls. the mean terminal body weights for basic study male mice were significantly depressed ( and % of controls) at the and mg/ m exposure levels, respectively. for female mice, terminal body weights were significantly depressed ( % of controls) only at the mg/m level. lung weights of male and female rats were increased ( % of control) at the mg/m exposure level. mean liver weights for male and female mice exposed to ada mg/m were lower than those of controls ( or % of controls, respectively). lung weights of mice were not influenced by ada exposure (data not shown). no other effects of exposure on organ weights were noted. a complete set of tissues from rats and mice exposed to and mg ada/m was examined histologicaljy. although several incidental lesions were present in both groups, lesions attributable to the ada exposure were not present. the decrease in hepatocyte vacuolation with increasing ada exposure described for the -week study was not observed in mice exposed to ada for weeks. five male and six female rats exposed to mg/m ada were described as having enlarged bronchial or bronchial and mediastinal lymph nodes at gross necropsy. histological examination of these nodes showed a moderate-to-severe lymphoid hyperplasia (table ) . subsequently, the lungs of all rats and mice in the mg/m exposure group were examined histologically. all male and female rats in the mg/m exposure group euthanized at the end of the -week exposure period had a spectrum of lung lesions that consisted of perivascular cuffing with lymphocytes and a multifocal type ii cell hyperplasia that was associated with a moderate number of mixed inflammatory cells (fig. ) . the extent of lung involvement varied from mild to moderate among animals. in some animals, the perivascular cuffs were predomi-nant, while other animals showed both the perivascular cuffs and the epithelial hyperplasia (table ). the lungs from all rats and mice exposed to mg ada/m , as well as the lungs of mice exposed to mg/m , were examined. there were no significant lesions on histologic examination. results obtained for hematology in rats and mice exposed to ada for weeks indicated that there were no exposure-related alterations in blood parameters. there were no significant, exposure-related changes, in either male or female rats, in the amounts of the four urinary enzymes (ldh, ap, p-g, nag) excreted. there were no adverse effects from inhalation exposure to ada for weeks, with respect to right caudal weight, right epididymal weight, right testicular weight, sperm motility, sperm count per gram caudal tissue, or incidence of abnormal sperm. however, there was a small, but significant, increase in sperm count in male rats exposed to or mg ada/m . no abnormal effects were noted in male mice. there were no apparent adverse effects on estrual cyclicity or on estrous cycle length in any of the dose groups, except in out of the animals in the mg/m dose group. for these animals, estrous cycle length was > days or was not precisely determined. no abnormal effects were noted in female mice. there were no significant differences in acetylcholinesterase activities in whole blood of male and female rats exposed to any concentration of ada when compared to controls. t and t levels in serum from male rats increased with increasing ada exposure concentration in male rats. t and t levels in the highest exposure group were significantly elevated, relative to control. t was increased approximately %, while t was increased approximately %. t and t were unchanged in female rats exposed to ada. samples of lung and kidney of male rats exposed to ada for weeks were analyzed for the presence of ada and biurea. these tissues were chosen, because they are the most likely tissues to contain significant quantities of one or both compounds, lung being the organ of exposure and kidney, because biurea had been detected in kidney (oser etal., \ ) . the results of chemical analysis of ada and biurea in lung and kidney of male rats are summarized in table . no ada was detected in either lung or kidney of male rats exposed to ada for weeks. biurea, however, was detected in lungs, but not kidney, of rats exposed to , , and mg/m ada. the amount of biurea in the lungs increased nonlinearly with increasing exposure concentration. the percentage of biurea retained in lungs was calculated as a percentage of ada deposited on the last day of exposure (table ). although % of the amount of ada expected to be deposited in rats exposed to mg/m on the last exposure day is retained in the lungs as biurea, this is a small percentage (~ %) of the total amount of ada deposited over the entire study. after inhalation of ada, the only apparently exposure-related lesions observed were those in lung and lymph nodes of rats exposed to mg/m for weeks. the lung and lymph node lesions in rats exposed to mg ada/m for weeks were striking and suggest an immune response to a virus or another antigen. several viral agents have been reported to produce similar pulmonary lesions in rats (jones el al, ; hamm, ) . one such agent is sendai virus. factors suggesting that sendai virus is not involved in this case are the following: (i) absence of bronchiolar epithelial involvement, including bronchiolar epithelial necrosis and hyperplasia; (ii) absence of similar lesions in mice housed in the same chamber as the rats (mice are even more susceptible to the virus than are rats); and (iii) negative viral titers for sendai virus from animals within the same chamber terminated at the same time. pvm has been reported to produce perivascular mononuclear cell infiltrates and a multifocal interstitial pneumonia in rats. however, as for sendai, negative viral titers for pvm were reported from animals within the same chamber as the rats having the lung lesions. for both sendai virus and pvm, serum antibody titers would be present at to days after exposure to the virus. it is unlikely that histologic lesions from such a viral infection would be present in the animals examined in the absence of positive antibody titers. rcv infection produces mild lung lesions in young adult rats, consisting of patchy interstitial pneumonia and lymphocytic perivascular infiltrates. mice are unaffected by the virus. rat coronavirus is closely related antigenically to sda, and serology cannot distinguish between exposure to either of these two coronaviruses. as previously indicated, rats in this study had positive titers to rcv/sda. we, therefore, cannot determine if the titers reflect only exposure to sda, or subsequent infection with rcv. because antibody titers for rcv/sda were equivalent across dose groups, any pulmonary lesions due to the viral infection would be expected to be present in all dose groups. . (a) lung section of a control rat exposed to filtered air. (b) lung section of a rat exposed to mg ada/m for weeks. note prominent perivascular cuffs composed of lymphocytes. another possible etiology for the lung lesions we observed is that ada acts as a hapten, inducing an immune response within the lung. several reports in humans suggest that ada is capable of inducing an immune reaction and/or asthma-like responses (slovak, ; bonsall, ) . the absence of a response to the two higher exposure concentra- " assuming a rat minute volume of . liter/min, a -hr ( min) exposure, and a % deposition efficiency in the pulmonary region (lungs and bronchi), the amount of ada deposited in the lungs per day is estimated as ( . liter/min) x ( mg/liter) x . x min = mg/lungs and bronchi for the mg/m group, mg for the mg/m group, and mg for the mg/m group. * np, no peak was observed at the expected retention time. limit of quantitation is mg per sample. ' nd, not determined. d mean mg/g tissue ± standard deviation; n = . tions used in the studies reported here (i.e., and mg/m ) suggests that the lung lesions in rats are not related to ada exposure. in addition, two recent studies of acute and repeated inhalation exposure to ada in guinea pigs did not report any evidence of airway irritation (shopp, ) or a potential for sensitization to ada (gerlach et al., ) . pyelonephritis, renal tubular concretions, and intratubular renal crystals were noted after subchronic exposure of rats and mice to ada by gavage, at levels of . g/kg body wt or greater per day. in the present study, no renal lesions were observed in animals exposed to mg ada/m for up to weeks. the lack of renal toxicity in the present study is most likely related to differences in the totaj amount of ada given to the animals in the two studies. for example, for the -to -ftm particle size used in this study, total deposition should be about % (raabe et al., ) . for animals exposed to mg ada/ m , with a ml/min minute volume, the total amount of ada deposited should be about - mg/kg body wt per day for -g males or -g females (mean terminal body weights of mg/m group). this dose is -fold lower than that resulting in nephrotoxicity. the lack of an effect on whole blood cholinesterase activity in the inhalation studies, compared to those previously reported, is also most likely due to differences between the two studies in administered dose. mernikova and selikhova ( ) used oral exposures of up to mg/kg body wt for days to achieve a % reduction in blood cholinesterase. the increased levels of t and t found in male rats after weeks of exposure to ada differ from those observed by gafford et al. ( ) , who reported a decreased radioactive iodine uptake in rats hr after being fed ada at % of their diet. no changes in iodine uptake were noted at lower levels of ada in the diet in studies of gafford et al. the reason for the difference between the results reported by gafford and those reported here is unclear, but may include differences in exposure route, exposure concentration, and duration ofexposure. the findings in male rats exposed to ada for or exposure days are generally consistent with the findings of mewhinney et al. ( ) , who showed that [ i c]ada deposited in the lungs of rats is rapidly absorbed into blood during the inhalation exposure and is cleared from tissues with a half-time of day. the rats in the -week, ada subchronic study were euthanized to hr after exposure to ada was stopped. no ada or biurea was detected in kidney tissue. the detection limit was at least mg/g tissue. thus, in the -week study, ada and biurea were cleared from the kidney at least as fast as for the rats in the previous studies. the nonlinearity of the amount of biurea in the lungs of rats exposed for or days to ada aerosols would not be expected, based on the results of the study by mewhinney et al., in which the rats were exposed once for a period of hr. this may, of course, be due to the much greater amount of ada deposited in the lung over the -or -day period of exposure or to the higher exposure concentration in the -week study compared to that in the study involving c. the amount of biurea present in the lungs of rats exposed to ada for or exposure days was small (~ %), compared to the total amount of ada inhaled and deposited over the -week period. in summary, ada is rapidly cleared from the lungs, even when inhaled at concentrations up to mg/m . exposure to ada for up to weeks did not appear to be toxic to rodents. however, the question as to the nature of the chemical sensitization noted in workers exposed to ada still needs to be addressed. vironmental health sciences as part of the national toxicology program. the facilities used for this research were fully accredited by the american association for the accreditation of laboratory animal care. the authors gratefully acknowledge the technical and professional contributions of colleagues at the inhalation toxicology research institute and at the national institutes of environmental health sciences. the determination of biurea in the presence of azodicarbonamide by hplc azodicarbonamide: methods for the analysis in tissues of rats and inhalation disposition allergic contact dermatitis to azodicarbonamide use of a jet mill for dispersing dry power for inhalation studies evaluation of a real-time aerosol monitor (ram-s) for inhalation studies a new and rapid colorimetric determination of acetyl cholinesterase activity microdetermination of oxyhemoglobin, methemoglobin, and sulfhemoglobin in a single sample of blood apparent effect of an azodicarbonamide on the lungs effect of azodicarbonamide (i, l'-azobisformamidc) on thyroid function effect of four-week repeated inhalation exposure to azodicarbonamide on specific and nonspecific airway sensitivity of the guinea pig complications of viral and mycoplasmal infections in rodents to toxicology research and testing , '-azobisformamide. ii. thermal decomposition. kinetics, products, and decomposition mechanism respiratory system correlation of urinary enzyme activity and renal lesions after injection of nickel chloride blood and liver cholinesterase in poisoning with porophor- and celogen the fate of inhaled azodicarbonamide in rats cascade impactor design and performance studies of the safety of azodicarbonamide as a flourmaturing agent regional deposition of inhaled monodisperse coarse and fine aerosol particles in small laboratory animals acute inhalation exposure of azodicarbonamide in the guinea pig occupational asthmas caused by a plastic blowing agent, azodicarbonamide use of doseresponse data to compare the skin sensitizing abilities of dicyclohexylmethane- , '-diisocyanate and picryl chloride in two animal species textbook of clinical chemistry respiratory symptoms associated with the use of azodicarbonamide foaming agent in a plastics injection molding facility this research was conducted under interagency agreement yo -es- o between the u.s. department of energy's office of health and environmental research (contract ev ) and the national institute of en- key: cord- -rmjv ia authors: nan title: the signal sequence of the p protein of semliki forest virus is involved in initiation but not in completing chain translocation date: - - journal: j cell biol doi: nan sha: doc_id: cord_uid: rmjv ia so far it has been demonstrated that the signal sequence of proteins which are made at the er functions both at the level of protein targeting to the er and in initiation of chain translocation across the er membrane. however, its possible role in completing the process of chain transfer (see singer, s. j., p. a. maher, and m. p. yaffe. proc. natl. acad. sci. usa. . : - ) has remained elusive. in this work we show that the p protein of semliki forest virus contains an uncleaved signal sequence at its nh -terminus and that this becomes glycosylated early during synthesis and translocation of the p polypeptide. as the glycosylation of the signal sequence most likely occurs after its release from the er membrane our results suggest that this region has no role in completing the transfer process. iosynthesis of proteins at the er can be subdivided into several steps. these are (a) targeting of translation complexes to the er membrane; (b) synthesis and transfer (translocation) of the polypeptide chain across the lipid bilayer; and (c) protein maturation in the lumen of er (chain folding, disulphide bridge formation, glycosylation, and oligomerization). the mechanisms for these processes have been studied extensively during recent years (kornfeld and kornfeld, ; wickner and lodish, ; rapoport, ; lodish, ; rothman, ) . a most important finding has been that all proteins made at the er carry a signal sequence (also called signal peptide), a hydrophobic peptide which is usually located at the nh -terminal region of the polypeptide chain. one function of the signal peptide is to achieve targeting of the polysome to the er membrane (rapoport, ) . when the signal sequence emerges from the ribosome it binds to the signal recognition particle, which mediates binding of the polysome to the docking protein in the er. after this another function of the signal sequence is expressed, that is to interact with some components of the er membrane and thereby initiate translocation of the polypeptide chain into the lumen of the er (gilmore and blobel, ; robinson et al., ; wiedmann et al., ) . further synthesis of the polypeptide then continues with concomitant chain translocation. an important but as yet unresolved question is whether the signal sequence has any role in the translocation process per se or whether its functions are limited to the targeting and translocation-initiation steps. for instance, singer and co-workers danny huylebroeck's present address is innogenetics, industriepark , box , b- , ghent, belgium. ( a) have suggested a translocator protein model in which the signal sequence helps to keep the machinery open for chain transfer. it is specifically this last question we have addressed in the present work. we describe the characteristics and behavior of the uncleaved signal sequence of the p protein of semliki forest virus (sfv) l upon translocation across the er membrane in vitro. the p protein is one subunit of the heterodimeric spike protein of the sfv membrane (reviewed in garoff et al., ) . it is made as a precursor protein together with the other structural proteins of sfv, i.e., the nucleocapsid protein, c, and the other spike subunit, el. the three proteins are synthesized from a . -kb long mrna in the order c, p , and el, and separated by cleavage of the growing precursor chain. during synthesis of the p polypeptide at the er all but a residue cooh-terminal portion and the membrane anchor is translocated across the membrane. the p signal sequence has so far been only roughly localized to the nh -terminal third of the polypeptide chain (garoffet al., ; bonatti et al., ) . we show here that the signal sequence of p consists of a residue peptide at its nh -terminal region. this region includes one out of four glycosylation sites (asn~ ) for n-linked oligosaccharide on the p chain. we also demonstrate that the glycosylation of the p signal sequence occurs early during chain translocation. as this modification of the signal region most likely correlates with its release into the lumen of er it follows that the signal sequence of p is probably only needed for an initial step in chain translocation and not to small scale plasrnid dna preparations were done using the alkali-sds method essentially as described by birnboim and dnly ( ) . large quantities of plasmids to be used for in vitro transcription were prepared by lysozyme-triton lysis of the bacteria, followed by csc -etbr banding (kahn et al., ) . etbr was removed by several extractions with isopropanol and, after fivefold dilution, the dna was precipitated twice with ethanol and further purified over a biorad a- m column. restriction endonucleases and dna-modifying enzymes were used according to the suppliers instructions. removal of the ' sticky end from the sac i site in pgem -alphag (zerial et al., ) with t dna polymerase was done at °c ( h), dntps were added (end concentration #m each), and the dna was subsequently filled in at °c for h. all ligations were done at °c for h except for linker ligations ( °c, h). all other molecular biological manipulations were done using slightly modified standard protocols (maniatis et al., ) . in vitro transcription ( . #g supercoiled template dna per # vol) in the presence of sp rna polymerase ( - u) and the cap structure was carried out as previously described (zerial et al., ) . in vitro translation reactions using a rabbit reticulocyte lysate were performed at °c essentially as described . . # of the in vitro synthesized rna was translated in a total volume of # . potassium, magnesium, and spermidine concentrations were , . , and . mm, respectively. when indicated, # of er membranes was included. in some translocations the membranes were pretreated with #m peptide for min on ice. the final peptide concentration in the total translation mixture here was, after addition of the pretreated membranes, adjusted to /~m. to obtain partial synchronization of translation, ata was added after a preincubation of . - . rain (borgese et al., ) . a final ata concentration of . mm was found to be sufficient for inhibiting initiation of chain synthesis (see control in fig. , lane/). higher concentrations of ata inhibited first transloeation and then also chain elongation. for protease protection experiments, proteinase k was added to a final concentration of . mg/ml and the samples were incubated at *c for min in the presence or absence of % triton x- . proteolysis was stopped by the addition of pmsf (final concentration mg/ml) and samples were kept at *c for min before further processing for electrophoresis (cutler and garoff, ) . bands containing labeled protein were visualized by fluorography. quantitation of proteins was done by cutting the bands out of the dried gel, solubilizing them with protosol (from dupont de nemours, nen) according to the instructions of the manufacturer, and finally counting the ~s radioactivity in a liquid scintillator (wallac lkb, turku, finland). the localization of the bands on the dried gel was done with the aid of the fluorograph in transillumination. -# translation mixtures were adjusted to ph - . by adding an appropriate volume (pretitrated) of . n naoh. after a -rain incubation on ice the samples were separated into a pellet fraction and a supernatant fraction by centrifugation through a -# alkaline socmse cushion (gilmore and blobel, ) for rain at psi in an airfuge (beckman instruments, inc., palo alto, ca) using the a- / rotor and cellulose propionate tubes precoated with bsa ( % solution). the entire supernatant was removed, neutralized with n hci, diluted . times with water, and then precipitated by adding . vol of acetone. these precipitated proteins and pelleted membranes (obtained from the airfuge tube) were taken up in % sds by incubating at °c for min and then processed for immunoprecipitation reactions as described below. total translation mixtures were adjusted to % sds, then boiled for rain and diluted : with water. vol of immunoprecipitation buffer ( . % triton x- , mm nac , mm tris-hc , ph . , mm edta, and /~g pmsf/rni) and # of antibody were added for h at c. the mixture was briefly centrifuged ( - min in an eppendorf minifuge) and to the supernatant one fifth volume of a : slurry of protein a beads were added and incubated at "c for h under constant agitation. the beads were collected and washed four times with ml ripa buffer (gielkens et al., ) by centrifugation, followed by a single wash with a buffer containing mm naci, mm tris-hcl ph . , and t~g pmsf/ml. the beads were then taken up in excess gel loading buffer (cutler and garoff, ) , heated at °c for min, and cleared by centrifugation before loading the immunoprecipitate on the gel. constructions of pgem alphagx and pgem dhfrx. for the construction of the final fusion protein-coding plasmids used in this study we first had to make plasmids pgem alphagx, which are derived from pgem alphag and pgem dhfrx, which are derived from pgem dhfr (zerial et al., ) . plasmid pgem alphag contains a bp-long nco i-pst i fragment encompassing the entire chimpanzee alpha-globin coding region between the hinc ii and pst i sites of the polylinker of the plasmid pgem (pmmega biotech). the nco i site contains the translation initiation codon from alpha-globin (zerial et al., ). an xho i site, allowing subsequent in-frame ligations of sfv sequences, had to be introduced in pgem alphag. therefore, this plasmid was cut (upstream of the nco i site) with sac i, the ' sticky ends removed with " " dna folymerase, an xho i octamer linker introduced and, after cutting with xho i, the plasmid was religated at low dna concentration ( #g/ml). plasmid pgem alphagx then contains the , bp-long xbo i-pvu i fragment needed for the construction of the fusion protein-coding plasmid pc alphag. an intermediate construct, analogous to pgem alphagx, and also conraining a unique xho i site, was needed for the constructions of dhfrcontaining plasmids. for this purpose we inserted the xho i linker into partially xmn i cut pgem dhfr (zerial et al., ) . after cutting the linkers, linear plasmid was purified on agarose gel and religated. since the second xmn i site in pgem dhfr is located in the beta-lactamase coding region of the vector (snt~liffe, ) and insertion of an xho i site by an octamer linker will result in an ampicillin-sensitive e. coli phenotype after transformation, only the desired pgem dhfrx construct was obtained. from this plasmid, an xho i-pvu' i fragment of at least , bp (the precise length of the cdna insert, i.e., the length of the ' untranslated region of dhfr, is not known in pgem dhfr) was used for the construction of pc dhfr. construction of the fusion protein-coding plasmids pc alphag and pc dhfr. plasmid pgemi-sfv (also called pg-sfv- / ; melancon and garoff, ) contains a re, engineered edna copy of the sfv s mrna sequences cloned as a barn hi fragment in the barn hi site of the polylinker downstream of the sp promoter in the plasmid pgem (promaga biotech). from the sfv plasmid, a , hp-long pvu i-xho i fragment, containing the coding sequences for the capsid protein and the nh -terminai region of the p protein, was isolated. the xho i-pvu i fragments from pgemi-sfv, pgem alphagx and pgem dhfrx were isolated and ligated at a : molar ratio to obtain pc alphag and pc dhfr, respectively. plasmid dnas from ampicillin-resistant colonies were screened and compared to the starting vectors by restriction analysis. altogether, the sfv-alpha-globin edna fusion results in a complete c region and codons from the ' end of the p region fused to the whole of the alpha-globin coding sequence (see fig. ). eight new codons have been introduced at the point of edna fusion. in the sfv-dhfr construction the c region and the first codons of p are fused to the dhfr coding sequence such that one new codon is introduced and the first codons of dhfr are lost. construction of plasmidp dhfr. for engineering of a p protein signal sequence-dhfr fusion protein which is not derived from a c proteincontaining precursor we synthesized the whole p signal sequence region. two overlapping oligonucleotides were made (dna-synthesizer; applied biosystems, foster city, ca) :( ) ' atacacagaattcagcaccatgt-ccgccccgctgattac tgccatgtgtgtcctiv~caatc_~tacct-tcccgtc~ttccagcccccgtgtgtacc~, ( ) ' gttatcct-cgagcatccgtagtgtggcctctgcgttgttttcatagcagca-aggtacacacgggggc tggaagcac gggaaggtagcattgcjca-aggac. they correspond to both strands of the p signal sequence region of the sfv edna. together they span the coding region of amino acid residues - of p . oligo (the coding strand) includes, in addition, the region coding for initiator methionine of the c protein plus its ' flanking sequences ( ' agcaccatg). at the extreme ' end of this oligo we have added the recognition sequence for eco ri and its flanking sequences from the ' end of the structural part of the sfv cdna ( ' atacacagattc). oligo ends at its ' end with the xho i site which follows the signal sequence region on the p gene. the two oligonucleotides were hybridized ( complementary bases), filled in using sequenase (united states biochemical co., cleveland, oh) and restricted with eco ri and xho i. the resulting dna fragment was then purified and inserted into pcp dhfr instead of the c and p sequences. for this purpose the pcp dhfr plasmid was eco ri and xho i restricted and the plasmid part with the dhfr sequences isolated. the resulting plasmid p dhfr contains thus the coding sequences for the initiator methionine of c and the first residues of the p protein, including the signal sequence, in front of the dhfr gene (see fig. ). construction of pgem sfv d- . this plasmid was constructed by ligatiag three fragments together. the first one was the major part of pgem , cut just after the promoter region with hind iii and barn hi. the second fragment (hind i~-xho i) was isolated from the plasmid psvs-sfv . this fragment contains the sequences encoding the capsid and the nh -terminal part of the protein of sfv. the third fragment was obtained by cleaving plasmid pl sfv d- (see below) with xho i and barn hi and isolating the fragment containing the ' part of the coding sequence for the p protein. however, it should be noted that in the d- version there is an exchange of codons at the ' end of the gene for six aberrant ones. the corresponding p protein variant is called d- (see fig. ). it should also be mentioned that pl sfv d- has been derived from pl sfv d- , (cutler and garoff, ) by exchanging the xho i-cla i region containing the ' part of the p coding region with the similar fragment from psv sfv d- . this latter plasmid is described in garoff et al. ( ) . to define the p signal sequence we have studied the translocation phenotype of two reporter molecules, the rabbit alpha-globin and the mouse dihydrofolate reductase (dhfr), both of which have been extended at their nh:-termini with an nh -terminal residue peptide from p . the hybrid molecules were tested in a microsome-supplemented in vitro translation system. the alpha-globin and the dhfr have earlier been shown to be translocation incompetent if not extended with a heterologous signal sequence at their nh termini (zerial et al., ) . we first tested the expression of in vitro-made rna from the construction pcp dhfr in an in vitro translation system. this would be expected to yield free c protein and p reporter hybrid (p -dhfr) through c-catalyzed autoproteolytic cleavage of the nascent c-p -reporter precursor ( fig. ) (aliperti and schlesinger, ; hahn et al., ; melancon and garoff, ) . furthermore, the p -reporter hybrid should be translocated across microsomal membranes and possibly glycosylated at asn~ of the p sequence if the residues long nh -terminal p peptide carries a signal sequence. is shown to be linked to asn residue in the p part (garoff et al., ) . additional amino acids resulting from in frame translation of the multicloning region of pgem and the added xho i linker as well as the initiator met of p dhfr are also indicated. analysis showing the translocation activity of the p -dhfr protein. in the absence of membranes (lane/) two major protein species were translated from the sp -directed transcript. one of these had the expected size of c ( kd) and the other one that of the p -dhfr hybrid molecule ( kd). the coding region has apparently been translated faithfully and the precursor protein cleaved efficiently. the identity of the p -dhfr was directly proven by immunoprecipitation with a dhfr specific antiserum (see fig. ). the two weaker bands migrating faster than the capsid in fig. , lane i were most likely derived from c coding sequences because they are found in all protein analyses of in vitro transcrip- figure . immunological identification of the p -dhfr hybrid protein and analysis of its association with membranes. rna transcribed from pc dhfr was translated in vitro in the presence of membranes which in some cases had been treated with an acceptor (acc) or nonacceptor (non) peptide. the samples were treated, after translation, at ph - . , and the proteins then separated into a membrane-bound pellet fraction (p) and a supernatant fraction (s) by centrifugation. in all samples the p -dhfr polypeptides were isolated using an anti-dhfr antibody. the proteins were then analyzed by sds-page ( %) and subsequent autoradiography. the slower migrating band corresponds to glycosylated and the faster one to nonglycosylated forms of p -dhfr (compare fig. ) . tion/translation mixtures involving cdnas with c regions (compare fig. ). when microsomes were added to the c-p -dhfr in vitro translation system a new band appeared which migrated somewhat slower than the p -dhfr band seen in the analysis of the mixture lacking membranes (fig. , lane ) . it almost comigrated with one of the two weak c derived bands. the new band apparently corresponds to iri -dhfr hybrids that have been translocated into the lumen of the added microsomes and have become glycosylated. the immunoprecipitation analysis shown in fig. confirmed the identity of this material. the protease digestions in the absence (fig. , lane ) and presence of triton x- (lane ) clearly demonstrated that the slower migrating p -dhfr molecules were indeed translocated. about half of this material remains protected in the presence of intact microsomes whereas all is digested when the membranes are solubilized with detergent. in contrast, the other translated material did not show such a pronounced membrane-dependent protease resistance. note that protease treatment of all samples yielded a resistant protein of a small size. this most likely represents a protease-resistant c fragment. the glycosylation of the translocated p -hybrid and its effect on the apparent size of the protein was shown in an experiment where a short peptide (asn-leu-thr), which competes for n-linked glycosylation, was included during translation. apparently only unglycosylated faster migrating p -dhfr hybrids were formed in these conditions although chain translocation took place conferring protease resistance (fig. , lanes - ) . additional analyses (lanes - ) illustrate that a control peptide (asn-leu-athr) which cannot serve as an acceptor site for n-linked glycosylation, had no effect on the glycosylation of the p -reporter hybrids when tested in an analogous way. similar studies as with pcp dhfr were also performed with the pcp globin coded proteins in vitro. the results (not shown) were analogous to those described above for the pcp dhfr construct. c protein and p -globin hybrid were synthesized in the absence of membranes. when membranes were added, a protease-protected form of the hybrid appeared. this hybrid was also glycosylated as deduced from an experiment involving the acceptor peptide for glycosylation. fig. (lanes - ) shows the results of analyses in which we have tested whether the p signal sequence region confers stable membrane attachment to the p -dhfr hybrid. microsome-supplemented translations were adjusted to ph - . with naoh, incubated on ice for min, and then separated into a membrane pellet and supernatant fraction by ultracentrifugation. in all samples the p -dhfr polypeptides were isolated using an anti-dhfr antibody, sds-page shows that the hybrid protein segregates almost quantitatively into the supernatant fraction (compare lane i with lane ). in similar conditions an integral membrane protein, the human transferrin receptor, was found to sediment with the membranes into the pellet fraction and a secretory protein, ig light chain, was only recovered in the supernatant (not shown). if the acceptor peptide for glycosylation was included in the in vitro translation and the mixture then analyzed we found that the now unglycosylated but still translocated p -hdfr hybrids were again mostly found in the supernatant fraction (lanes and ) . lanes and show the analyses with the control peptide. to see whether the c protein exerts an influence on the translation phenotype of the p -dhfr protein the p dhfr plasmid (see fig. ), lacking the c gene, was tested. the results shown in fig. show clearly that the p -dhfr hybrid is translocated and glycosylated in the same way as when expressed from pcp dhfr. thus, apart from providing a free nh -terminal end to the p -dhfr protein by autoproteolysis of the c-p -dhfr precursor the c protein has no role in the translocation process. we conclude that the residue peptide from the p nh -terminal region confers a translocation positive phenotype to the p -globin and p -dhfr polypeptides and therefore must contain a functional signal sequence. the translocated fusion proteins were also shown to be glycosylated. this must involve asn~ of the p peptide as it is part of the only potential glycosylation site on the hybrid polypeptides (garoff et al., ; references on dhfr sequence in legend to fig. ) , finally, we can also conclude that the p signal sequence does not provide a stable membrane anchor to the translocated chain. to define at what time point during p -dhfr chain synthesis the asn becomes glycosylated we performed a time-course experiment essentially as described by rothman and lodish ( ) (fig. ) . in this experiment a -# translation was initiated. after . rain ata was added ( . ram) to block additional starting of chain synthesis. then, at . -rain intervals, two . /~ aliquots were removed; one for mixing with # of hot page sample buffer ( % sds) and the other one for further incubation after mixing with . /~ of % tx- . the first sample from each time point was used for the determination of the time needed for chain completion, which is a function of the translation rate, and the other one allowed determination of the time course of glycosylation of the translocated chain. triton x- solubilizes the microsomal membranes and thereby inactivates glycosylation (but not chain elongation). therefore, only those p -dhfr chains that have presented asnl to the glycosylation machinery before tx- addition have had the possibility to become glycosylated. in fig. , lanes - , one can see that completed p dhfr chains ( residues with initiator met) appear after a -min incubation from the time point of ata addition. if one assumes constant chain initiation during the figure . time course of p dhfr glycosylation. a -# translation was initiated. after a preincubation time of . min ata was added to inhibit further initiation of chain synthesis. then, at intervals of . min (indicated by . ', . ', . ', . ', . ', . ', . ', . ', . ', and . ') two . -/zl samples were removed, one for mixing with page sample buffer and another one for mixing with tx- (final concentration %) and further incubation at °c (for a total time of min after ata addition as indicated by the lower row of time points in the figure) . lanes - show the samples removed for mixing with the page sample buffer. from these results the approximate rate of translation can be derived. completed chains appear in the -min sample. lanes - show the samples in which the membranes have been solubilized with triton x- for inactivation of the glycosylation machinery. from these analyses it is possible to estimate when asn is modified during p -dhfr synthesis. the first glycosylated forms are clearly visible in the . -min sample, a time point where only about half of the p -dhfr chain has been synthesized. the nature of the material in the two weak bands seen in lanes - is unclear. their transient appearance before the completion of the p -dhfr chain suggests that they represent complexes of nascent p -dhfr chains. figure . time course of p d- glycosylation. seven translations in the presence of microsomal membranes were started in parallel. after a -rain initial incubation at °c, ata was added in order to inhibit further initiation of chain synthesis. incubation was then continued for rain. at the indicated time points ( , , , , , , and rain) tx- (tx) was added to stop further chain glycosylation. at the same time one half of each sample was removed and put on ice in order to measure the extent of chain elongation at each time point. all samples were analyzed by sds-page ( %) and autoradiography. lanes - show the analysis of the samples incubatedwith tx- and lanes -- the analysis of the portions put on ice at the different time points. the complete sequence of treatments for each sample is indicated by the labeling in each lane (upper row of time points indicate tx- addition and cooling on ice, respectively; lower row of timepoints indicate incubation in the presence of tx- ). lanes i and represent controls. in the experiment shown in lane i, ata was added before starting a -rain membrane-supplemented translation. in the experiment shown in lane a translation with membranes was allowed to proceed for min. ata was added as in the time course samples but tx- was omitted. the c protein, the unglycosylated (p ) and the glycosylated (gp ) forms of p d- are labeled at right in the figure. arrowheads at left indicate (from above) the migration of the -kd igg heavy chain, the -kd ovalbumin, and the -kd carbonic anhydrase. note that somewhat different amounts of translation mixtures have been analyzed in the various lanes (compare intensities of c and c-derived bands). . -rain preincubation without ata then the total time for chain synthesis is ,~ . rain ( + . rain). this corresponds to a mean translation rate of . peptide bonds per rain. lanes - show that glycosylated chains appear in all those samples that have had the membranes intact for . min or more after ata addition. this means that p dhfr chains that have been elongated for '~ . rain ( . min incubation after and . min before ata addition), to the length of ,'~ residues already carry a sugar unit at asn . as ~ residues of the nascent chain are required to span the ribosome and the lipid bilayer we conclude that glycosylation occurs when the first - residues of p -dhfr appear within the lumen of the er (malkin and rich, ; blobel and sabatini, ; bergman and kuehl, ; smith et al., ; glabe et al., ; randall, ) . we also studied the timing of the glycosylation of asn~ in its normal background, i.e., during p chain synthesis. for this experiment we used the pgem sfvd- construct. this encodes the c and the p membrane protein variant, p d- , in which a few residues of the cytoplasmic protein domain have been exchanged as compared to the wild type sequence (see materials and methods and fig, ) . fig. , lane , shows that rna, which has been transcribed from this construct, directs the synthesis of c and p d- chains. the protein has catalyzed correct c-p cleavage and the p signal sequence has catalyzed the insertion of about half of the p d- chains across the added microsomal membranes. these migrate as glycosylated - kd proteins in contrast to the noninserted molecules which have an apparent molecular mass of 'x, kd. the glycosylated and translocated nature of the - kd material was clearly demon-strated in experiments similar to those described above for the p -dhfr hybrid molecule (not shown). altogether there are four glycosylation sites within the p d- sequence. these correspond to asn residues at positions , , , and (see fig. ). fig. (lanes - ) shows the time course of the four glycosylation events during c-p d- translation. a slightly different protocol was followed in this experiment as compared to that with p -dhfr. seven translations were initiated in parallel and after a -min incubation these were put on ice and ata was added. elongation of the already initiated chains was then continued for a total of min, however, so that triton x- was added to individual samples at , , , , , , and min. at these time points half of each sample was also removed and translation stopped by cooling on ice. lanes - show the sds-page of the samples that had received triton x- at different time points. we found the sequential appearance of p d- polypeptides with no carbohydrate (lane ), with one and two units added (seen as two new bands with slower migration in lanes and ), with three units (lane ), and all four sugar units (lanes , , and ) attached to the protein backbone as the translation proceeded coordinately with time. note that the four glycosylation events result in different degrees of increase of the size of p d- . the second event causes the largest increase and the third one the smallest. as the sugar unit added at each step should be the same we think that these differences reflect some conformational changes in the p folding which occur coordinately with glycosylation. in lanes -- we have analyzed the samples that were withdrawn at the different times but were kept on ice. as expected, we see a sequential appearance of first the capsid the journal of cell biology, volume , protein (in the -min sample) and then the p d- protein (barely visible in the -min sample). the p d- protein is partly present in its glycosylated and partly in its unglycosylated form. using . min as a rough estimate for the translation time of the residue long c-p d- chain (time point of p d- detection, min, plus half of the -min preincubation time without ata) we have calculated the translation rate and derived the approximate earliest time points when the four glycosylation sites of p d- should be available for modification. according to these, asn~ and asn should be the only sites available for glycosylation in the -min sample, shown in lane , and the most abundant ones presented for modification in the -min sample, shown in lane . therefore, it appears reasonable to assume that those chains of these two samples which have obtained two sugar units carry these on the aforementioned two sites. thus, the peptide region with asn,a seems to be target for rapid modification also when present in its normal background, that is with the p protein. the fact that the residue fragment of the nh -terminal region of the p protein is able to translocate two different reporter molecules into microsomes constitutes in our mind convincing evidence for signal sequence activity in this protein fragment. a more precise location of the p signal sequence within the residue p fragment can be done with the aid of the known consensus features of a signal sequence. the most typical characteristic of a signal sequence is a stretch of - uncharged residues, mostly hydrophobic ones (von heijne, ) . this part of the signal sequence probably forms an alpha helix in the er membrane (emr and silhavy, ; briggs et al., briggs et al., , kendall et al., ; batenburg et al., ) . the only possible candidate region within the residue p fragment having these features is the residue segment between pro and pro (see box in uppermost sequence in fig. ) . the pro-rich region in the middle of the residue fragment would not form an alpha-helix, and the cooh-terminal part of the p segment contains a high number of charged residues. as shown in fig. these features are conserved in all those alphaviruses where the p protein has been sequenced. thus, we find the experimental results, together with the structural considerations discussed above, highly indicative that the nh terminal residues of p constitute its signal sequence. eventually, the signal sequence of the p protein becomes translocated across the membrane of the er into its lumenal space. in here it is found as a glycosylated peptide which is part of a amino acid residues long "pro-piece of the p protein. this pro-peptide, called e , is cleaved at a late stage during virus assembly (de curtis and simons, ) and is then either released into the extracellular medium as a soluble protein (sinbis virus) or remains as a peripheral protein subunit on the virus spike (sfv) (garoff et al., ; mayne et al., ) . our present tests of the p -globin and p dhfr hybrids in the high ph wash assay of membrane supplemented in vitro mixtures also support the notion that the p signal sequence does not remain bound to the membrane where it has exerted its function as a translocation signal. in this work we like to use the glycosylation event at asn, of the signal sequence to mark the time point when the latter becomes released into the lumen of the er. the crucial question then becomes whether it is reasonable to assume that the signal peptide has to be released from the er membrane before it can become glycosylated. to answer this question we have to consider what is known about the topology of glycosylation as well as the way by which the p signal might interact with the er membrane. today there is no exact information about how a signal sequence might be inserted into the er membrane when exerting its function in chain translocation. however, the typical cytoplasmic orientation of the nh -termini of membrane protein chains carrying a combined signal sequence-anchoring peptide suggests that signal sequences in general might direct their function in translocation through the insertion of their hydrophobic and uncharged stretch of amino acid residues into the membrane in such an orientation that the nheterminus of the signal remains on the outside of the er mem- (garoff et al., ; rice and strauss, ; dalgarno et al., ; kinney et al., ; chang and trent, ) . amino acid residues are given using the one letter code and they are numbered from the nh -towards the cooh-terminus. the boxes indicate that region in each sequence which best fulfills the consensus features of a signal sequence (the uncharged and hydrophobic region). the * symbols represent attachment sites for oligosaccharide and the (+) and (-) the presence of a charged amino acid side chain. proline residues are labeled with a dot. the sequences are aligned according to maximum amino acid sequence homology. brane (bos et al., ; lipp and dobberstein, ; spiess and lodish, ; zerial et al., ; see also shaw et al., ) . in addition, it is known from physical studies using synthetic signal peptides and artificial lipid membranes that the signal peptides readily insert into the membrane and there obtain an alpha-helical conformation (briggs et al., (briggs et al., , batenburg et al., ; cornell et al., ) . if the p signal sequence adapts such an orientation and conformation in the er membrane it would mean that the glycosylation site at asnt would locate inside the membrane (von heijne, ) . in this location the site can hardly be accessible for the glycosylation machinery. (note that in the related ross river virus, the venezuelan equine encephalitis virus and eastern equine encephalitis virus the corresponding glycosylation site is even closer towards the nh terminus, that is at asn , see fig. .) according to several recent studies, glycosylation requires the exposure of the glycosylation site in the lumen of er. firstly, it has been shown that the binding protein for the glycosylation site of n-linked oligosaccharides is a lumenal -kd protein of the er (geetha-habib et al., ) . secondly, one study with the asialoglycoprotein receptor and another one with the corona virus e membrane protein demonstrate that lumenally oriented glycosylation sites are not used on transmembrane polypeptides if they locate very close to the membranebinding segments of the chains (mayer et al., ; wessels and spiess, ) . in the case of the asialoglycoprotein receptor a site was not used if located residues apart from the membrane anchor, however, if moved more residues apart from the anchor it became glycosylated. in the case of the corona virus protein a site just adjacent to the combined signal sequence-anchor peptide remained unglycosylated, whereas an engineered site residues further away was used for glycosylation. such restrictions in glycosylation are most likely to be explained by sterical problems in attaching the very spacious sugar unit (lee et al., ; see also wier and edidin, ) onto acceptor sites that are fixed in a position which is close to the membrane plane. therefore, we assume that the p signal sequence, with its glycosylation site at asn , cannot become glycosylated before it has been released into er lumen. as this glycosylation event was shown to occur at an early stage of chain translocation it follows that this signal sequence can only interact with the er membrane during the beginning of chain translocation. in other words, the signal sequence of p can only function at the initiation stage of chain translocation and has no role in completing this transfer process. if the latter would be true we would have expected that the signal sequence glycosylation would have occurred first after all of the lumenal domain of the p d- chain would have been translated and translocated. the importance of our results in this work lies in the fact that they rule out translocation models in which the signal sequence would have a role throughout the whole process of chain translocation. for instance, if the translocation site is represented by a multisubunit protein complex forming an aqueous channel across the membrane for chain transfer (see signal hypothesis, blobel and dobberstein, ; amphiphatic tunnel hypothesis, rapoport, ; translocator protein hypothesis, singer et al., a,b) , then the signal sequence could be involved in its assembly or "opening" but apparently not for keeping it together or open until chain transfer is completed (as suggested in singer et al., a) . similarly, when considering models in which the chain transfer occurs directly through a lipid membrane (see the helical hairpin hypothesis, engelrnan and steitz, ; direct transfer model, von heijne and blomberg, ; phospholipid channel hypothesis, nesmayanova, ) the interaction of the signal sequence with the lipid bilayer could be of importance only at the stage of translocation initiation but not at the actual chain transfer step. the possibility that our results about p protein translocation would be unique to the viral system .and different from the general translocation process in the er we find most unlikely. several results from this and earlier works suggest that the signal sequence of the p protein functions much in the same way as cleavable ones do. firstly, studies with a temperature-sensitive mutant of sfv, ts , have shown that the signal sequence of p requires a free nh -terminal end for function (hashimoto et al., ) . at the nonpermissive temperature the ts mutant is defective in cleavage between the c and the p protein region of the protein precursor because of a mutation that inactivates the autoproteolytic activity of c. this defect results in a translocation negative phenotype for the p protein. secondly, the p signal sequence has been shown to be srp dependent. if the mrna for the structural proteins of sfv is translated in vitro in a wheat germ-derived system that is supplemented with saltwashed (and srp-deprived) membranes then p translocation is observed only in the presence of exogenous srp (bonatti et al., ) ~ if srp is supplemented without membranes then p translation is arrested. thirdly, our time course study about p synthesis and glycosylation in this work clearly demonstrates that the p chain is translocated cotranslationally across the er membrane. this was also suggested by earlier studies in vitro (garoff et al., ; bonatti et al., ) . in these studies it was shown that both microsomal membranes as well as srp have to be added to the synthesis mixture before extensive lengths (,,o amino acid residues) of the p chains have been translated. it is also possible to speculate on a mechanism in which the p signal sequence would be released from a putative translocation site by being replaced by another signal sequence-like structure in the p polypeptide. however, such a "rescue" mechanism appears improbable as the p signal sequence was found to be glycosylated early during translation of both the p polypeptide as well as the signal sequence-dhfr hybrid chain. evidence for an autoprotease activity of sindbis virus capsid protein characterization of the inteffacial behavior and structure of the signal sequence of escherichia coli outer membrane pore protein phoe addition of glucosamine and mannose to nascent immunoglobin heavy chains a rapid alkaline extraction procedure for screening recombinant plasmid dna transfer of proteins across membranes. i. presence of proteolytically processed and unprocessed nascent immunoglobin light chains on membrane-bound ribosomes of murine myeloma controlled proteolysis of nascent polypeptides in rat liver cell fractions. i. location of the polypeptides within ribosomes role of signal recognition particle in the membrane assembly of sindbis viral glycoproteins. fur ribosomemembrane interaction: in vitro binding of ribosomes to microsomal membranes nh -terminal hydrophobic region of influenza virus neuraminidase provides the signal function in translocation in vivo function and membrane binding properties are correlated for escherichia coli lamb signal peptides conformations of signal peptides induced by lipids suggest initial steps in protein export phenotypic expression in e. coli ofa dna sequence coding for mouse dihydrofolate reductase nucleotide sequence of the genome region encoding the s mrna of eastern equine encephalomyelitis virus and the deduced amino acid sequence of the viral structural proteins conformations and orientations of a signal peptide interacting with phospholipid monolayers structure of amplified normal and variant dihydrofolate reductase genes in mouse sarcoma sis cells mutants of the membrane-binding region of semliki forest virus e protein. i. cell surface transport and fusogenic activity ross river virus s rna: complete nucleotide sequence and decoded sequence of the encoded structural proteins dissection of semliki forest virus glycoprotein delivery from the trans-golgi network to the cell surface in permeabilized bhk cells importance of secondary structure in the signal sequence for protein secretion the spontaneous insertion of proteins into and across membranes: the helical hairpin hypothesis solid phase peptide synthesis assembly of the semliki forest virus membrane glycoproteins in the membrane of the endoplasmic reticulum in vitro nucleotide sequence of edna coding for semliki forest virus membrane glycoproteins structure and assembly of alphaviruses expression of semliki forest virus proteins from cloned complementary dna. ii. the membrane-spanning glycoprotein e is transported to the cell surface without its normal cytoplasmic domain glycosylation site binding protein, a component of oligosaccharyl transferase, is highly similar to three other kd luminal proteins of the er synthesis of ranscher murine leukemia virus-specific polypeptides in vitro translocation of secretory proteins across the microsomal membrane occurs through an environment accessible to aqueous perturbants glycosylation of ovalbumin nascent chains: the spatial relationship between translation and glycosylation sequence analysis of three sindbis virus mutants temperature-sensitive in the capsid protein autoprotease evidence for a separate signal sequence for the carboxy-terminal envelope glycoprotein e of semliki forest virus preparation and use of nuclease-treated rabbit reticulocyte lysates for the translation of eucaryotic messenger rna dog pancreatic microsomalmembrane polypeptides analysed by two-dimensional gel electrophoresis plasmid cloning vehicles derived from plasmids cole , f, r k, and rk idealization of the hydrophobic segment of the alkaline phosphatase signal peptide nucleotide sequence of the s mrna of the virulent trinidad donkey strain of venezuelan equine encephalitis virus and deduced sequence of the encoded structural proteins expression of semliki forest virus proteins from cloned complementary dna. i. the fusion activity of the spike glycoprotein assembly of asparagine-linked oligosaccharides binding of synthetic clustered ligands to the gal/galnac lectin on isolated rabbit hepatocytes structural and evolutionary analysis of the two chimpanzee alpha-globin mrnas signal recognition particle-dependent membrane insertion of mouse invariant chain: a membrane-spanning protein with a cytoplasmically exposed amino terminus transport of secretory and membrane glycoproteins form the rough endoplasmic reticulum to the golgi partial resistance of nascent polypeptide chains to proteolytic digestion due to ribosomal shielding molecular cloning: a laboratory manual membrane integration and intracellular transport of the coronavirus glycoprotein el, a class ill membrane glycoprotein biochemical studies of the maturation of the small sindbis virus glycoprotein e reinitiation of translocation in the semliki forest virus structural polyprotein: identification of the signal for the el glycoprotein processing of the semliki forest structural polyprotein: role of the capsid protease on the possible participation of acid phospholipids in the translocation of secreted proteins through the bacterial cytoplasmic membrane. febs (fed. fur structure and genomic organization of the mouse dihydrofolate reductase gene translocations of domains of nascent periplasmic proteins across the cytoplasmic membrane is independent of elongation extensions of the signal hypothesis-sequential insertion model versus amphipathic tunnel hypothesis. febs (fed. eur protein translocation across and integration into membranes improved plasmid vectors with a thermoinducible expression and temperature-regulated runaway replication nucleotide sequence of the s mrna of sindbis virus and deduced sequence of the encoded virus structural proteins identification of signal sequence binding proteins integrated into the rough endoplasmic reticulum membrane polypeptide chain binding proteins: catalysts of protein folding and related processes in cells synchronized transmembrane insertion and glycosylation of a nascent membrane protein evidence for the loop model of signal-sequence insertion into the endoplasmic reticulum on the translocation of proteins across membranes on the transfer of integral proteins into membranes nascent peptide as sole attachment of polysomes to membranes in bacteria an internal signal sequence: the asialoglycoprotein receptor membrane anchor complete nucleotide sequence of the escherichia coli plasmid pbr subcellular location of enzymes involved in the n-glycosylation and processing of asparagine-linked oligosaccbarides in saccharomyces cerevisiae structural and thermodynamic aspects of the transfer of proteins into and across membranes trans-membrane translocation of proteins: the direct transfer model insertion of a multispanning membrane protein occurs sequentially and requires only one signal sequence multiple mechanisms of protein insertion into and across membranes a signal sequence receptor in the endoplasmic reticulum membrane constraint of the translational diffusion of a membrane glycoprotein by its external domains the transmembrahe segment of the human transferrin receptor functions as a signal peptide we thank ernst bause for constructive discussion; gunnar von heijne and michael baron for critical reading of the manuscript; johanna wahlberg for help with the figures; margareta berg, tuula marminen, and elisabeth servin for technical assistance; and ingrid sigurdson for typing. this work was supported by grants from the swedish medical research council (b - x- - a), swedish natural science research council (b-bu - ), and swedish national board for technical development ( - p).received for publication march and in revised form may . key: cord- - vofftmj authors: everitt, j i; richter, c b title: infectious diseases of the upper respiratory tract: implications for toxicology studies. date: - - journal: environ health perspect doi: nan sha: doc_id: cord_uid: vofftmj the consequences of adventitious infectious agents upon the interpretation of toxicology studies performed in rats and mice are incompletely understood. several prevalent murine pathogens cause alterations of the respiratory system that can confuse the assessment of chemically induced airway injury. in some instances the pathogenesis of infection with these agents has been relatively well studied in the lower respiratory tract. however, there are few well-controlled studies that have examined the upper respiratory region, which result in interpretive problems for toxicologic pathologists. the conduct and interpretation of both short-term and chronic rodent bioassays can be compromised by both the clinical and subclinical manifestations of infectious diseases. this paper reviews several important infectious diseases of the upper airway of rats and mice and discusses the potential influence of these conditions on the results of toxicology studies. the validity and reproducibility of rodent toxicology studies depend, in part, on the interaction of numerous environmental, microbial, and genetic factors. control of important animal and extrinsic factors forms the basis of laboratory animal science programs in toxicology. despite numerous advances and sophistication in the field of laboratory animal medicine, adventitious murine microbial agents continue to pose a threat to both shortand long-term studies that use rats and mice. programs for prevention, detection, elimination, and control of rodent infectious agents are necessary in toxicology research and testing. these programs are of particular importance to both toxicologists and pathologists responsible for conducting and interpreting rodent bioassays. specific procedures and equipment used in inhalation toxicity experiments can contribute significantly to the spread of disease and the interaction of infectious agents with inhaled toxicants. many factors, such as inhalation caging; cage rotation schemes; inhalation chamber microenvironments; food and water deprivation during exposures; and stresses from crowding, frequent handling, and servicing of animals, all play important roles in the interplay between pathogen and chemical exposure. the complications of rodent infectious agents to toxicology research and testing has been the subject of increasing awareness and review ( , ) . recent rodent serology surveys indicate that sialodacryoadenitis virus (sdav), sendai virus, and mycoplasrna pulmonis are three of the most prevalent murine pathogens ( ) . all three agents cause significant rodent respiratory disease, with lesions in the upper airways, including the nasal passages. in addition to being a common site for microbial-induced disease, the upper respiratory tract is a target organ of chemically induced injury. this paper will review the respiratory pathology of several important murine pathogens and discuss their importance in toxicology and carcinogenicity studies. sialodacryoadenitis virus is a common, highly infectious coronavirus affecting rats and causing a selflimiting necrosis and inflammation of mixed or serous salivary glands, lacrimal glands, and upper airway epithelium ( , ) . respiratory tract lesions are generally confined to the upper airway and usually precede the inflammatory changes that occur in the exocrine tissues of the head ( ). gross lesions consisting of edematous and/or inflammatory changes are sometimes noted in extrarespiratory tissue in mixed or serous salivary glands, exorbital lacrimal glands, harderian glands, periglandular connective tissue, cervical lymph nodes, or the thymus. everi t and richter microscopic lesions in experimental sdav infection begin in the nasal respiratory epithelium approximately hr postinfection. initial respiratory epithelial necrosis accompanied by congestion and edema is rapidly followed by a mixed inflammatory cell infiltrate of the lamina propria. necrosis primarily occurs in the respiratory epithelium lining the ventral turbinates and lateral wall of the nasal cavity but usually spares the olfactory mucosa. the nasal meatuses may be filled with exudate composed of necrotic epithelial cells admixed with inflammatory cells and mucus. serous mucosal glands of the nasopharynx generally sustain relatively mild injury ( ) , although necrosis of ducts and acini does occur. lesions similar to those in the nasopharynx, but milder and less uniform, are found in the trachea. the rhinotracheitis of sdav is usually self-limiting and it is resolved by the end of the second week of infection ( ) . although not as prevalent or as severe as upper respiratory tract lesions, microscopic changes do occur in the lower respiratory tract in experimental infections of rats ( ), consisting of focal nonsuppurative bronchiolitis and peribronchial lymphocytic infiltration. although sdav infection is generally a self-limiting disease without significant mortality, it can cause marked effects on toxicology studies through clinical disease or subclinical manifestations. rats with sdav infection often have reduced food consumption, weight loss, and reduced breeding performance all of which can affect toxicology studies. the interactions of sdav with other respiratory pathogens and chemical agents is not well established. recent experimental evidence suggests that sdav infection depletes salivary epidermal growth factor (egf) and may thereby affect egfdependent cell growth processes and experimental carcinogenesis studies in rats ( ) . results of a -year inhalation toxicity study of methylene chloride were clouded by sdav infection of rats early in the study ( ) . in this study, a low number of male rats exposed to the two highest doses of the chemical had an increased incidence of sarcomas in the ventral neck region. the relevance and toxicological significance of these neoplasms was questionable because the species and sex specificity of the response was inconsistent with the body of knowledge on the toxicity of the chemical. it was postulated that the tumor response may have been due to a combination of viral infection and exposure to high concentrations of methylene chloride. this case exemplifies the problems that may occur in toxicologic studies when unusual and unexpected lesions are found in animals that had infectious processes within the target organ of toxicity. sendai virus is a very common respiratory pathogen of laboratory rodents that has complicated numerous toxicology and carcinogenicity studies ( ) . in mice and rats, this paramyxovirus causes clinical and subclinical changes with great strain variability in disease expression and resultant pathologic lesions. the virus has a marked tropism for the respiratory tract, including the nasal cavity. sendai virus infection has been well described for mice ( ) ( ) ( ) , and recently the course of experimental infection in the rat has been reported ( ) . sendai virus infection causes rhinitis, tracheobronchitis, bronchiolitis, and varying degrees of alveolitis in both rats and mice. there is marked strain variability in qualitative, quantitative, and chronological aspects oflesion development, which causes difficulty in making generlizations regardingthe pathology ofthe respiratory tract. although there are many excellent descriptive studies ofthe histogenesis of sendai virus-induced lesions within the lower respiratory tract, few pathology reports include a description of lesions in the nasal cavity and upper airway. nasal lesions have been well described in experimental infections of the sprague-dawley rat ( ) . in this model, a rapid development of severe rhinitis with marked infiltration of the epithelium and lamina propria with lymphocytes and some neutrophils occurred at day postinfection. lesions were most severe in the respiratory epithelium of the naso-and maxilloturbinates, compared to minimal lesions in the olfactory epithelium of the ethmoid region. over the next days postinfection, there was a progressive accumulation of inflammatory cells, chiefly of lymphocytes, in the lamina propria. the lesions expanded to involve the middle portions of the nasal septum. respiratory epithelial cells exhibited pyknosis and karyorrhexis, particularly in the more basilar regions of the mucosa. exudate was noted in the ethmoid region, although there was little inflammation in that area. between and days postinfection, the severity of the nasal epithelial necrosis, inflammatory cell infiltrate, and lumenal exudate decreased. by day postinfection, no discernable lesions were noted in experimentally infected rats. there are numerous systemic effects (thble ) that toxicologists and pathologists need to consider when interpreting the impact of sendai virus infection upon study results ( , ) . studies can be compromised through reduction in animal numbers, changes in immune function, xenobiotic metabolism, and physiology ( ) . sendai virus infection has altered the course of chemically induced pulmonary carcinogenesis in strain a mice by reducing the number of resultant lung tumors ( ) . in addition, the pulmonary carcinogenic responses have been altered in sendai virus infected balb/c mice following exposure to urethane ( murine respiratory mycoplasmosis (mrm), due to mycoplasrna pulmonis is a naturally occurring, slowly progressing, chronic disease in rats and mice. numerous respiratory responses are associated with m. pulmonis infection of rodents (table ) ( ) . the prevalence of the pathogen and the numerous respiratory and systemic effects of infection make this disease one of the most important entities for pathologists and toxicologists during studies of the respiratory tract. respiratory mycoplasmosis is often clinically silent, although lesions of the upper respiratory tract commonly occur ( ) . the principal lesions of mrm in rats include rhinitis, otitis media, laryngitis, and tracheitis ( ) . gross lesions in the upper respiratory tract are generally not discernable, although rats may occasionally show mucopurulent nasal exudate and/or porphyrin-tinted oculonasal discharge. the microscopic pathology of mrm is characterized by epithelial changes including cellular hypertrophy and hyperplasia, as well as metaplastic changes. neutrophilic exudation and lymphoplasmacytic infiltrates are common throughout the upper airway. subepithelial lymphoid accumulations can occur in mrm-associated rhinitis (plates and ). ciliary loss and epithelial hyperplasias can be severe and quite extensive. the relative importance of direct mycoplasmal damage, as opposed to immune and nonimmune inflammatory reactions form. pulmonwn has yet to be completely discerned ( ) . it is known that cytolysis follows attachment of m. pulmonis to upper airway epithelial cells. ciliastasis, loss of cilia, distension of intercellular spaces, cytoplasmic vacuolization, disruption of mitochondria, epithelial hyperplasia and metaplasia, and syncytial cell formation have also resulted following attachment of this organism ( ) . the tympanic cavity of the ear may be completely filled with a neutrophilic exudate. frequently in mrminduced otitis media, the lining epithelium is hyperplastic and the lumenal cavity may become filled with collagenous connective tissue. thickened connective tissue lining the tympanic cavity may remain as a chronic sequellum of the infection. epithelial hyperplasias and lymphoid cell accumulations are commonly found in the certain chemical agents, including ammonia, which is commonly found in the cage environment from soiled bedding, can exacerbate mrm in rats. inhalation of the important industrial compound hexamethylphosphoramide (hmpa) can cause a synergistic enhancement of the progression and severity of mrm ( , ) . in hmpa toxicity studies, nasal tumors, rhinitis, nasal epithelial degeneration, metaplasia, and dysplasia were noted in cornunction with an enhanced mortality from chronic pneumonia in infected rats. the increased mortality was possibly due to a chemically induced destruction of the mucociliary apparatus in the upper airway, which may have contributed to fatal lower respiratory infections. a chronic inhalation bioassay of propylene oxide revealed dose-dependent nasal epithelial proliferative lesions and two nasal adenomas in rats with intercurrent mrm ( ) . the significance of the proliferative nasal lesions, which appeared to be treatment related, was difficult to interpret, since their development may have been influenced by intercurrent infectious inflammatory disease. although numerous bacteria can infect the upper airway of the rat and mouse, they are not generally prevalent in well-conducted toxicology studies begun with animals free of adventitious murine pathogens and maintained with modern methods of laboratory animal husbandry. however, the cilia-associated respiratory (car) bacillus has recently received attention. this gramnegative, filamentous, rod-shaped bacillus ( , ) infects both rats and mice and causes lesions morphologically similar to those of m. pulmonis infections. the car bacillus was generally overlooked in the past because it often occurred as a dual infection with m. pulmonis. lesions typical of mycoplasmal chronic respiratory disease have been noted following natural and experimental infection with the car bacillus. these lesions include massive accumulations of predominantly mononuclear inflammatory cells surrounding bronchi and bronchioles (plate ), as well as various degrees of suppurative bronchopneumonia, squamous metaplasia, and bronchiectasis. the ciliated epithelium of the airway is usually heavily colonized with filamentous bacteria, which can be readily demonstrated with warthin-starry silver impregnation techniques (plate ). little is known regarding the prevalence of this organism as a subclinical infection. although lesions induced by the car bacillus have been described in the lungs of both rats and mice, there have been no descriptions of pathology in the upper airway where, presumably, the organism can also grow. elucidation of the significance of this pathogen for rodent toxicity awaits further studies and characterization. descriptions of naturally occurring fungal infections of the respiratory tract of rodents are extremely rare. the histological features of fungal rhinitis, which occurred in high incidence in two separate chronic carcinogenicity studies in male wistar rats ( / animals), have been described ( ) . since these animals had titers to both sendai and sdav viruses, the authors suggested that viral-induced inflammation of the upper respiratory mucosa rendered the epithelium susceptible to the fungal infection. in addition to the animals with fungal infection, animals had suppurative rhinitis without evident fungal growth. an etiologic diagnosis ofaspergillusfumigatus was based upon characteristic morphology of the fruiting heads found in a small percentage of cases. aspergillus rhinitis was generally noninvasive and limited to the naso-and maxilloturbinates. although purulent inflammation was noted in the olfactory epithelium of some cases, fungal growth was rarely noted in this region. hyphal conglomerates were usually associated with foreign bodies (hair and plant material) and were surrounded by polymorphonuclear leukocytes, bacteria, debris, and nasal secretions. the underlying respiratory epithelium was usually hyperplastic, hypertrophic, or revealed squamous metaplasia. subepithelial connective tissue and submucosal glands were often infiltrated by aggregates of lymphocytes, plasma cells, and neutrophils. a relatively small number of cases had epithelial necrosis associated with fungal invasion. a review of cases of fungal rhinitis in the national tbxicology program (ntp) archives revealed the occurrence of fungal rhinitis in eight bioassays. in the affected studies that encompassed animals that were both serologically negative as well as some bearing viral titers, cases occurred in both sexes of fischer rats in relatively low incidence (up to % of a dose group). a few scattered cases were noted in b c f mice. the histologic appearance (plates and ) was identical to that described in the literature in the wistar rat. in the affected bioassays the chemical was administered by inhalation, feed, or gavage in several different laboratories. foreign material was noted in most of the cases suggesting that particles from food or elsewhere may serve as local irritants and carriers for the fungus. one of the principal ways in which infectious diseases complicate toxicologic studies is by interference with the interpretation of the pathology data. in addition to alterations in the morphologic appearance of target organs, there can be changes in clinical signs of toxicity, food consumption, body weight gain, hematology, urinalysis, and serum chemistry parameters ( ) . body weight gain depression of greater than % is often considered to be a sign of toxicity in treated groups of animals. the combined effects of infection and treatment influence food consumption and body weight gain to a greater extent than infection or chemical treatment alone. this synergism can confound data interpretation ( ) . it has recently become apparent that infectious agents can markedly affect the metabolism of foreign compounds by impairing hepatic mixed-function monoxygenases (cytochrome p- -dependent monoxygenase system) ( ) . alteration of xenobiotic metabolism has important ramifications for toxicologists who administer compounds that are subject to bioactivation and biotransformation. the mechanistic basis for the microbialinduced inhibition of biotransformation has not yet been completely elucidated. it appears that interferon induction as a result of infection can act as a mediator in depressing p- , and it may have a direct action on the hemoprotein itself ( ) . many of the important murine viral agents including sendai virus are potent inducers of interferon ( ) . infectious diseases can also modulate hepatic cytochrome p- by effects on the reticuloendothelial system. furthermore, microbial agents that perturb kupffer cells decrease drug biotransformation activity ( ) . effects on nonhepatic xenobiotic metabolism by infectious agents have received little attention. several upper respiratory viral infections in man, including rhinoviruses and influenza viruses, are known to impair drug biotransformations by affecting the cytochrome p- system ( ) . similar viral effects have been demonstrated in pr influenza-infected mice ( ) . mice infected with this virus have significantly decreased pulmonary benzo[a]pyrene hydroxylase activity. nasal cytochrome p- -dependent monooxygenases may be extremely important in the bioactivation and biotransformation of inhaled xenobiotics. in most species, the nasal olfactory concentration of these enzymes is second only to that found in the liver ( ) . mouse hepatitis virus, a common mouse coronavirus infection, is reported to depress hepatic p- levels ( ) . strains of this pathogen cause nasal cavity infections with necrotizing lesions in the olfactory mucosa ( ) . it is therefore possible that extrahepatic alterations of p- may result and be of importance to toxicology studies. in addition to alterations of xenobiotic metabolism, infectious diseases cause other cellular effects that can modulate toxic and carcinogenic responses. the association between enhanced cell replication and cancer induction has gained the interests of many toxicologists ( ) . gross and co-workers found that sites of cell replication correlated well with sites of tumor induction in the nasal cavities from rats exposed to formaldehyde in acute and chronic inhalation studies ( ) . although it is uncertain how enhanced cell replication affects the carcinogenic process, such correlations suggest that a cause and effect relationship may exist. infectious diseases that cause epithelial necrosis and repair lead to significant alterations in cell turnover. microbial agents such as m. pulmonis are known to cause significant alterations in cell cycle kinetics in populations of upper airway epithelial cells ( ) . this clearly has profound implications for carcinogenesis studies in which cell turnover may be an important contributing factor in the multistage process. not only would the microbial infection and degree of cell turnover be important, but the chronology of the infection with regard to the chemical administration could prove critical. a variety of important microbial pathogens including viruses, mycoplasmas, bacteria, and fungi infect the upper respiratory tract of the mouse and rat and result in significant pathologic alterations. the rodent upper respiratory tract may also be an important target organ in chronic bioassays. lbxicologists and pathologists need to understand the etiopathogenesis of common pathogen-related diseases in the murine respiratory tract, so that the effects of natural disease processes may be separated from chemically induced injury. additional studies are needed to assess the impact of several of the more prevalent adventitious pathogens on the results of rodent bioassays. the examination of the rodent nasal cavity has been overlooked in many previous experimental models of murine infectious disease. descriptive pathology studies, which carefully examine the histogenesis of upper airway injury, are warranted for many of the common pathogens that complicate toxicology studies. in addition, the effects of murine infectious diseases on xenobiotic metabolism and cytokinetics in the upper airway should be further investigated. the authors wish to thank j. griffith for slides of car bacillus. viral and mycoplasmal infections of laboratory rodents: effects on biomedical research complications of viral and mycoplasmal infections in rodents to toxicology research and testing prevalence of pathogenic murine viruses and mycoplasma that are currently a problem to research biology and diseases of rats pathogenesis of sialodacryoadenitis in gnotobiotic rats sialodacyoadenitis virus infection, upper respiratory tract, rat comparison of strain susceptibility to experimental sialodacryoadenitis in rats effects of sialodacryoadenitis virus on experimental carcinogenesis in the rat (abstract) methylene chloride: a two-year inhalation toxicity and oncogenicity study in rats and hamsters sendai virus-disease processes and research complications the pathogenesis of sendai virus infection in the mouse lung susceptibility of inbred and outbred mouse strains to sendai virus and prevalence of infection in laboratory rodents naturally occurring sendai virus infection of athymic nude mice experimental sendai virus infection in laboratory rats ii. pathology and immunohistochemistry sendai virus influence of sendai virus on carcinogenesis in strain a mice respiratory infections and the pathogenesis of lung cancer. recent results cancer res mycoplasmal infections: disease pathogenesis, implications for biomedical research, and control the pathogenic potential of mycoplasmas: mycoplasma pulmonis as a model murine respiratory mycoplasmosis, upper respiratory tract, rat enhancement of natural and experimental respiratory mycoplasmosis in rats by hexamethylphosphoramide pulmonary response to inhaled hexamethylphosphoramide in rats y carcinogenic and toxicologic effects of inhaled ethylene oxide and propylene oxide in f rats isolation, propagation, and characterization of a newly recognized pathogen, cilia-associated respiratory bacillus of rats, an etiological agent of chronic respiratory disease cilia-associated respiratory (car) bacillus infection of obese mice aspergillus rhinitis in wistar (crl:(wi)br) rats toxicology: complications caused by murine viruses and mycoplasmas the influence of infection on the metabolism of foreign compounds the effect of cyclophosphamide on sendai virus infection of mice effect of pr- viral respiratory infection on benzo possible consequences of cytochrome p- -dependent monooxygenases in nasal tissues research complications and state of knowledge of rodent coronaviruses mouse hepatitis s in weanling mice following intranasal inoculation the value of measuring cell replication as a predictive index of tissuespecific tumorigenic potential formaldehydeinduced neoplasia, acute toxic responses and cell turnover in the nasal passages of f- rats (abstract) the kinetics of cell proliferation in the tracheobronchial epithelia of rats with and without chronic respiratory disease photomicrograph of the nasal cavity from a f rat with aspergillus rhinitis. the respiratory epithelium has early squamous metaplasia. a diffuse inflammatory infiltrate is present in the underlying lamina propria. the nasal cavity is filled with debris and polymorphonuclear leukocytes plate . fungal hyphae within nasal cavity debris of f rat with aspergillus rhinitis. gomori-methenamine silver key: cord- -ht ry i authors: nan title: sorting within the regulated secretory pathway occurs in the trans- golgi network date: - - journal: j cell biol doi: nan sha: doc_id: cord_uid: ht ry i bioactive peptides cleaved from the egg-laying hormone precursor in the bag cell neurons of aplysia are sorted into distinct dense core vesicle classes (dcvs). bag cell prohormone processing can be divided into two stages, an initial cleavage occurring in a late golgi compartment, which is not blocked by monensin, and later cleavages that occur within dcvs and are blocked by monensin. prohormone intermediates are sorted in the trans-golgi network. the large soma-specific dcvs turn over, while the small dcvs are transported to processes for regulated release. thus, protein trafficking differentially regulates the levels and localization of multiple biologically active peptides derived from a common prohormone. . abbreviations used in thispaper: asw, artificial sea water; dcv, dense core vesicles; elh, egg-laying hormone; hd, half-distance; ile, isoleucine; phe, phenylalanine; tgn, trans-golgi network. et al., ) . while the mechanism of this sorting is still anknown, proposals have been made both for an aggregation event whereby the condensation of neuropeptides excludes other proteins from the forming dcv (kelly, ) , and a receptor-mediated sorting event (burgess and kelly, ; pfeffer and rothman, ; chung et al., ) analogous to lysosomal sorting where a specific signal (mannose- phosphate) targets proteins through a recycling receptor (griffiths et al., ) . sorting within the regulated secretory pathway has recently been demonstrated both in somatomammotrophs (fumagalli and zanini, ; hashimoto et al., ) and in the bag cell neurons of aplysia californica . in the bag cells, different products of the egg-laying hormone (elh) precursor are localized to separate classes of dcvs. peptides from the carboxy-terminal side of the elh precursor are found in a class of small dcvs which are rapidly transported to the neuronal processes, while peptides from the amino-terminal side of the precursor are found both in a class of large dcvs that are restricted to the cell body and a distinct class of small dcvs which are transported to processes (fig. ) . this sorting event has important physiological consequences as the different regions of the elh prohormone contain peptides with unique biological activities (kupfermann, ; rothman et al., a,b; mayeri et al., ; kauer et al., ; brown and mayeri, ) . in this paper, we investigate the cellular pathway of protein trafficking within the bag cells using em autoradiography and the carboxylic acid ionophore monensin. the bag cells have two features that facilitate these studies; (a) the elh prohormone is the major protein produced by the bag cells and accounts for up to % of the translated protein (berry and arch, ; scheller et al., ) ; (b) an asymmetric distribution of amino acids across the prohormone fig. ) allows the selective labeling of the sorted carboxy or amino terminal-derived peptides. in this study, we use these properties to selectively follow the flow of neuropeptides derived from the elh precursor through the secretory pathway. the results suggest possible mechanisms that underlie sorting within the regulated secretory pathway. - -g aplysia were obtained from sea life supply (sand city, ca). bag ceil clusters were isolated and equilibrated in artificial sea water (asw; mm naci, mm kci, mm mgci , mm mgso , mm caci , and mm tris, ph . ) at °c for rain. the clusters were then incubated in isoleucine ([ h] ile) or l-[ , , , , - h]phenylalanine ([ h]-phe)(amersham corp., arlington heights, il) ( mci/ml for a -rain pulse; mci/mi for a -rain pulse) for either or min and then chased with asw plus mm phe, asw plus mm ile, or isotonic li plus mm phe for the -h chase at °c. the chase was stopped by placing the clusters into a fixation solution consisting of % glutaraldehyde, % paraformaldehyde, % dmso, . m sucrose in pbs ( . m nac , . mm kci, mm na po , . mm kh po , ph . ). occasionally, % acrolein was also included in the fixation solution. the tissue was fixed for - h at room temperature (occasionally overnight at °c). the clusters were rinsed with pbs, desheathed, and osmicated with % oso in pbs for h followed by four washes in ddh and an additional h in % aqueous uranyl acetate. the clusters were then step-wise dehydrated to % ethanol followed by propylene oxide before infiltrating and embedding with epon-araldite. after polymerization, thin sections ( - nm) were cut on a microtome (reichert jung, vienna, austria) and collected on formvar-coated nickel grids. the grids were then lead stained, carbon coated, and covered with emulsion l ; ilford ltd., basildon, essex, england) using the loop technique (caro and van tubergen, ; caro, ; williams, ) . the emulsion was exposed in the dark at °c from d to mo depending on the experiment and then developed by incubating in microdol x (eastman kodak co., r~chester, ny; rain), stopped in % acetic acid, fixed with % sodium thiosulfate ( rain), and washed in dvh . grids were then visualized using a transmission electron microscope ( ; philips electronic instruments, inc., mahwah, nj). micrographs were photographed at , x and then printed to give a final magnification of , x. this size was chosen as the smallest magnification that small clear vesicles around the golgi apparatus are clearly visible. pictures were not taken at grid coordinates but rather over concentrations of grains. this was necessary due to the large size of the bag cells ( /~m table i . quantitation of em autoradiography in diameter) and the small area of the cells in which one could find grains. therefore, all results are given in percentage of grains in each compartment rather than density of radioactivity in each compartment. the micrographs were digitized (gp digitizer; science accessories corp., southport, ct) and analyzed using a computer-implemented maximum likelihood algorithm (miller et al., ) . an important parameter in this program is the approximate error due to the spread of radioactivity, which depends on the thickness of the section and the emulsion. we calculated all time points at half-distance (hd) values (saltpeter and bachmann, ) of , , and am. the calculations are fairly insensitive to this parameter, and the data in table i are calculated with an hd of run, as this value matched our estimates for section and emulsion thickness. the largest variations observed at different hd values occur between the cytoplasm, er, and small mature vesicles. all of these compartments have large areas and low densities and are situated in close proximity to each other, making it difficult to asign counts between these compartments. the largest change is seen at the ile -rain pulse plus -h chase time point, when, with an hd of am, the percentage of counts in small mature vesicles and cytoplasm are . and . %, respectively, as opposed to . and . % with an hd of am. all other changes were minor in comparison, and in the compartments important in these studies-small and large immature vesicles, clear vesicles, and golgi apparatus-the results between calculations at three hd values differ by no more than % in any experiment. there were nine compartments entered during digitization of the micrograph (er, golgi apparatus, golgi-associated sacs [usually situated on the cis side of the goigi apparatus], dcvs, immature dcvs, clear vesicles, mitochondria, lysosomes, and nucleus). all nonlabeled parts of the micrographs defaulted to cytoplasm. mature and immature dcvs were then divided into small and large classes using a size cutoff (area = , nm , based on a diameter of nm; fisher et al., ) to make a total of compartments. the areas of labeled (center of at least one grain within the vesicle) and unlabeled large vesicles were also calculated to determine if phe-labeled small immature dcvs gradually increased in size to form large phe-labeled immature dcvs. at the earliest time point that significant radioactivity is observed in large immature vesicles (phe -rain pulse plus rain chase), the average area of labeled large vesicles was actually larger than the average area of unlabeled large vesicles (l. x) and exceeded the cutoff size by a large margin (average diameter = am). immature vesicles were defined by either (a) membrane extensions (bulge or sac; see fig. ); (b) irregularities in shape; (c) extremely ruffled membranes; or (d) connection to a tubule or golgi stack. it is important to note that the percentage of immature vesicles is probably an underestimate, as serial sections through bag cells often reveal sacs on vesicles or connections to tubules that are absent in other sections. for the phe -rain pulse plus % chase experiment, the iysosome compartment was divided into mottled dcvs and clear lysosomes. for all experiments other than phe -rain pulse plus -h chase, the digitization was done blindly without knowledge of the time point or the label used in the experiment. most time points include data from more than one application of emulsion. data was pooled from experiments as long as the average number of grains per micrograph was within %. for the phe -min pulse plus -h chase experiment, results are a weighted average of two different sets of data. the standard deviations in table i are the result of simulation experiments (miller et al., ) to evaluate the error inherent in the quantitation. in these experiments, new grains for each micrograph were generated using the assumptions inherent in the algorithm (a poisson distribution of grains in a compartment and a gaussian error vector between the location of the radioactivity and the center of the simulated grain). the maximum likelihood calculation was then repeated for the simulated grains. five simulations were done for each time point, and the standard deviation of these simulations is presented in table i . in several cases, the original value was not within one standard deviation of the simulation average, although all values were within two standard deviations. this occurred mainly in the small mature and clear vesicle compartments and is probably caused by the inhomogeneity of these compartments. for example, the clear vesicle compartment contains transport vesicles from er to goigi apparatus, from one golgi slack to another, and from golgi apparatus to plasma membrane as well as parts of the tgn, primary lysosomes, and other compartments that cannot be differentiated by morphology. the simulation treats these as homogeneous compartments, while the grains may have been coming from a small subset of these compartments. therefore, the simulations arrive at estimates different from the original computation. the small mature vesicles at early time points are usually found close to the golgi apparatus and thus do not share the distribution of the majority of small mature vesicles, again causing differences between the simulation and the original experiment. other errors, such as sampling bias and digitation errors, are not included in the standard deviations and probably add to the total error in the experiment. it is difficult to quantitate these errors and they are presumed to be minor contributions compared with the errors due to the quantitation procedure. simulations were also used to evaluate the possibility that the high percenlage of grains in clear vesicles resulted from their proximity to both golgi apparatus and small immature vesicles. at three time points (phe rain pulse plus -min chase, ile -min pulse plus -rain chase, and phe -rain pulse plus -rain chase), the counts in clear vesicles were assigned proportionally to golgi apparatus and small immature vesicles, and a total of simulations were carried out with these new densities. in these simulations, the maximum value of counts ever seen over clear vesicles is %, and thus we conclude that the high values seen over this compartment at these time points is not due to their proximity to other compartments that contain radioactivity. one source of concern is the relative incorporation and washout of [ h]ile and [ h]phe. as our results are mainly based on comparing the flow of the different regions of the prohormone, as opposed to comparing the absolute position at a time point, we do not feel that possible differences in incorporation and washout would affect our results. the relatively slow washout of accumulated [ h]phe probably accounts for the difference in absolute timing observed between the experiments with -and -rain pulses of [ h]phe. bag cell clusters were isolated and fixed in % glutaraldehyde, % paraformaldehyde, % dmso, . m sucrose in . m na cacodylate buffer, ph . , for min at °c. the sheath was then dissected from the cluster, and the cluster was washed in . m na acetate, ph , and incubated in . % cytidine monophosphate (sigma chemical co., st. louis, mo) or glycerophosphate (sigma chemical co.) and . % lead nitrate in . m na acelate, ph , for rain at °c (novikoff et al., ) . results were similar for both of the labels, and control preparations without substrate showed no lead precipitate. clusters were washed with . m na cacodylate, ph . , osmicated in % oso in . m na cacodylate, ph . , for h, and then dehydrated and embedded as described above. thin sections ( - nm) were cut and stained with % uranyl acetate followed by lead nitrate before visualization on a transmission electron microscope ( ; philips electronic instruments, inc.). bag cell clusters or atrial gland pieces were incubated in #m monensin (sigma chemical co.) for h in asw with % ethanol at °c. control experiments with asw and % ethanol alone showed no effect on the bag cells. after the -h preincubation, clusters were labeled with tritiated amino acids as described above. all incubations and washes were done in the presence of #m monensin and % etoh or % etoh alone. the clusters were then processed for em immunohistochemistry (fisher et ai., ) , autoradiography (described above), or sds-nrea gels . in the monensin em autoradiography ~periment, quantitation was similar to that already described, but different compartments were used. the compartments measured in the monensin experiment were er, vacuoles, vacuoles with densities, densities in vacuoles, dense core vesicles, mitochondria, iysosomes, nucleus, and cytoplasm. a separate compartment, vacuolar membranes, was calculated in the entry algorithm. as the vacuoles curve through the thickness of the section, a -nm distance was used to define the limit of the membrane in these calculations. also, for quantitating monensin experiments, micrographs were taken at , x magnified to , x. clusters were labeled as described . the gels were quantitated by densitometry of the x-ray film. figure . proteolytic processing of the elh prohormone. a schematic of the -amino acid elh prohormone is shown including a -amino acid signal sequence (horizontal black bars). four biologically active bag cell peptides, the c~,/ , and , bag cell peptides as well as elh, are shaded. vertical bars are sequences of basic residues used as proteolytic processing sites. the first cleavage of the prohormone occurs at a tetrabasic sequence arg-arg-lys-arg, and the pathway then proceeds as shown, leading to the final set of product peptides shown . the peptides amino terminal to the first cleavage are packaged into one set of vesicles, and the peptides carboxy terminal to this cleavage are packaged in a distinct vesicle class. above the schematic are the positions of the peptides used to raise antisera used in immunohistochemical experiments . the top of the figure shows the distribution of the amino acids-leucine (l), isoleucine (i), and phenylalanine (f)-within the prophormone's sequence. elh precursor must occur after the initial cleavage of the prohormone. to determine the intracellular site of various cleavages, we have correlated the extent of prohormone endoproteolytic cleavage with the location of the molecule within the secretory pathway. bag cell clusters were labeled with [ h]ile to label the carboxy-terminal, elh-containing side of the prohormone or [ h]phe to label the aminoterminal, bag cell peptide-containing side of the prohormone. acid acetone extracts were then fractionated on sds-urea polyacrylamide gels (fig. , a , further cleavage of the initial amino-terminal intermediate (f ; fig. a) occurs more slowly than that of the initial carboxy-terminal intermediate ( ; fig. b) . monensin is an ionophore that blocks the proteolytic cleavage of a number of neuropeptide prohormones and causes them to accumulate in golgi-related compartments (crine and dufour, ; orci et al., ) . presumably, the cleavage is inhibited either by blocking transport of the hormone to the site of cleavage or by disrupting necessary ionic gradients. in contrast to other systems, initial cleavage of the elh prohormone still occurs after a monensin block; however, all subsequent cleavages are inhibited, and the two initial processing intermediates accumulate in monensin-treated cells (fig. c) (yates and berry, ) . this is not a peculiar effect of monensin in aplysia tissue, as all cleavages of the atrial gland prohormone are blocked after incubation with monensin ( fig. c) . therefore monensin divides elh processing into two distinct steps: the initial cleavage, which occurs before the monensin block, and all subsequent cleavages. to identify the site of the monensin block, we examined monensin-treated bag cells in the electron microscope. as in other systems, monensin causes a specific enlargement of golgi-related compartments while leaving other cellular compartments such as the nucleus, er, mitochondria, lysosomes, and mature dcvs relatively unchanged (tartakoff, ) . in the bag cells, some of these vacuoles contain dense core material, and these can be divided into two general types: (a) vacuoles with densities that are homogeneous in appearance ( %) and (b) vacuoles that contain two different types of densities ( %; fig. a) . examination of the densities with immunoelectron microscopy reveal thathomogeneous dense cores contain intermixed carboxy-terminal (elh) and amino-terminal (peptide k) immunoreactivity, but, as illustrated in fig. b, when two separate densities - ) . the clusters were then extracted with acid acetone and fractionated on sds-urea gels. (neweomb et al., ) . the bands are marked according to the nomenclature outlined in fig. . the initial cleavage is occurring at the -min chase and is complete after h. (c) after pretreatment for h with /~m monensin plus % etoh (lanes and ) or asw plus % etoh (lanes and ), bag cell clusters (lanes i and ) or atrial gland fragments ( mm x mm; lanes and ) were pulsed for h with [ h]leucine and chased for h (bag cells) or h (atri .al glands) before acid acetone extraction. under these conditions, the initial cleavage of the bag cell prohormone is completed in monensin, but all further cleavages of the intermediates are blocked (lane ). in contrast, the atrial gland precursor accumulates in monensintreated cells (lane ). other bag cell clusters labeled with [ h]leucine were assessed by hplc analysis (newcomb and scheller, ) , and all radioactivity was found in the first intermediates, demonstrating more conclusively that no further cleavages of the f or intermediate occur in the monensin experiment (data not shown). are observed the immunoreactivity of the different dense cores is segregated. to demonstrate that these densities actually represent the site of blockage, the monensin-treated bag cells were pulse chased with either [ h]leu, [ h]phe, or [ h]ile and processed for em autoradiography. as evident in fig. monensin blocks transport at various sites in different systems but almost always blocks transport somewhere within the golgi apparatus (gritliths et al., ; johnson and schlessinger, ; orci et al., ) . osmium, a specific marker for the cis-golgi compartment (friend and murray, ) , labels a subset of vacuoles but does not label vacuoles that contain densities (data not shown), suggesting the monensin block is beyond this point in the secretory pathway. the presence of sorted densities suggests that segregation occurs at this stage of prohormone processing and that the intermediates may have intrinsic abilities to aggregate selectively. these results must be interpreted cautiously as the disruption of ionic and ph gradients in monensin-treated cells may cause perturbations in the sorting process. in pulse-chase studies using either ph]ile (carboxy-terminal) or [ h]phe (amino-terminal), counts flow through the secretory pathway from er to golgi apparatus to granules (table i) . after a -min pulse with phllle, a large number of grains are seen over the golgi apparatus ( fig. a and table i). since at this time point no processing has occurred (fig. b) , one can conclude that cleavage does not occur early in the golgi apparatus. both amino and carboxy terminal-associated radioactivity are transported through the golgi stacks and enter small immature dcvs (defined by membrane extensions, connection to tubules, or nonspherical morphology) and clear vesicles after a -min pulse and -min chase (fig. b, fig. , and table i ). this is the time point correlated with the initial cleavage of the prohormone (fig. , a and b) . after a -min pulse and -h chase with [ h]phe, grains are found predominantly over large immature dcvs (fig. c, fig. , and table i) , while grains are found predominantly over small immature dcvs at this time point when [ h]ile is used (fig. d, fig. , and table i ). therefore, we can conclude that after a -min pulse and -h chase, the two regions of the elh prohormone have been sorted into distinct compartments. the em autoradiographic results are a strong independent confirmation of immunohistochemical studies demonstrating that large dcvs contain more immunoreactivity from amino terminal-derived (phe) peptides, while the majority of small dcvs contain more immunoreactivity from carboxy terminal-derived (lie) peptides kreiner et al., ) . to look more closely at the movement of the aminoterminal intermediate from small to large immature vesicles, a number of experiments were done using -min pulses of [ h]phe (table i ). the movement from small to large dcvs occurs quickly (largely between and min of chase), and a large percentage of counts are also seen in clear vesicles at these time points. the vectorial flow of the amino-terminal portion of the precursor appears to be from golgi apparatus to clear vesicles and small immature dcvs then to large immature dcvs. the flow of the amino-terminal intermediate from small to large immature vesicles could arise by (a) distinct aminoterminal specific small vesicles increasing in size or (b) movement of the amino-terminal intermediate from small immature vesicles containing carboxy-terminal intermediates to a distinct class of large immature vesicles. we favor the second possibility due to the fact that we do not see a gradual increase in the size of phe-labeled immature vesicles the bag cell soma, some of which contain dense cores. the small and large arrows identify two dense cores within a single vacuole that appear to be of different composition. about - % of the densities in vacuoles had this appearance. (b) immunoelectron microscopic analysis of monensin-treated bag cells. bag cell sections were labeled with a rabbit anti-peptide k and a rat anti-elh primary antibody followed by a -nm colloidal gold anti-rabbit and -nm colloidal gold anti-rat secondary antibodies. immunoreactivity within the dense cores is segregated; the small arrow points to peptide k immunoreactivity, and the large arrow points to elh immunoreaetivity. (see materials and methods) but do observe an abrupt change from small to large phe-labeled vesicles. furthermore, small immature vesicles containing amino-terminal peptides that are contiguous with the golgi apparatus are not observed, although carboxy-terminal peptide immunoreactive small immature vesicles are detected . it is possible that features of immature vesicles may result from their association with the tgn. a standard marker for the tgn is acid phosphatase (grifiiths and simons, ) , and, as illustrated in fig. , a-c, both small and large immature vesicle membranes are ringed by the lead phosphate reaction product. immature vesicles have also been shown to contain acid phosphatase in a number of other systems (smith and farquhar, ; novikoff et al., ; hand and oliver, ) . fig. , a-c, shows a series of micrographs from a set of serial sections; the structure marked by the small arrow actually attaches to the proximal large immature vesicle (fig. a) and in the next section attaches to a small immature vesicle (fig. b) . many other attachments between acid phosphatase-containing vesicles are seen in serial sections, suggesting that the immature vesicles are to some extent still connected to the tubular portion of the tgn. mature small and large vesicles, as well as er and other golgi stacks, do not stain with acid phosphatase, while lysosomes stain intensely. double label experiments which combine em autoradiography with acid phosphatase treatment formally demonstrate that the immature dcvs contain acid phosphatase activity (fig. d) and are therefore part of the tgn. interestingly, one of the large vesicles in this micrograph contains only patches of acid phosphatase reaction product. this is a common occurrence and suggests that the acid phosphatase is removed in patches from immature vesicles, as opposed to gradually fading in intensity. acid phosphatase is an enzyme destined for transport to endosomes and lysosomes. the appearance of acid phosphatase reaction product in patches suggests that lysosomal proteins are removed, not only from clear regions of the tgn, the journal of cell biology, volume i , but also from membranes of immature vesicles. immature vesicles often contain patches of clathrin, although the function of this clathrin is unclear. this clathrin has been proposed to be involved in the budding of regulated secretory vesicles (orci et al., (orci et al., , or recycling of protein from immature vesicles to the golgi apparatus (tooze and tooze, ) . lysosomal enzymes are most probably removed via clathrin-coated vesicles from the tgn (campbell and rome, ; grifliths and simons, ; von figura and hasilik, ) , suggesting that the function of clathrin patches on immature vesicles may be to facilitate sorting of lysosomal proteins. the above results suggest that sorting occurs as the aminoterminal intermediate moves from small immature vesicles and clear vesicles to large immature vesicles, all of which are defined by acid phosphatase cytochemistry as part of the tgn. furthermore, we have demonstrated the site ofprohormone cleavage to be the clear vesicles, small immature vesicles, or golgi stacks. yet, at a time when the prohormone is intact ( -min pulse; fig. b) , counts are located within the golgi stacks (fig. a) , suggesting that the cleavage of the prohormone must occur after this point, either in a late golgi stack or, more likely, the tgn. (table i) quantitative hplc studies indicate that the carboxyterminal (ile) final product peptides are present at three-to eightfold higher steady-state levels than the amino-terminal (phe) final peptides ( fig. ; fisher et al., ) . the large dcvs are not transported to the processes (kreiner et al., ) and quantitative immunoelectron microscopy studies suggest that the different levels of peptides could be due to the selective degradation or release of these large vesicles . to examine this question we chased [ h]phe-labeled bag cell clusters for longer times to observe the eventual fate of the large dcvs. after h of chase, many grains are observed in vesicles with heterogeneous cores that we refer to as mottled dcvs (table i) . the appearance of the core is quite variable, ranging from vesicles that are mostly clear but contained patches of dense material (fig. a) to dense dcvs with nonhomogeneous patches (fig. b) . loss of the homogeneous dense core suggests the peptides are being degraded. few grains are observed over large membranous lysosomes or multivesicular bodies. other interesting results from this time point include the movement of grains from immature to mature large vesicles and an increase in the number of grains in small mature vesicles (table i). coupled with the lack of constitutive release of large vesicle contents (fisher, j., unpublished data) , these results suggest that the asymmetry in peptide steady-state levels is generated through a degradative pathway. our results suggest a model for sorting within the regulated secretory pathway (fig. ) . correlating a biochemical assay of processing with em autoradiography predicts cleavage of the elh prohormone in a late golgi compartment. further support for this model comes from subcellular fractionation studies of bag cells, where the initial cleavage is shown to occur in a light fraction enriched in mannosidase ii activity (a golgi marker) and well separated from the dcvs (sweet, a., j. m. fisher, w. s. sossin, r. newcomb, and r. h. scheller, manuscript submitted for publication). the initial cleavage is not blocked by monensin, which does block the formation of mature granules. the protease that cleaves the tetrabasic site may be a tgn resident protein whose activity triggers the condensation and sorting of the processing intermediates in this compartment. alternatively, processing enzymes with different ph activation profiles or different affinities for the various cleavage sites may explain the distinct subcellular sites of endoproteolytic cleavage in the bag cells. multiple enzymes with different ph profiles have been proposed to differentiate between the two cleavages of the insulin precursor (davidson et al., ) . after the initial cleavage event, the elh-containing carboxy-terminal intermediate condenses in one region of the tgn (small immature vesicles) and the amino-terminal bag cell peptide-containing intermediate condenses in another region of the tgn (large immature vesicles). this model is consistent with immunocytochemical studies that demonstrate that small immature vesicles connected to the tgn contain largely carboxy-terminal immunoreactivity. these regions of the tgn may be connected by tubules, or transport between them may occur through vesicles. how are these intermediates segregated before formation of a dense core? after a -min chase both amino and carboxy terminal-associated grains are found over small imma- schematic diagram for prohormone processing and sorting in the bag ceils is described fully in discussion. a solid line represents the carboxyterminal intermediate; a dotted line represents the amino-terminal intermediate; a dotted line attached to a solid line represents the elh prohormone; smaller lines represent the carboxy-terminal final product peptides; and dots represent the amino-terminal final product peptides. l indicates an organelle of degradative function (endosome or lysosome). direct connection between the part of the tgn containing large immature vesicles and small immature vesicles is putative and this is represented by a dotted line. shading represents acid phosphatase-positive membranes. the small amino-and carboxy-terminal vesicles will be transported to processes for regulated release, where they are present at a carboxy-toamino terminal ratio of : . ture vesicles and clear vesicles. although the compartment of clear vesicles is obviously heterogeneous, the location and the time course of counts moving into these vesicles is most consistent with their arising from sections through the tgn. the lack of grains located over clear vesicles in other em autoradiographic studies of neuropeptide transport (saltpeter and farquhar, ) may be due to an earlier peptide condensation event in that system. amino terminal-associated radioactivity then decreases in clear vesicles and small immature granules and increases in large immature granules. it is the selective movement of the amino-terminal intermediate to large immature granules and/or the selective retention of the carboxy-terminal intermediate in small immature granules that underlies sorting within the regulated pathway. these results suggest a flow of the amino-terminal intermediate through the tgn from an early region that conrains small immature vesicles to a later region that contains large immature vesicles. later cleavages occur in vesicles after leaving the tgn, presumably due to activation of enzymes by the acidification of this granule (orci et al., ; anderson and orci, ) ; these cleavages are blocked by monensin. we propose that the small amino terminal-containing vesicles that are transported to processes arise from the larger immature vesicles, although the evidence supporting this idea is not yet conclusive. in support of this idea, a higher proportion of processing intermediate immunoreactivity is found in the large vesicles (kreiner et al., ) . furthermore, in [ h]phelabeled experiments, a high concentration of autoradiographic grains is seen in mature small dcvs only after a -h chase but not at earlier time points (table i) . the large vesicles appear to have a short half-life since > % of the counts associated with these vesicles appear in profiles that appear to be fated for degradation after a -h chase. the molecular mechanism by which the two processing intermediates are segregated from each other is still an open question. one appealing possibility is that the carboxyterminal intermediate selectively condenses in the early region of the tgn, leaving the amino-terminal intermediate soluble. perhaps different ionic conditions or different accessory proteins (chung et al., ) located in the late region of the tgn would allow the amino-terminal portion of the prohormone to condense at this site. a differential timing of condensation has also been proposed to explain the separation of prolactin and growth hormone in somatomammotrophs (fumagilli and zanini, ) . the aggregated carboxy-terminal portion of the precursor may be prevented from traveling to the late compartment either through steric hindrance of aggregates moving through small tubules, the inability to be packaged into small transport vesicles, or a specific association with an immobile membrane-bound receptor. alternatively, movement of the amino-terminal portion of the precursor may be mediated through the actions of a membrane-bound recognition system. in support of this model, the bag cell amino-terminal intermediate (f ) is associated with membranes at a time point ( -min pulse and -h chase) when the carboxy-terminal intermediate (i ) is not membrane associated (fisher, j., manuscript in preparation; illustrated in fig. ) . a selective association of the amino-terminal intermediate with a membrane-bound receptor would allow a vesicular sorting mechanism similar to that proposed for lysosomal enzymes. the amino-terminal bag cell peptides act locally to modulate the electrical activity of abdominal ganglion neurons and in an autocrine fashion to regulate the excitability of the bag cells (rothman et al., a; kauer et al., ; brown and mayeri, ) . the carboxy-terminal elh acts both on nearby neurons (mayeri et al., ) and through the circulation at peripheral targets as a hormonal substance (kupfermann, ; r~thman et al., b). thus, while the polyprotein motif ensures cosynthesis, the relative levels of these two sets of substances are regulated by the proteolytic cleavage, packaging, and targeting described above. recent studies indicate that non-elh precursor-related bag cell vesicle proteins are also selectively sorted ). these latter molecules may play a role in selective transport or release of different vesicle types. other neurons that express the elh prohormone ( a view of acidic intracellular compartments activation of neurosecretory cells enhances the synthesis of secretory protein positive feedback by autoexcitatory neuroendocrine bag cells of aplysia constitutive and regulated secretion of proteins coated vesicles from rat liver and calf brain contain lysosomal enzymes bound to mannose- -phosphate receptors a common source of ditficulty in high resolution autoradiography high resolution autoradiography two neuronal populations in the head ganglia of aplysia californica with egg-laying hormone-like immunoreactivity molecular sorting in the secretory pathway effects of monensin on the processing of proopiomelanocortin in the intermediate lobe of the rat pituitary intranrganellar calcium and ph control proinsulin cleavage in the pancreatic b cell via two distinct site-specific endopeptidases multiple neuropeptides derived from a common precursor are differentially packaged and transported osmium impregnation of the golgi apparatus in cow anterior pituitary, growth hormone and prolactin can be packaged into separate granules in the same cell nearophysin biosynthesis: conversion of a putative precursor during axonai transport the trans-golgi network: sorting atthe exit site of the golgi complex dissection of the golgi complex. i. moneasin inhibits the transport of viral membrane proteins from medialto trans-golgi cisternae in baby hamster kidney cells infected with semliki forest virus the mannose -phosphate receptor and the biogenesis of lysosomes the role of the goigi apparatus and gerl in secretory granule formation in acinar cells of the~rat exorbital lacrimar gland sorting of three secretory proteins to distinct secretory granules in acidophilic ceils of cow anterior pituitary vesicular stomatitis virus and sindbis virus glycoproteins transport to the cell surface is inhibited by ionophores alpha bag cell peptide directly modulates the excitability of the neurons that release it pathways of protein secretion in eukaryotes localization of aplysia neurosecretory peptides to multiple populations of dense core vesicles, jr large dense cored vesicles are enriched in neuropeptide processing intermediates in the aplysia bag cells stimulation of egg laying: possible neurocndocrine function of bag cells of abdominal ganglia ofaplysia californica proteolysis in neuropeptide processing and other neural functions nonsynaptic characteristics of neurotransmission mediated by egglaying hormone in the abdominal ganglion ofaplysia in situ hybridization to study the origin and fate of identified neurons maximum-likelihood estimation applied to electron microscopic autoradiography proteolytic processing of the aplysia egg-laying hormone and r - neuropeptide precursors processing of the elh precursor in the bag cell neurons of aplysia goigi apparatus, gerl, and lysosomes in neurons of rat dorsal root ganglia studied by thick section and thin section cytochemistry perrelet. . a clathrin-coated golgi-related compartment of the insulin secreting cell accumulates proinsulin in the presence of monensin proteolytic maturation of insulin is a post-golgi event which occurs in acidifying clathrin-coated secretory vesicles the transmost cisternae of the golgi complex: a compartment for sorting of secretory and plasma membrane proteins biosynthetic protein transport and sorting by the endoplasmic reticulum and golgi primary structure and neuronal effects of alpha bag cell peptide, a second candidate neurotransmitter encoded by a single gene in bag cell neurons of aplysia egg-laying hormone: direct action on the ovotestis of aplysia autoradiography high resolution analysis of the secretory pathway in mammotrophs of the rat anterior pituitary a single gene encodes multiple neuropeptides mediating a stereotyped behavior lysosome function in the regulation of the secretory process in cells of the anterior pituitary gland a bag cell neuron-specific antigen localizes to a subset of dense cored vesicles in aplysia californica cellular and molecular biology of neuropeptide processing and packaging perturbation of vesicular traffic with the carboxylic ionophore monensin clathrin-coated vesicular transport of secretory proteins during the formation of acth-containing secretory granules in att cells an antibody specific for an endoproteolytic cleavage site provides evidence that proopiomelanocorticotropin is packaged into secretory granules in att- cells before its cleavage sorting of progeny coronavirus from condensed secretory proteins at the exit from the trans-golgi network of att cells lysosomal enzymes and their receptors preparation of em autoradiographs subcellular sites of processing of precursors of neurosecretory peptides in the bag cells of aplysia: inferences from the effects of monensin, fccp, and chloroquine key: cord- -s nbr y authors: nan title: section virology date: - - journal: zentralblatt für bakteriologie doi: . /s - ( ) - sha: doc_id: cord_uid: s nbr y nan s contains a human endogenous retroviral element related to simian sarcoma virus (ssv) and its associated virus ssa v. by sequence analysis and comparison with the corresponding ssvlssav sequences the genomic organization of s element was determined to be ' gag-s-nrs-pol-ltr '. s-nrs represents a region of bp in s that consists of nonretrovira!'sequences. a probe containing the complete s element was used to screen two human cdna libraries under low-stingency conditions. clones were isolated which had yielded strong hybridisation signals with the s probe. hybridisation of these clones with different fragments of the s genome revealed that of these clones contain s-nrs related sequences. five of the isolated clones were sequenced and compared with s . one of them contains a homologous to the u -region of the s l tr. the outer four clones sequences with - % identity to s s-nrs on nucleotide level. the deduced amino acid sequences of the four s-nrs clones are only - % homologous to s s-nrs. none of the sequences represent a contiguous open reading frame. these results indicate that s-nrss probably do not have protein encoding function. hybridisation of human genomic dna shows that s-nrs belongs to a multicopy family of related sequences. human immunodeficiency viruses, human t lymphotropic viruses, and the human spumaretrovirus (hsrv) constitute the natural occurring human retroviruses. molecular cloning and sequencing of hsrv revealed four open reading frames (orfs) additional to gag, pol, and env. three additional orfs, bel - , are located berween the env gene and the 'ltr, one additional orf, sl, is loacted in the central region of the genome. functional analysis of the bel and s genes requires an infectious molecular clone of hsrv, which was not available so far. we have constructed such a clone (phsrv). the biological activity of the clone was confirmed by a variety of criteria: induction of characteristic cpe in susceptible cells infected with cell-free supernatant from cultures transfected with phsrv; indirect immunofluorescence; radioimmunoprecipitation of viral proteins and electron microscopy. furthermore, it is shown that phsrv is able to transactivate the hsrv-ltr. glycoprotein iv of bovine herpesvirus (bhv-l) is one of the major immunogenic glycoproteins of the viral envelope and is involved in absorption and/or penetration of the virus. it is esential for the production of infectious virus and cannot be deleted from the viral genome. in contrast to the analogous proteins of herpes simplex virus (gd) and pseudorabies virus (gp ) the giv of bhv- shows a size heterogeneity among different strains. this indicates that in at least one part of the polypeptide backbone the aminoacid composition is variable. comparison of the nucleotide sequences of four bhv- strains revealed that the size heterogeneity in these strains is due to different repetitions of a bp sequence, which is located upstream the sequence coding the membrane spanning domaine of giv. we are currently testing the possibility to introduce heterologous sequences into this part of giv to analyse whether the giv can contain antigenic epitopes of different viruses without affecting the functional activity of the giv. the molluscum contagiosum virus (mcv), a member of the family poxviridae, induces epidermal proliferation in man. the genome of mcv type (mcv-l; kbp) had been characterized by physical mapping using a defined gene library of the viral genome and by dna-dna hybridization. the physical maps of the viral genome were constructed for the restriction endonucleases bamhi, clai, ecori, and hindiii. detailed hybridization experiments revealed the presence of repetitive dna sequences located within the terminal regions of the viral genome, e. g. bamhi dna fragment b ( kbp; to . mu) and e ( . kbp; . to mu). the fine mapping of these particular regions indicates that the repetitive dna sequences are located within the hindiii dna fragments jl ( . kbp; . to . mu), k ( . kbp; . to . mu), pi ( . kbp; to . mu), and p ( . kbp; . to mu). nucleotide sequence analysis was carried out. it was found that the hindiii fragments jl and k each contained an inverted repeat of bp and bp, respectively. the homology between the both repetitive dna elements was found to be %. the analysis of the coding capacity of the determined dna sequences revealed the presence of and open reading frames in the hindiii dna fragment k and the corresponding region in the hindiii dna fragment jl, respectively. positive in-patients (n = ) and outpatients (n = ) showed an increasing prevalence of antibodies to herpes viruses. the difference was particularly evident for cmv-igg ( % prevalence in hospitalized, . % in out-patients and . % in hiv negative patients). anti-hbc, with a low prevalence in controls ( . %) was markedly associated with progression of hiv infection ( . % prevalence in out-patients, . % in in-patients). the antibody pattern to opportunistic viral infections may be regarded as a marker of pathogenicity in hiv infected patients. because of the strong crossreactivity of the two serotypes of herpes simplex virus (hsv) it is very difficult to distinguish between hsv-l and hsv- -typespecific antibodies in patients' sera. although genital herpes can be caused by hsv-l in % of the cases, hsv- is the cause of most recurrent genital herpes ( %). the serological differentiation of past hsv- from past hsv-l infections is necessary for identifying pregnancies likely to be complicated by recurrent maternal hsv- infection. by improving the enzyme-linked immunosorbent assay (elisa) for hsv- -antibodies and additional testing of sera by western blot, we were able to specifically identify hsv-l-and hsv- -antibodies in serum samples. -for the elisa, hsv- -antigen was immobilized on -well micro titer plates (nunc), and patients' sera were added. antibodies were detected by biotin/streptavidin peroxidase. -for the western blot the electrophoretically separated hsv- -antigen was used. the antigen was blotted to a polyvinylidenedifluoride (pvdf) membrane (immobi- n™, pharmacia) and incubated with the test sera. antibodies against typespecific glycoproteins of hsv type (gg- ), forming a sharp band, were visualized by the application of biotinlstreptavidin peroxidase. our results showed that the elisa and the western blot correlated in . %. serum samples with high antibody titers against hsv-l showed false positive reaction in the hsv- -elisa in . % of the cases. the optical density of these sera ranged ± , around the cut-off value of the elisa. these samples could easily be identified by western blot. -serological studies showed, that % of the prostitutes (n = ) have antibodies against hsv-l and % against hsv- . in % both types of antibodies could be found. furthermore % of female patients in gynecological treatment (n = ) had antibodies to hsv type and in % of the cases against both serotypes. % showed no antibody reaction. roughly the same prevalence of hsv-l and hsv- -typespecific antibodies was found in patients from the dermatological department. a. m. eis-hubinger, k. kurowski, and k. e. schneweis inst. f. med. mikrobiologie u. immunologie, univ., d- bonn a nonneutralizing monoclonal antibody (mab), directed against glycoprotein gc of herpes simplex virus type (hsv-l) and neutralizing mab to glycoprotein gb were evaluated for their ability to protect mice from genital hsv-infection. the nonneutralizing mab had only little effect on virus replication in the mucous membranes, but completely protected the mice from peripheral skin lesions, neurological illness and death. progression of the virus to the central nervous system was obviously inhibited by a modified course of the ganglionic infection: the number of ganglia presenting infectious virus and final latency were reduced, although early latency was not induced. in addition to the effects of the nonneutralizing mab, the neutralizing mab effectively shortened viral shedding from the vagina and converted proliferative ganglionic infection into latency. the different modes of action of the monoclonal antibodies are discussed in context to the possible defense mechanisms of the humoral immunity against virus proliferation in mucous membranes and in ganglia. the thymidine kinase (tk) gene of bovine herpesvirus (bhv-l) can serve as an integration locus for foreign dna into the viral genome, because expression of a functional active tk is not essential for viral replication. the tk -gene of bhv - was located by conversion of tk--negative cells to the tk+ -phenotype and marker rescue experiments. it contains an open reading frame of bp. sequence comparison with other herpesviral tk-proteinsequences revealed, that only certain parts of the amino acid sequence as the nucleotide binding loop are highly conserved. hybridization of rna from infected cells with tk-dna showed, that tk-mrna has a size of . kb, whereas the size of tk-mrnas of other herpesviruses measures about kb. '-and '-end of the tk transcription unit were characterized using nuclease -analysis. an open reading frame, when translated into protein, is homologous to the glycoprotein h (gh) of herpes simplex virus type and lies downstream the open reading frame of the tk-gene. we conclude, that the expression of,bhv-l-gh correlates with the expression of thymidine kinase. preliminary results suggest, that transcription of both genes is initiated from one common promoter. in foot-and-mouth disease virus (fmdv) infected cells disappearance of the nuclear protein histone h and the simultaneous appearance of a new chromatin associated protein termed pi can be observed. we have sequenced the amino terminus of pi and clearly showed that protein pi derives from histone h by proteolytic cleavage. the n-terminal amino acid residues are specifically cleaved off early during infection. in addition using an in vitro transcription/translation assay with different fmdv clones we showed that the histone h -pi transition is fmdv c protease dependent. this protease until now has only been found to be responsible for the processing of the viral polyprotein. the c protease (i) is the only fmdv protein required to induce this histone h -pi transition, (ii) no other viral protein can perform this specific cleavage, and (iii) no viral precursor fusion protein is necessary for this specific cleavage, as it is reported for the processing of the poliovirus p precursorpolyprotein. the c mediated histone h cleavage is not restricted to chromatin derived from natural host cells. as the deleted part of the histone h corresponds to the domain presumed to be involved in the regulation of transcriptional active chromatin in eucaryotes, it is postulated that this specific cleavage of h is a mechanism which fmdv utilizes to switch off host cell rna synthesis, as is reported for picornaviruses. in combination with the reported mechanism of host cell translation shut off by cleavage of the cap-binding protein complex, this specific histone h cleavage could contribute to the almost complete breakdown of host cell functions during infection. the tk of hsv - contains three regions of homology to highly conserved sequences of other nucleotide binding enzymes. these are the residues to (nucleotide binding loop), residues to and residues to . comparison of the viral and cellular tk protein sequences and -d structure analysis led to the hypothesis that the asp might be involved in binding of acyclovir which is used as a therapeutic for hsv infection. site specific mutagenesis which replaced asp by asn led to a polypeptide with no tk activity. the same was found when residues to , which are not present in cellular tks, were deleted. both mutant genes were integrated into vaccinia virus to study the biochemical properties of the resulting polypeptides and to analyze the importance of the mutated sequences for the functional activity of the enzymes. . in contrast the human glioma cell line u and the adenovirus transformed kidney cell line revealed replication of both organspecific variants as early as hours p.t. nevertheless the amount of replicated dna of the kidney variant was clearly reduced in glioma cells and replicated dna was detected later than with the cns variant. from these data we conclude, thatjcv replication is regulated not only host type specific, but also in a cell type specific manner. young human volunteers were vaccinated with a killed hepatitis a vaccine produced in human embryo fibroblast cells. different amounts of vaccine were administered by the intramuscular route. weeks after the first vaccination with a . !-lg vaccine . % of the volunteers seroconverted. weeks after the second injection the seroconversion rate was . %. anti-hav was determined quantitatively and results showed anti-hav titers to times higher than those after gamma globulin administration. one year after the vaccination / volunteers still had anti-hav titers in their sera to times higher than those after gamma globulin administration. human papillomaviruses (hpv) associated with the epidermodysplasia verruciformis syndrome (ev) represent a group of closely related viruses, clearly distinct from other hpvs. the most interesting features of ev-viruses are: (i) high oncogenic potential of some specific virus types, (ii) extremely narrow host range. to get some insight into the molecular basis of processes controlling the viral expression we studied the sequence-specific dna-protein interactions within the genomic regulatory regions. using the nuclear extracts of hela cells and a combination of exonuclease iii-and dnase i-footprinting techniques the protein binding maps have been constructed for hpv and hpv , the prototypes of viruses with high versus low oncogenic potential. the sequences in question showed a complex array of protein binding domains, covering almost the entire length of the regulatory regions. a cluster of prominent binding sites, which overlapped with the sequences of the motif (m ), a highly conserved element in most of the ev-viruses, was investigated in more detail. in transient cat assays the m motif of hpv as dimer or trimer was found to act as a strong expression activator. the analysis of m sequences in band-shift tests revealed partially different sets of dna binding proteins, interacting with the elements from hpv and . one of these proteins, at least in case of hpv , was shown to be the regulatory factor api. a part of m sequences in the vicinity of the ap binding site display a homology to enhancer elements in other small dna viruses. a. gerritzen, j.-p. kleim, and a. friedrich inst. for med. microbiology, univ., d- bonn semiquantitative detection of hepatitis b virus (hbv) dna in sera of infected individuals has become an important means of modern serological hepatitis diagnostics. it enables investigators to draw conclusions on infectivity, prognosis and therapeutical success. molecular hybridization using radioactively (i. e. phosphorus) labeled dna probes with subsequent autoradiography is characterized by both high sensitivity and specificity. alternatively digoxigenin-labeled probes which are detected by enzyme immunoassay have been employed. using this method - pg of hbv dna in aqueous solution have been detected with high specificity on membranes made of cellulose nitrate. testing sera of hepatitis patients pg of hbv dna has been detected on nylon membranes of . m pore size e p: . pg). unfortunately specificity remained disappointing even after centrifugation, digestion by proteinase k and treatment of the sera with phenole/chloroform. objective. to assess the risk for laboratory personnel resulting from patients with unknown hiv infection, sera sent in to the institute for medical virology and immunology (imvi essen) for immunologic and/or virologic testing were anonymously screened for hiv antibodies. methods. between july and december, , a total of sera from different departments of the university clinics of essen were selected for screening under code on the basis that no hiv antibody test was requested for diagnostic purposes at the same time, and sera from patients found to be anti-hiv positive during the previous years were disregarded (n = ). sera reactive in elisa (enzygnost-anti-hiv, behring) were further tested in a second (dupont) and third elisa (pasteur) and in a confirmatory test (western blot -wb-, dupont). results. in of sera from patients not suspected for hiv infection, hiv antibodies were confirmed by wb ( . %) (table) . an additional sera showed less than specific we bands and were considered indeterminate. sera from unknowingly infected patients were sent in most often from the internal (n = ) and dermatology departments (n = ), whereas sera with indeterminate hiv antibody results mostly originated from patients who received tumor treatment (n = ). conclusions. the prevalence of . % unknown hiv infections reflects a higher rate than generally assumed but possibly results from a selection in a university of patients with immunological disorders and underlying hiv infection. an overall prevalence of % anti-hiv positive sera suggests the strict adherence to infection control measures in medical laboratories. bovine viral diarrhea virus (bvdv) is a member of the pestivirus group. in culture of bovine cells, a non cytopathic (ncp) and a cytopathic (cp) biotype can be distinguished. using radioimmunoprecipitation a monoclonal antibody (mab) detected a kd nonstructural (ns) polypeptide in cells infected with ncpbvdv. in cells infected with cpbvdv an additional kd protein was precipitated. a second set of mabs was directed against the kd minor glycoprotein. the distribution of both proteins in cells infected with the two biotypes was analyzed by immunofluorescence analysis (ifa). none of the two proteins was detected on the surface of live, infected cells. the ns protein was homogenously distributed in the cytoplasm of cells infected with both biotypes. the second set of mabs displayed different staining patterns in cells infected with each of the biotypes. in cells infected with cpbvdv, a homogenous cytoplasmic fluorescence was visible. in cells infected with ncpbvdv, the stain was largely restricted to the perinuclear zone, giving a distinct staining with each of the mabs. the possible significance of these results for cytopathogenicity are discussed. in sera of patients with a variety of inflammatory rheumatic diseases autoantibodies to selfantigens (autoantigens) are found. one of the hypotheses on the molecular basis of autoimmune diseases which is discussed intensively since decades, assumes that structure-or sequence-related epitopes of virus and host proteins might be involved in initiation of autoimmune processes (molecular mimicry). -to search for crossreactive or sequenceidentical epitopes of cell and virus proteins, we started to map in detail antigenic regions and individual epitopes on autoantigens. a most detailed study has been performed for the ulsnrnp specific p protein which is the major target of autoantibodies in systemic rheumatic diseases such as mixed connective tissue disease and systemic lupus erythematosus. -by immunoblotting and elisa assays performed with recombinant p fusion proteins and peptides four antigenic regions and many patient specific epitopes could be mapped. in one of the antigenic regions an epitope amino acids long could be identified which is also present on the matrix protein m of influenza b viruses. with affinity purified p specific autoantibodies the reaction with the m influenza b virus protein and vice versa could be experimentally verified. -these results demonstrate for the first time that autoantibodies from patients with rheumatic diseases recognize an epitope of identical sequence on a highly prevalent and pathogenic virus and a major auto antigenic target. whether the existence of this common epitope is by chance or causually related is currently investigated. detection of antibodies against cytomegalovirus (hcmv) induced "early" -antigens by immunoblotting contradictory informations about the diagnostic assessment of antibodies against the "early" -antigens of human cytomegalovirus (hcmv) have been numerously published. we investigated the correlation between the incidence of antibodies against hcmv "early"proteins and the state of infection. ninety-six hcmv-igg-positive sera (elisa) were tested for specific igg-antibodies against hcmv "early"-antigens by immunoblotting. three groups were examined: (a) renal transplantation patients, (b) aids-patients and (c) randomly selected healthy individuals. each group yielded approximately the same percentage of positive immunoblots ( %, %, %). sera belonging to group (a) or (b) reacted stronger and recognized a greater number of polypeptides ( ± ; ± ) when compared to healthy persons ( ± ). all immunoblot-positive sera reacted at least with the kd protein (major "immediate early"-protein). fourteen out of hcmv-igm-positive sera (elisa) belonging to group (a) or (b) recognized "early"-antigens ( %). twenty-two out of hcmv-igm-negative sera ( %) reacted as well. we conclude that an acute hcmv infection does not cause the formation of antibodies against "early" -antigens in all individuals and furthermore these antibodies can persist during a subclinical/latent infection. berne virus (bev), isolated from a horse, is the prototype of the toroviridae, a proposed new family of positive-stranded rna viruses. bev virions consist of a peplomer-bearing membrane which envelops a tubular nucleocapsid of helical symmetry; this structure can be straight (resulting in a tubular particle) or bent into an open torus (conferring the shape of a kidney or biconcave disc to the virion). the nucleocapsid contains a single polyadenylated rna molecule of > kb and the most abundant polypeptide, an . kd basic phosphoprotein with nucleic acid binding properties. upon infection, a set of '-coterminal sub genomic mrnas is synthesized by leader-independent transcription; only the unique ' sequences of each mrna are translated. -the combination of virion structure, nucleocapsid protein size and leader-independent transcription is unique in virology and justifies a family status for bev and related viruses. however, coronaviruses have a similar genome organization, a '-coterminal nested set of mrnas and sequence similarities in the second orf of the polymerase gene of bev. since the latter suggest common ancestry, toro-and corona viruses together may be considered as a third evolutionary cluster of positivestranded rna viruses, in addition to the alpha-and picornavirus superfamilies. w. ]ilg, h. mairhofer, c. markert, and h. wolf max v. pettenkofer-inst. for hygiene and med. microbiology, univ., d- munich in order to characterize viral and nonviral structures responsible for the recognition of ebv-infected lymphocytes by the immune system, we studied the reactivity of ebv-specific cytotoxic t cells towards autologous ebv-positive lymphoblastoid cell lines (lcls). lcls were established from different ebv-positive donors by either spontaneous outgrowth of cells transformed by the donors own virus or by infection with a laboratory strain of ebv (b - ). these cell lines were used for the generation of ebv-specific cytotoxic t cells by weekly stimulation and addition of interleukin ; cells were cloned by limited dilution. in chromium release assays these cd positive t cell lines and clones were able to discriminate between two autologous lymphoblastoid cell lines infected by either the "own" virus strain or the b - strain, respectively. further experiments using various concentrations of effector cells showed that structures recognized by different t cell clones were expressed only in a certain percentage of cells ( - %) of each lcl, and that nonviral components differently expressed on different lcls also seem to playa role ctlllcl interactions. the large-scale production and purification of recombinant gp leads to a native and biologically active protein, which bounds specifically to the cd receptor. anti-hbs response of hbs vaccine recipients within an ongoing immunization course was studied in vitro. antigen specific antibody production and proliferative response as well as the expression of cd and cd and the secretion of scd were detected. it was the aim of the study to analyze the effect of various cell stimuli (mitogens, lymphokines and antibodies against cell surface antigens) on the antigen-specific immune response in vitro. pwm driven enhancement in hbs specific antibody production was shown to be time dependent. in contrast to iii and il , incubation with il led to a significant increase in anti-hbs antibody synthesis. low doses of led to a significant increase in hbs induced cd expression. moreover, induced scd secretion is enhanced by hbs antigen. il receptor expression of hbs vaccine non-responder pbmc is reduced as compared to the responder group. cd receptor expression of responder pbmc is influenced by antigen as well as iii whereas no modulation can be seen with non-responder pbmc. the capacity of nonresponder cells to respond to hbs antigen is reduced whereas the capacity of these cells to respond to iii is markedly enhanced. in summary, our data show that the hbs specific immune response in vitro is influenced by lymphokines. . % of sera from women (n = ) and . % of sera from men (n = ) were found to contain antibodies directed against the l gene products of the hpv types mentioned above. . % of female and . % of male sera exhibited antibodies directed against the hpv- e and/or e gene products. on the other hand in an individual female serum antibodies directed against hpv- el and e could be found, and another one harboured antibodies directed against hpv- e . all of the antibodies were of igg type. in order to specify whether antibodies against papillomaviruses are associated with sexual activity, we used sera from female individuals of age years old. we tested also the sera from the same individuals which were subsequently taken at time intervals of and years. it could be shown that l antibodies were present in the sera over the whole period of time. however, also an increase in the frequency of antibodies directed against hpv - ll with growing age of the women was observed. these data indicate that beside the distribution of human papillomaviruses by sexual intercourse other routes of papillomavirus infection may exist, for instance perinatal infection. further experiments revealed differences in salt stability and ph dependence between gd, gb, and gc with respect to their binding ability. thus, binding of gd could be disrupted at mm nacl and had a ph optimum between ph and ph , whereas binding of gc and gb showed a ph optimum near ph and was stable even at salt concentrations above mm nacl. the results given above provide direct evidence for a functional role of gc, gb, and gd in binding of hsv- to the cell surface. to h. as demonstrated by electron microscopy, the mechanism of this effect is due to irreversible binding of the metal ions to the viral membrane, presumably to mercaptan groups of the viral glycoproteins. adsorption of zinc inactivated virus is reduced to some extent only whereas a heavy impact has to be presumed on virus penetration. only in a small concentration range ( to i!m zn in culture medium) zns is inhibitory to the virus replication in infected cells without serious toxicity to the cells themselves. -therefore the mechanism of the in vivo efficacy of zinc preparations against hsv lesions of the mucosa is mainly based upon inactivation of free virus and only partly due to virustasis or inhibition of hsv adsorption. experiments done either with synthetic peptides or with cells transfected with the gene encoding the ebv latent membrane protein bnlfi suggested that this protein is a target for ebv specific cytotoxic t-cells (ctls). as such experiments do not closely resemble the natural situation we wanted to expand on this topic and established a system which should better reflect in vivo conditions. we constructed two recombinant vaccinia viruses, one carrying the complete bnlf l-ma reading frame, the other encodes a truncated form of bnlf i-ma containing the third exon only which was found on ebv infected burkitt lymphoma in addition to the downregulated full length protein. the continuous coding sequence of the complete gene which is necessary for expressing foreign proteins in recombinant vaccinia was cloned from genomic fragments and synthetic oligonucleotides. after infection of several cell types including freshly isolated pbls the expression of both forms of lmp was clearly demonstrated in immunoblots and by immunofluorescence. -ebv -specific cytotoxic t-iymphocytes (ctl) generated by repeated stimulation with autologous ebv infected lymphoblastoid cells in the presence of il- were reacted with autologous pha stimulated blasts infected with the two vaccinia viruses and the wild type virus as a control. ctls of two persons recognized the full length bnlfi protein but not the shortened protein whereas ctls of two other persons did not recognize any of the two bnlfi proteins. from these experiments we conclude that ., the n-terminus of the bnlfi protein contains a determinant which is recognized by some ebv-specific ctls and ., that there are additional proteins which are targets for other ebv-specific ctls. the expression of the epstein-barr virus regulation gene bmlfi is regulated by a promoter/enhancer complex located upstream from the short orf bslfi (transcribed as a spliced unit). the region '-proximal to the tata box contains consensus sequences for binding transcription factors (e.g. nf-l, ap-l). we analyzed the activity of this control region in different cell systems using appropriate reporter assays (chloramphenicol acetyltransferase and hepatitis b virus surface antigen as reporter genes). -a bp aluilbsteii fragment including the tata box was shown to be sufficient to promote the transcription in raji cells induced to lytic ebv expression by different procedures. responsiveness to phorbolester was shown in ebv negative cells ( t ). the upstream region of the bmlfi promoter ( bp bsteiiissti fragment) was identified as regulatory segment in transfection assays showing both positive and negative effects depending on the presence and state of ebv. -in ebv negative cells (hela), the upstream element clearly responded to the ebv transactivator brlfl. this specific trans-activation of the distal control region by brlfi (expression vector pksvr kindly provided by a. sergeant, lyon) was down-regulated in latently infected cells (raji) while in ebv producer cells (p hr-l) trans-activity by brlfi was detected. following insertion into a heterologous expression system the bmlf upstream control region enhanced transcription of the sv early promoter independent of its orientation. we have previously shown that mutants of prv that do not express the nonessential glycoprotein gill adsorb less readily to cells than does wildtype virus. we show here that the first interactions of prv with target cells occur via binding of the virus to a heparin-like component on the cell surface and that the viral protein mediating this binding is glycoprotein gill. this conclusion is based on the following findings: ) heparin inhibits adsorption of wildtype prv effectively as measured by plaque formation as well as by attachment of radioactively labelled virus to cells. however, it affects adsorption of gill-mutants only slightly. ) while wild-type prv binds well to matrix-bound heparin binding of a giiimutant is dramatically reduced. ) pre-treatment of cells with heparinase reduces plaque formation and adsorption of wildtype pry by % but does not affect gill mutants. ) of the pry membrane proteins glycoprotein glii binds most abundantly and specifically to heparin sepharose beads. our results indicate that binding of pry via glycoprotein glii to a heparin-like cellular component promotes efficient adsorption. in the absence of glii or of the heparin-like cellular receptor the virus adsorbs by an alternative less efficient mode. a. e. metzler and r. wyler inst. of virology, univ., ch- ziirich, switzerland bovine herpesvirus (bhv ) causes two well established entities, namely infectious bovine rhinotracheitis (ibr) and infectious pustular vulvovaginitis (ipv). encephalitis, a third entity, is less well understood. whereas ibr usually follows horizontal virus spread by aerosols, ipv is acquired by venereal contact. it remains controversial if the conditions were associated with distinct viruses. restriction endonuclease analysis of viral dna or evaluation of viral proteins following separation in sds-polyacrylamide gels may be used to distinguish between bhv . , bhv . and bhv . . the proteins of european field isolates, recovered from distinct disease episodes within the time period to , were compared with the proteins of established laboratory strains. of field isolates were classified as bhv . , as bhv . and none as bhv . . bhv . was most regularly recovered from cattle with genital afflictions. however, some bhv . strains originated from animals with ibr and others from aborted fetuses as well. the first recognition of bhv . among the field isolates in coincided with sequential waves of severe ibr outbreaks throughout europe. results obtained with laboratory strains indicated that bhv . , obviously of limited pathogenic potential, must have existed at earlier times. together with published data the results suggest that recognition of a strain as bhv . or bhv . does not necessarily reflect a specific pathogenic potential nor a distinct organ tropism. nevertheless, the severe ibr incidences were clearly associated with a virulent bhv . it has been demonstrated that the late gene products ll and l of certain papillomavirus types exhibit dna-binding activity. hepatitis b virus core proteins are also an example for the interaction of viral capsid proteins with nucleic acids. in this case dna binding is mediated by carboxy terminally located clusters of basic aa residues. similarly, the ll gene product of hpv- contains also groups of basic amino acids at its carboxy terminus. to examine whether this region is in fact the dna binding site of ll, we expressed different parts of this gene in e. coli as ~-gal fusion proteins. the vector system which we used allows the cleavage of the viral protein from ~-gal by collagenase digestion. out of the different expression products only the whole l protein and its carboxy terminal part bound dna. to specify the dna binding site, the coding sequence for the last amino acids of l was fused to ~-gal. by this measure dna binding activity could be transferred to ~-gal, which did not formerly exhibit such property. collagenase digestion and use of l specific polyclonal antibodies ensured that dna binding was a genuine attribute hpv- l gene products. the latter enzyme differentiates between a , -and a , -linkages, cleaving preferentially sialic acid attached to galactose via an a , -linkage. na-treated cells were resialylated using specific sialyl-transferases and cmp-sialic acid. only a transferase attaching sialic acid in an a , -linkage to gal was able to restore receptors for bfdv. accordingly, cultured chicken embryo cells were resistant to bfdv infection following destruction of this receptor by na treatment. detection of cytomegalovirus (antigen) in body fluids has become increasingly important.-for that purpose, in our study blood and urine specimens from immunosuppressed patients ( renal transplant recipients, heart and liver transplant recipients, patients with aids) were tested for hcmv. indicator cell cultures (foreskin fibroblasts) were inoculated with urine and leucocytes, respectively, and resp. , , and days after inoculation, subjected to an immunoperoxidase staining (ips) using a monoclonal antibody (dupont, f.r.g.) directed against hcmv early antigen. as controls, cell cultures inoculated with leucocytes were examined for hcmv-specific cytopathic effects (cpe) for days. additionally, leucocytes from patients were subjected to in-situ-hybridization with biotin-labeled hcmv ad -dna (eco ri j-fragment) probes. serum samples were tested for the presence of hcmv-specific antibodies of ig classes g, m., and a by elisa (behring, f.r.g.). -hcmv was detected in blood and urine samples from patients. blood samples were positive by both ips and cpe, by ips only, and by cpe only. hybridization assays were all negative. in virologically positive cases, titres of hcmvspecific antibodies amounted to (reciprocal titres): igg ;::: ( cases, with a significant rise of titre in case), igm ;::: ( cases), and iga ;::: ( cases). -our results indicate that, for laboratory diagnosis of active hcmv infections, the detection of hcmv early antigen in urine is, with regard to practicability and rapidity, superior to the test for viremia and is to be considered a helpful extension of serological testing. moreover, with urine samples being easily obtainable, the detection of hcmv early antigen in urine is especially appropriate, too, for controlling the course of active hcmv infections. kai-olaf netzer, axel rethwilm, and volker ter meulen inst. f. virologie u. immunbiologie, univ., d- wiirzburg the human spumaretrovirus (hsrv) is a distinct member of the foamy virus subfamily of retroviridae. its genome of about kilo bases has been sequenced. it comprises the typical retroviral genes gag, pol, and env, and at least three more open reading frames possibly coding for regulatory proteins. thus far, not much is known about the gene products of hsrv. by means of radioimmunoprecipitation, we have identified and partly characterized the major immunogenic antigens of hsrv. radiolabeled viral proteins precipitated by hsrv-positive sera (but not by hsrv-negative control sera) were in the range of to kilodalton (kda) apparent molecular weight. labelling with c-glucosamine, or with s_ methionine in the presence of tunicamycin led to the identification of three viral glycoproteins of , and kda apparent molecular weight, respectively. these glycoproteins most likely represent env gene products. a phosphorylated protein of kda may be related to the gag gene of hsrv. the results of this study show that radio-immunoprecipiation provides a powerful diagnostic and research tool to identify hsrv-positive sera. thomas nowak! and gerd wengler inst. f. virologie, univ., d- gief~en, !present address: behringwerke ag, d- marburg the primary structure of the nonstructural proteins ns , ns a, ns b, ns , ns b and ns of the wnv has been determined. the nonstructural proteins were isolated from nuclear membrane fraction of wnv infected bhk cells. aminoterminal sequence data of these purified proteins were determined. together with the published amino acid sequence of the nonstructural coding genom region (castle et ai., , virology , - ) we obtained the sequences of the nonstructural proteins ns ( kd), ns a ( kd), ns b ( kd), ns ( kd), ns b ( kd) and ns ( kd). the gene order, the sizes of the virus coded proteins and the processing of the nonstructural proteins appears to be identical between the flaviviruses. it is well accepted that the functional impairment and killing of infected cells, hypersensitivity and autoimmunity contribute to the symptoms and pathology of viral diseases. we will discuss evidence for an additional mechanism can be defined as the uncontrolled activation of host effector functions not focused on viral antigens. "autotoxicity" is evident in the following situations: (i), certain paramyxoviruses and influenza viruses are capable of activating the generation of reactive oxygen species in phagocytes in the absence of antiviral antibody. this reaction is triggered by the binding of viral surface glycoproteins to the plasma membrane of the phagocytes. when injected into the blood stream, these viruses exert toxic effects independent of viral replication. -(ii), liver damage is observed in a model of murine influenza despite the apparent lack of viral replication in this organ. this effect may be mediated by cytokines. -(iii), in canine distemper, demyelination occurs despite the apparent lack of viral replication in oligodendrocytes, the cells which form myelin. degeneration of uninfected oligodendrocytes is also observed in dissociated brain cell cultures. as measured by luminol-dependent chemiluminescence, antiviral antibody stimulates the generation of reactive oxygen in microglial cells by linking fe receptors with viral antigen expressed on the surface of infected cells, e. g. astrocytes. in these cell cultures, oligodendrocytes can readily be destroyed by reactive oxygen species generated by xanthine/ xanthine oxidase. about , sera (january, to august, ) were analyzed retrospectively for hepatitis a or hepatitis b markers; , of these were evaluable. age distribution and seasonal distribution of acute hepatitis a virus infections in groups of patients with german or foreign names were determined. most cases of acute hepatitis a in the foreign population occurred between september and december, and most patients were below years of age. in the german population no seasonal peaks could be found. however, there was one peak between and , and another between and years of age. -we did not see seasonal peaks of acute infections with hepatitis b virus. no age was preferentially affected, but infections occurred earlier in foreign population than in german people. -in both groups cases of acute infections with both hepatitis a and hepatitis b viruses were only rarely found. more foreign people than german had markers for hepatitis a or hepatitis b ( % vs. %). the glycoprotein complex gil belongs to the essential membrane proteins of pseudorabies virus (prv). therefore mutational analyses of viral gil require growth of the respective mutant in a complementing, gil-expressing cell line. a cell line capable of supplying gil in trans was isolated after co-transfection of a genomic pry-dna fragment encompassing the complete viral gil-expression unit and the plasmid psv neo conferring resistance against the antibiotic g . the viral expression unit is usually silent but can be transactivated after superinfection by herpes simplex virus (hsv-l). transient expression of the pry "immediate early" protein is not sufficient to induce transactivation. by immunofluorescence and radioimmunoprecipitation using gil-specific monoclonal antibodies expression of authentic gil could be demonstrated. attempts to isolate a constitutively gil-expressing cell line failed, presumably due to the toxicity of the expressed glycoprotein. results regarding processing of gil without the context of a pry-infection will be presented. furthermore, availability of this cell line enables us to specifically mutate the gil-gene in the pry genome and characterize the resulting mutants biologically. cellular and humoral immune reactions are important for the pathogenesis of viral infections. in our animal model of mv encephalitis, lewis rats develop a subacute cns disease process (same) in the presence of only low levels of neutralizing antiviral antibodies. the contribution of the mv-specific cellular immunity to this disease is yet unknown. therefore, the in vitro reactivity of polyclonallymphocyte cultures to mv structural components was determined. additionally, the possibility to replace purified viral antigens by bacterially expressed fusion proteins was studied. t cells were primed by immunization with antigens in emulsified in freund's complete adjuvant. t cells prepared from regionallymphnodes were taken into culture - days later and lymphoproliferation was measured by the incorporation of tritiated thymidine in the presence of specific and irrelevant antigens with a panel of antigen-specific t cell lines. with all polyclonal t cell populations except those primed with recombinant haemagglutinin (pbd-h) a specific proliferation was obtained when either whole inactivated mv or the immunizing antigen was used for restimulation. while the nucleocapsid (n) or matrix (m)-specific cell lines recognize equally well pbd-n and virion purified n (nv), or pbd-m and mv respectively, such substitution for pbd-h and hv was not found. our observations indicate the induction of a differential t cell dependent immune response against the procaryotically expressed h compared to the h glycoprotein purified from virion. k. rittert, b. nellent, h. eiffertl, h. kratzin , and r. thomssen in the course of acute epstein-barr virus (ebv) infection igm antibodies always occur against two cellular antigens that were characterized as proteins with a molecular weight of kd (p ) and kd (p ), respectively. purified p was identified as a monomer of human triosephosphate isomerase (htpi). p is a so far unknown protein that possesses a high homology with triosephosphate isomerase of rabbits (rtpi). -the two autoantibodies are produced only as igm class antibodies, there is no switch to igg. presumably these antibodies are monoclonal in percent of the patients. -in percent of the cases with acute hepatitis a virus (hav) infection anti-htpiirtpi antibodies were found, too. acute ebv infection as well as acute ha v infection may be complicated by hemolysis of different extent. igm anti-htpiirtpi antibodies purified by affinity chromatography caused an increased tcr release from human erythrocytes (rh negatice, group ). the contribution of these autoantibodies to hemolysis in acute viral infections is likely and will be further investigated. in first attempts we tried to express hbv pre-s( ) epitopes as aminoterminal fusions with hbc, all attempts resulted in no detectable expression due to instability or toxicity. we then inserted oligonucleotides coding for two overlapping pre-s( ) epitopes (dprvrglyfpa) o. immunol. : immunol. : , ) at the site where in duck hepatitis virus core antigens an insertion of amino acid is found compared to the mammalian hepatitis viruses and predicted to be at the surface of particles. the insertion results in the expression of stable fusion proteins with pre-s antigenicity in western-blots. the chromatographic behaviour of hbdpre-s( ) chimaera on sepharose b is similar to that of authentic recombinant core particles, suggesting that they assemble to particles. a rabbit anti-pres( ) - antiserum (kindly provided by r. neurath) recognizes the hbdpre-s( ) particles in a non-denaturing elisa type assay, a monoclonal antibody to the second epitope does not, which shows that a part of the inserted sequence is accessible on the particles. since we can now express hbc particles carrying pre-s epitopes in e.eoli the immunologic properties (induction of t-cell and b-cell responses) of purified particles can be investigated. w. the characterization of an enzyme-linked immunosorbent assay, ®enzygnost-hsv (ag), for the identification and typing of hsv is discussed. -differentiation of hsv was evaluated against laboratory hsv strains. it was shown that the typing indices were valid over a broad dilution range, which is essential for samples of both low and high antigen content. -in a preliminary clinical study (n = specimens) direct testing revealed an identification sensitivity of . %, a typing sensitivity of . % and overall specificity of . %. in a confirmatory test, a % agreement for both identification and typing was obtained. -on the basis of these results, it was concluded that ®enzygnost-hsv (ag) is a suitable alternative to the cell culture method, since it overcomes the failure of virus isolation due to possible inactivation resulting from improper transport and/or storage of the specimens. -in comparison with conventional hsv detection and typing test systems, ®enzygnost-hsv (ag) offers the following advantages: -ease of performance (within h), -less expensive, -subjective reading of test results using elisa photometers, -computer-controlled automation using microtitre plates is possible. sera of persons in the age between -to -years were tested parallel with the biotin! avidin western blot (b/awb), with the biotin!avidin enzyme-linked immunosorbent assay (b/aelisa) and with the complement fixation technique (cft). antigens used in all tests of the study were preparations of the human adenovirus type . specific igg-antibodies directed against two immunoblotted group-specific major adenoviral polypeptides, the hexon epitope a-antigen and the penton base ~-antigen, were found in more cases ( %) than antibodies found with the b/aelisa ( %) and with the cft ( %). the prevalences of igg-and iga-antibodies to human adenovirus were studied by b/aelisa in serum samples obtained from different age-groups of frankfurt/main, west germany. the lowest igg-antibody prevalence ( %) was measured in the six-to -month age-group, increasing to % in the six-to seven-years age-group. a lot of adenovirus positive sera with specific iga-antibodies were measured in the one-to two-( % and two-to three-( %) years age-groups. a second peak of iga-antibody prevalence ( %) appeared in the six-to seven-years and seven-to eight-years age-groups, where the highest prevalence of anti-adenovirus igg was seen. reverse transcriptase is necessary for viral replication, therefore it is an attractive candidate for antiviral therapy. detailed functional and structural analysis like e. g. cristallographic studies or neutron solution scattering are predisposition for the development of new inhibitors affecting reverse transcriptase activity. -for this purpose we have constructed a plasmid which allows high level expression of the active reverse transcriptase after introduction into e. coli. by partially adopting the e. coli codon usage and adding the original amino-and carboxy terminal sequence by synthetic oligonucleotides we were able to produce the authentic enzyme in e. coli in considerable amounts (up to % of the total e. coli protein) and in a very stable form, as shown by coomassie staining and by western blot analysis. mutants with additional amino acids fused at the aminoterminal sequence show a lower expression and an increased accessibility to the bacterial proteases. -the activity of the authentic and of the amino terminally altered enzyme was compared by standard methods and by an activity gel procedure. enzyme activity could be detected only at kd and kd, wereas no activity could be detected at kd. the recombinant produced enzyme can be used for purification and crystallographic studies. the genome of hog cholera virus (hcv) consists of an rna of kb in length. the rna contains one large open reading frame(l) which is probably translated into a polyprotein and then processed proteolytically. -metabolic labeling and radioimmunoprecipitation with a polyspecific antiserum led to the identification of four different glycoproteins -gp , gp , gp and gp -in hcv infected cells ( ) . inhibition of n-linked glycosylation through treatment of infected cells with tunicamycin resulted in distinct changes in migration behavior of these proteins in sds-page. -various cdna fragments located in the region coding for hcv encoded glycoproteins were expressed as fusion proteins in bacteria. the purified fusion proteins were used to prepare antibodies specific for the respective hcv glycoproteins. these serological reagents were used in radioimmunoprecipitation assays and western blots. the following conclusions can be drawn: .) gp and gp represent differently processed forms of a single protein. in patients with epidermodysplasia verruciformis (ev) hpv induces lesions with a higher risk of malignant conversion. there is evidence that the virus occurs also in the normal population. as hpv can not be propagated in tissue culture capsid antigens are not readily available for seroepidemiologic studies. we therefore expressed the major structural protein l of hpv and fragments thereof as ~-gal fusion proteins in bacteria. the expression vector pros encodes a fxa-cleavage site, which allows the separation of viral and bacterial moiety by proteolytic digest. purified viral antigens were used to test sera by western blot analysis. % of the sera revealed antibodies against hpv l at a dilution of : . in some cases the titers exceeded : . the antibody prevalence was similar in all age groups. western blots with l fragments showed that the humoral immunoresponse of different persons is not always directed against the same epitopes. the molecular basis for the lack of hbeag in viremic sera of some acute and chronic infected patients is not clear. in this study it was investigated whether this group of patients is infected with hbv variants which cannot synthesize hbeag. -viral dna isolated from sera of hbeag negative chronic carriers was amplified (per) and sequenced directly or after cloning. in all patient's sera hbv variants were found which had in common a stop codon in the precore region. -since the precore protein is the precursor for synthesis of the classical hbeag, one can conclude that the precore mutation of the hbv variants are responsible for the lack of hbeag in the serum of these patients. these results also implicate that the expression of hbeag is not essential for the viability of hbv. at least under immunosuppressive conditions the precore mutation seems not to drastically effect viral replication since a high hbv-dna titer was observed in the serum of one patient after liver transplantation. -whether the lack of hbeag expression is also responsible for the frequent severe and progredient course of infection and the lacking response in interferon therapy is currently investigated with a test specific for precore variant's infection and with animal models. inst. of virology, univ., d- giessen a highly purified nucleoprotein (np) preparation from influenza virus infected cells yielded in addition to the commonly known kd protein a kd component which could not be detected in virus particles. among a series of np-specific monoclonal antibodies some reacted with both proteins and others were only bound by the kd protein. among both types of np-specific monoclonal antibodies only a limited number were bound at the surface of murine cells infected with any type a virus. another category of antibodies bound to cells infected with a given subtype, but failed to react with the surface of cells infected with a different subtype. the results indicate that only restricted antigenic domains of the native np and perhaps np fragments are exposed at the surface of infected murine cells. additionally, the protective capacity of cell-associated np was determined by immunization of mice with the purified np preparation. in parallel, and in order to determine the immunogenic potency of newly synthesized np, mice were immunized with a vaccinia virus recombinant containing the gene for np prior to challenge with infectious virus. although immunized mice produced monospecific antibodies and a cytotoxic t cell response to the employed forms of np, they were not protected from influenza virus infection. the s segment rna of nephropathia epidemica virus (nev) strain hiillniis b was isolated by molecular cloning of the corresponding cdna. therna is nucleotides long with the ' and ' termini being complementary for bases. the viral messengersense rna contains one major open reading frame (orf) with a coding capacity of amino acids encoding a kda polypeptide. compared to the hantaan s segment cdna sequencing there is a nucleotide homology of % and % homology at the amino acid level. many of the amino acid differences are conservative exchanges. the c-termini of the nev and hantaan nucleocapsid proteins are nearly identical. the hydrophilicity profiles are very similar and most of the potential kinase dependent phosphorylation sites have been conserved. in contrast, the following differences are significant: the calculated isoelectric points of the nev and hantaan nucleocapsid proteins are . and . , respectively. the most prominent antigenic determinants predicted by the hydrophilicity profiles are located close to the c-terminus of nev and close to the n-terminus of hantaan virus nucleocapsid polypeptides. -bmft project a. foot-and-mouth diesease virus-infected cells suffer from cytopathic effects. one causative agent is the virus protease c, as shown by transient expression of respective cdna in baby hamster kidney cells. in contrast to other edna-encoded virus proteins c is not detectable by indirect immunofluorescence. it is, however, detectable as de novo synthesized protein hours after transfection by radioimmunoprecipitation. the enzyme is then indistinguishable in size from that found in virus-infected cells, indicating similar autocatalytical release from fused protein. transcription of protease c-encoding edna fragments is inhibited, as well as that of co-transfected fragments which do not encode protease c, as analysed by northern blot hybridizations. the shut off of transcription which is one of the cytopathic effects observed in infected cells correlates thus to the production of active protease c. the inhibitory molecular mechanisms may involve truncation of the nuclear protein histone h at its n-terminus as found by western blotting. this protein is found similarly truncated in virus-infected cells. virusprotein-specific antigenicity and immunogenicity of tissue culture rabies vaccines o. thraenhart, . marcus, and k. ramakrishnan inst. f. med. virologie u. immunologie, univ., d- essen pre-and postexposure treatment with inactivated rabies vaccines prevent rabies virus infection without complications in contrast to vaccines of nervous tissue origin. a considerable diversity concerning virus strains (pm, flury lep, era), cell strains (wi- , mrc- , chick fibroblast, bhk) and concentration procedures (ultrafiltration, ultracentrifugation) exists between vaccines of different producers. the influence of the various criteria on the antigenicity and immunogenicity were tested in in vitro experiments using mono-and polyclonal antibodies against rv proteins with antigen-elisa, western blot and immuneelectronmicroscopy in unfractionated and fractionated vaccines after rate zonal ultracentrifugation. the immunogenicity was tested in vivo by protection induction (pi) in mice, the results were correlated with the virusspecific antigenicity (vps-ag) in tissue culture supernatants. vps-, immunglobulin-specific and functional antibody-(ab) and interferon-(ifn) induction was tested in human vaccinees. -rv glycoprotein (gp) and nucleocapsid (np) concentration in vaccines were correlated with pi in mice. the gp : np ratio was > in tissue culture vaccines in contrast to brain vaccines. the harvest of gp and np in tc depends mainly on the cell strain. the virion-associated : soluble gp ratio is productionspecific. the concentration virion tc vaccines contain gp, np, m, l, which induce in vaccinees an early, high and long lasting vps-, igg specific ab-response; anti-gp and -np is induced as early as - days. ifn-induction is correlated with the applied dosis. no nonresponder was observed and all vaccinees had protecting levels of neutralizing ab from - days onwards and still after year. the frequency and specificity of antibodies to p-gene encoded proteins of human hepatitis b virus was tested in sera of acute and chronically infected patients with and without hepatocellular carcinoma (hcc). for antibody detection an immunoprecipitation gel assay was performed with radioactively labeled polypeptides produced by in vitro translation of rna of different p-gene regions. thus, five antigenic regions were identified. all anti-p antibody positive sera reacted with carboxy terminal p-polypeptides, a subset with polypeptides of the aminoterminal and middle region, and none reacted with p-protein derived from the most sequence variable region. anti-p antibodies were detected at very high frequency in sera of acute ( %) and chronically infected patients without hcc ( %), but less often in hcc patients ( %). anti-p antibodies appear early in infection and decline prior to hbsag/anti-hbs seroconversion. -these data indirectly demonstrate the expression of most hbv p-gene sequences and the high immunogenicity of p-proteins in vivo. moreover, they establish anti-p antibodies as a frequent serological marker of infection and identify the carboxy terminal region of the p-proteins (s) as immunodominant. the human polyoma virus jc produces brain tumors in hamsters. in these tumors jcv tantigen, the major product of the early genes is generally expressed. the protein plays a central role in the regulation of polyomavirus replication. since tissue culture as a major source for t-antigen is limited to human primary fetal glial cells we characterized jcv tantigen in the hamster cell line hjc derived from a jcv induced medulloblastoma. -southern blot analysis revealed the presence of jcv dna in hjc cells. the physical state was predominantly integrated. the transcription of early genes was demonstrated by presence of jcv specific mrna in northern blots. the nuclear localisation of t-antigen could be established by immunohistochemical staining and by immunoprecipitation with a crossreacting monoclonal sv antibody (pab ) a molecular weight of to kd was determined. furthermore from western blot analysis it could be assumed that high molecular forms of jcv t-antigen are present in the hamster cell line. taken together these data demonstrate that the molecular weight and nuclear localization were as expected from sv transformed cell lines. therefore jcv t-antigen in hjc cells shall be used to characterize its dna binding capacity to the origin region of jc virus dna. current laboratory diagnosis of a coxsackie-b-virus (cbv) infection is mainly based on virus isolation, supported by the detection of rising or high virus-specific neutralizing antibody titers. since such high titres have also been found in apparently healthy peopleprobably originated from a subclinical infection and persisting for a year or more -cbv-igm detection may be a more reliable criteria for serological diagnosis. attempts to identify these antibodies in routine context using conventional techniques (nt, immunodiffusion) or solid phase immunoassays (eia, ria, reverse elisa, immunoblot) have failed, despite high sensitivity and specificity, due to high costs or technical disadvantages. in the present study we developed a modified western blot technique (modi-western blot), which enables a rapid and reliable identification of cbv-igm antibodies. in this assay the antigen was electrophoretically separated using an integrated electrophoresis system (phastsystemunit) and transferred to a solid matrix by diffusion blotting. subsequent immunodetection was performed using a biotin-avidin amplification and monoclonal antibodies. to appraise the efficiency of the method human serum samples were analysed for virus-specific antibodies (igm, iga and igg subclasses) to coxsackie-b-viruses. -group specific igm responses could be found in of ( . %) of igm seropositive cases. type-predominant igm antibodies ( / ) were detected in cases against cbv , in cases against cbv and in case against cbv . moreover igg/lga assay in patients seropositive for igg and igm revealed in all cases igg and iga antibodies, which supports the evidence of an acute cbvinfection. improvement of diagnosis of cytomegalovirus (hcmv) infections in immunosuppressed patients by detection of hcmv using a monoclonal antibody directed against hcmv-early d- frankfurt primary or recurrent hcmv infections can cause severe clinical problems in immunocompromised patients. as far as active hcmv infections in these patients are concerned, the diagnostic significance of serological data can be restricted tiel: virology, in press an unsatisfactory reproducibility and comparibility was observed when six available enzyme immune test kits for anti-hbc were evaluated by four german red cross bloodtransfusion centers. only of blood donors were consistently positive, but samples produced discrepant results, although five of the assays used the same inhibition procedure of labeled anti-hbc (caspari et ai., j. clin. microbiol., in press). we reexamined the clearly and discrepantly positive samples of this study (besides some negative controls) by an assay which measures the binding of igg to hbc antigen by peroxidase labeled anti-igg. practically all consistently positive samples were confirmed by the different test principle while practically all discrepant samples were negative. this shows that consistent results by different inhibition assays are indeed reliable while divergent results can be neglected. anti-hbc is used in some countries as surrogate test for hcv carriers. using an experimental test kit from ortho diagnostics, of confirmed anti-hbc positiive and of confirmed anti-hbc negative donors reacted repeatedly as anti-hcv positive. these data do not provide evidence that anti-hbc is useful for elimination of hcv carriers. in this study we compared directly the detection level, sensitivity, and specificity of the most sensitive radioactive and the most sensitive non-radioactive method for detecting hepatitis b virus (hbv) dna in patient serum by dot blot hybridization, based on our previous experience with different assay systems. the former employed the p-labeled hbv rna probe included in the hepprobe kit (gibco-brl), detected autoradiographically. an advantage of this kit is the low level of radioactivity of the pre-labeled probe « f,tc), thereby permitting its use even in those laboratories lacking a license for radioisotopes. the non-radioactive method involved the use of an hbv dna probe sulfonated with sodium bisulfite (chemiprobe kit, orgenics), followed by immundetection and an enzymatic color reaction. the detection level of the p probe was found to be . pg hbv dna, corresponding to x genomes in f,tl serum, compared with only pg with the sulfonated probe. subsequently, sera from patients with various constellations of hbsag, and anti-hbe were tested with both methods. the concordance rate was % (r = . ). compared with p results, sulfonation showed a sensitivity of % and a specificity of %. radiolabeling, therefore, still allows the most sensitive and reliable detection of hbv dna in serum. sulfonation could eventually provide a feasible alternative to radioactivity if the viral dna in serum could be sufficiently amplified in vitro, for example with the polymerase chain reaction. such studies are being planned in our institute. key: cord- -ub p ngr authors: mollenhauer, hilton h.; james morré, d.; rowe, loyd d. title: alteration of intracellular traffic by monensin; mechanism, specificity and relationship to toxicity date: - - journal: nan doi: . / - ( ) -z sha: doc_id: cord_uid: ub p ngr monensin, a monovalent ion-selective ionophore, facilitates the transmembrane exchange of principally sodium ions for protons. the outer surface of the ionophore-ion comples is composed largely of nonpolar hydrocarbon, which imparts a high solubility to the complexes in nonpolar solvents. in biological systems, these complexes are freely soluble in the lipid components of membranes and, presumably, diffuse or shuttle through the membranes from one aqueous membrane interface to the other. the net effect for monensin is a trans-membrane exchange of sodium ions for protons. however, the interaction of an ionophore with biological membranes, and its ionophoric expression, is highly dependent on the biochemical configuration of the membrane itself. one apparent consequence of this exchange is the neutralization of acidic intracellular compartments such as the trans golgi apparatus cisternae and associated elements, lysosomes, and certain endosomes. this is accompanied by a disruption of trans golgi apparatus cisternae and of lysosome and acidic endosome function. at the same time, golgi apparatus cisternae appear to swell, presumably due to osmotic uptake of water resulting from the inward movement of ions. monensin effects on golgi apparatus are observed in cells from a wide range of plant and animal species. the action of monensin is most often exerted on the trans half of the stacked cisternae, often near the point of exit of secretory vesicles at the trans face of the stacked cisternae, or, especially at low monensin concentrations or short exposure times, near the middle of the stacked cisternae. the effects of monensin are quite rapid in both animal and plant cells; i.e., changes in golgi apparatus may be observed after only – min of exposure. it is implicit in these observations that the uptake of osmotically active cations is accompanied by a concomitant efflux of h(+) and that a net influx of protons would be required to sustain the ionic exchange long enough to account for the swelling of cisternae observed in electron micrographs. in the golgi apparatus, late processing events such as terminal glycosylation and proteolytic cleavages are most susceptible to inhibition by monensin. yet, many incompletely processed molecules may still be secreted via yet poorly understood mechanisms that appear to bypass the golgi apparatus. in endocytosis, monensin does not prevent internalization. however, intracellular degradation of internalized ligands may be prevented. it is becoming clear that endocytosis involves both acidic and non-acidic compartments and that monensin inhibits those processes that normally occur in acidic compartments. thus, monensin, which is capable of collapsing na(+) and h(+) gradients, has gained wide-spread acceptance as a tool for studying golgi apparatus function and for localizing and identifying the molecular pathways of subcellular vesicular traffic involving acid compartments. among its advantages are the low concentrations at which inhibitions are produced ( . – . μm), a minimum of troublesome side effects (e.g., little or no change of protein synthesis or atp levels) and a reversible action. because the affinity of monensin for na(+) is ten times that for k(+), its nearest competitor, monensin mediates primarily a na(+)-h(+) exchange. monensin has little tendency to bind calcium. not only is monensin of importance as an experimental tool, it is of great commercial value as a coccidiostat for poultry and to promote more efficient utilization of feed in cattle. the mechanisms by which monensin interact with coccidia and rumen microflora to achieved these benefits are reasonably well documented. however, the interactions between monensin and the tissues of the host animal are not well understood although the severe toxicological manifestations of monensin poisoning are well known. equine species are particularly susceptible to monensin poisoning, and a common effect of monensin poisoning is vacuolization and/or swelling of mitochondria in striated muscle. other pathological injuries to striated muscle, spleen, lung, liver and kidney also have been noted. a consistent observation is cardiac myocyte degeneration as well as vacuolization. differences in cellular response resulting from exposure to monensin (i.e., golgi apparatus swelling in cultured cells, isolated tissues, and plants vs.mitochondrial swelling in animals fed monensin) suggest that myocardial damage is due either to a monensin metabolite or is a secondary response to some other derivation. however, as pointed out by bergen and bates [ ], the underlying mode of action of ionophores is on transmembrane ion fluxes which dissipate cation and proton gradients. consequently, some or all of the observed monensin effects in vivo in animals could be secondary phenomena caused by disruption of normal membrane physiology resulting from altered ion fluxes. monensm, a na ÷ ionophore capable of collapsing na ÷ and h + gradients, has gamed wide-spread acceptance as a biochemical and biologacal investigative tool to study golgi apparatus function and to localize and identify the molecular pathways of subcellular vesicular traffic. among its advantages are the low concentrations at which lntubltions are produced ( . - . #m), a minimum of troublesome side effects (e.g., little or no change of protein synthesis or atp levels), and a reversible action [ ] . the purpose of this review is to examine the mechanism of action and specificity of monensln in na+/h ÷ exchange and to attempt to reconcile tlus to the large body of structural and biochemical information on monensin toxicity derived from animal studies in , pressman and co-workers [ ] reported a class of anubiotics that induced alkali ion permeability in mitochondna and other membranous systems. these antibiotics functioned as lonophores (ion-carriers) to carry ions across hpid barriers as complexes soluble in the hpid phase of the membranes. the potential use of tonophores as probes of biological function, or as potential therapeutic agents, was recognized very early [ ] [ ] [ ] [ ] , but major economic importance was not forthcoming until the discovery of monensin in and the recognlnon of tts potential in the poultry mdustrty as a coccxdtostat [ ] subsequently, ~t was discovered that tonophores also could improve feed converston in rumtnants such as cattle [ , ] , thus adding further to their commercial value of the more than lonophores that have been reported [ ] , three, monensln, lasalocld and sahnomysin, have widespread commercial use of those licensed, monensin is probably used most widely. several monensins have been tdentified [ , ] _ monenstn a, and specfftcally the sodium salt of monensin a (hereafter simply designated as monensm) ts derived from streptomvces cmnamonensts [ ] , and a crude mycehal preparation (rumensm') containing about _ % monensin ts used commercially. the on spectfictty of monensm xs ag > na >> k > rb > cs > li > ca [ , ] with approximately a -fold selectlvry for sodtum over potassium [ ] and little tendency to bind calcmm [ ] i! . one of the original interests in ionophores was their percewed potential for directly modifying intracellular iomc gradients, pamcularly ca +, winch would lead, hopefully, to the development of useful pharmacologic agents or, alternatively, provide a tool for studying cellular functtons medmted by changes m ca + [ , ] . of parttcular interest were divalent xonophores such as x- a (normally considered a ca + ionophore -note, however, x- a complexes na ÷ and k + almost as well as ca +) winch have been shown to mduce contractaon of aortic strips and increase the rate of contractility of tsolated perfused rabbit heart [ , ] , and release ca + from energy-loaded vesicles derived from the sarcoplasrmc renculum of muscle [ ] [ ] [ ] x- a may also mcrease blood flow through coronary artenes and mcrease cardiac output [ ] . the emphasis on heart physiology stemmed from this organ's strong dependence on calcmm for proper functioning [ ] . indeed, subsequent studies of x- a used as a feed additive for poultry and cattle has shown that the heart ~s a primary target for lonophore toxicity [ ] . x- a affects many other cellular functions such as release of b~olog~cally active agents and the induction of sperm acrosome reactions of several species [ , ] . it was soon realized, however, that many of the ionotroplc effects of the divalent ionophores could be duplicated with even greater efficiency by monovalent ionophores such as monensm which complexes na + but almost no ca ÷ tins response apparently occurs because the movement of na ÷ into a cellular compartment by monensin fac~htates the entry of ca + by a na+-out/ca +-ln exchange [ , , , ] . thus, a ca ÷ shaft ts stall the pnmary factor medmtlng cellular responses although other factors may also play significant roles m monensm physiology for example, many tono-phores, either directly or as a result ol the lomc imbalance. may transport, promote uptake, or release effector substances such as serotonm, lustamme, prostaglandm and catacholamlne which, m turn. have profound effects on cellular function [ . ] slmdarly. monensm. through alteration of the ph of mtracellular compartments may lnhlbr the release and/or transport of numerous agents and. in so doing, perturbate cellular function in cardiac tissues, both posmve and negative motroplsm has been observed sequentially (the variable factor being time) m tissues following exposure to monensin [ ] concentrahon of monensln may. also. cause similar posttlve/neganve ,notroptc responses [ , . finally. some monensln mgested b}¢ an animal is metabolized to other tonophores, the properties of which are largely unknown thus, ionophores, in spite of many common characteristics, differ indtvtdually in their effects on cell~ moreover. cells may respond to both direct tonophore interaction as well as secondary effects that develop from the initial ionophore reactions. the latter is partlcularly likely in the whole antmal where metabolites with unknown properties are produced from lonophore breakdown and where changes m the products of one organ can affect the function of other organs_ monensin is an open chain molecule that is capable of ton complexation through a cyclic form stabilized by hydrogen bonding between the carboxyl and hydroxyl groups charge transfer bonding wltinn the cavity formed is responsible for on binding (fig ) _ because the affinity of monensln for na + is -ttmes that for k+. tts nearest competitor in biological systems. bergan and bates [ ] ) the aniomc form of the lonophore is stabilized by the polar environment characteristic to the surface of a membrane_ the ionophore is capable of ion pamng with a metal cation either at the terrmnal carboxyhc acid moiety or at other internal sites the binding of a cation initiates the formation of a hpophahc, cyclic catlon-lonophore complex that can diffuse through the interior of the blmolecular membrane structure_ after traversing the membrane, the complex is again subjected to a polar environment where the electrostatic forces that had stablhzed the complex are no longer greater than the unfavorable gibbs free energy change of cyclzzation the ionophore then releases its enclosed cation and reverts to the low energy acyclic conformation monensin, like other carboxyhc lonophores, binds metal ions through liganding s~tes such that the ions become centrally oriented ( fig. ) and masked from the extraceuular environment [ , , ] . the outer surface of the ionophore-lon complex is composed largely of nonpolar hydrocarbon, which imparts a high solubility to the complexes m nonpolar solvents [ , , ] in biological systems, these complexes are freely soluble in the lipid components of membranes and, presumably, diffuse through the membranes from one aqueous membrane interface to the other [ , ] . once the ion traverses the membrane as a monensin-lon complex, the ion is released, and the monensin molecule picks up a proton to form an undissociated molecule which then retraverses the membrane to release the proton to the outside of the cell, vesicle, organelle, or other subcellular compartment [ ] (fig. ) . thus, the net effect for monensin is a trans-membrane exchange of monovalent ions for protons. the on transfer rates may be very high and can approach, or even exceed, normal enzyme diffusion rates [ ] , although the actual rate may be markedly altered depending on factors such as the concentration of k ÷ m the external medium and the type and concentration of permeant ion that accompariles the accumulated k + [ ] . however, effects of lonophores on cation transport and their distribution among different membrane-bounded compartments within the cell, will vary depending upon the physical and chemical properties of the different membranes. membrane fluidity, thickness, curvature, charge and orientation of polar head groups of phosphohpids, cholesterol content, and protein content, all influence solubihty, penetration, and expression of the lonophore [ ] . moreover, in asymmetric membranes (i.e., biological membranes), ionophores generally exhibit asymmetric transport properties [ ] . for example, kovac et al [ ] showed that both vahnomycm and nigericin (an lonophore similar to monensin) crossed the plasma membrane of saccharomyces cereotslae at a rather low rate but then were preferentially located, and active as ~onophores, m the tuner mltochondrlal membrane. thus, the physiological effects of monensln will depend on the membrane composition and functional characteristics of the different compartments involved. although mechanisms for on transfer through a blmolecular leaflet (membrane) have been proposed, questions still remain as to how this action is related to known effects of monensin on cell function and what relationships these may have, m turn, on blochermcal mechanisms leading to ammal toxaclty. while any consideration of ~onophore action must focus on the mechanism of lonophore interaction with biological membranes [ ] , the complexity of the process and the multiplicity of potentml pathways involved suggests that a single causal mechanism cannot explain both the cellular responses and the clinical expressions of toxic-]ty in animals monensin is cost-effective in increasing the yield of meat from both fowl and ruminants [ ] . in fowl, this increase m productivity is derived almost directly through the control of coccid]a that, if present, would adversely affect animal health [ ] in ruminants, increased product]vity appears to result from several factors, the most obvious being an increase in the effectiveness of feed utlhzation [ , , ] . these whole-animal effects (xe, systems effects) are well documented [ , [ ] [ ] [ ] and will be paraphrased only briefly here. the beneficial effects of monensm in cattle accrue, in part, through shifts m rumen rmcroflora population. for example, gram-positive bacteria (that are primarily acetate, butyrate, h , and formate producers) are inhibited by monensin; whereas, gram-negauve bacteria (many of which produce succinate) are less sensmve to monensm [ ] . the outer layer of the multflayered well of the gram-negatxve bacterium may contribute to this resistance by acting as a barrier to the penetration of [able i adapted from ledger and tanzer [ ] in ~e~retlon reduced secretion procollagen [ ] [ ] [ ] [ ] , fibronectm [ ] [ ] [ ] ] , proteoglycans [ , , ] , prolactln [ ] , alburmn [ ] , transfernn [ ] , promsuhn polypepudes [ ] , larmmn [ ] , a-amylase isoenzymes [ , ] , newly synthesized proteins [ ] , secretory proteins [ ] , proteins for fast axonal transport [ , ] , thyroxine-binding globuhn [ ] , acetylchohnesterase [ , ] , chononlc gonadotropin [ ] , phytohemagglutmm [ ] , very-low-density hpoprotem [ ] , maize rootcap polysaccharldes [ ] (see however, sticher and jones [ ] for lack of monensm effect), vesicular stomatltxs virus glycoprotein [ ] , extracellular matrix [ ] , type ii collagen [ , ] , reviews [ , , ] increased secreuon catecholarmne [ ] , catheps'n d [ ] _ defective processing pro-albumin to serum albumin [ ] , receptors for msuhn and somatatomedin c [ ] , pro-oplomelanocortm [ ] incomplete processing of ohgosacchandes (n-hnked and/or o-linked) myeloperoxldase [ ] , prenv glycoprotexn [ ] ; fibronectm [ ] , hcg subumts [ ] , blocked formation of complex ohgo-~acchandes [ ] , herpes simplex glycoprotelns [ ] , hla-dr-as-soclated mvanant chain [ ] , coronavlrus glycoprotem [ ] , review [ ] undersulphauon proteoglycans [ ] , glycosammoglycan chains [ ] , / -d-xyloside glycosammoglycans [ , ] in endocytosts and endosome actdzflcatton intubitlon of mternahzatlon arylsulfatase [ ] , lmmunoglobulln [ ] , a- -macroglobuhn [ ] , semlikl forest varus [ ] , horseradish peroxldase [ ] inhibition of dlssocmtion of mternahzed hgand asmloglycoprotems [ ] , asmlo-orosomucojd [ ] lnhlbxtlon of hgand transfer smb~s virus nuclear capsids to cytoplasm [ ] , epidermal growth factor, / -hexasamlmdase, low-density hpoprotein, lmmunoglobulin, and proteoglycans to lysosomes [ , , ] inhibition of acldfflcauon endocytlc vesicles [ ] [ ] [ ] , lysosomal and prelysosomal compartments [ ] , interference with semllka forest virus genome penetrauon [ ] , expression of diphtheria toxin [ ] ; recycling of ldl receptors [ ] , release of diphtheria toxin from endocyuc vesicles [ , ] lnhlbltton of mtracellular degradation proteoglycans [ ] , insuhn [ ] , lysosomal (methylarmne-sensxtlve) protem degradation [ ] inhibition of contraction of contractile vacuoles paramecmm aureha [ surface formation and growth altered secretion of cell surface molecules proteoglycan [ , , ] , type if collagen and/or procollagen [ , , ] ; fibronectin [ , , ] , lamlmn [ ] , mcorporauon of sulfaudes into myelin [ ] , incorporation of po protein and myehn basic proteins into myelin [ ] inhibition of scale morphogenesis scales of the green alga pyrarmmonas mconstans [ ] inhibition of cell spreading-cultured fibroblasts [ ] ; mesoderm ceils [ ] stimulation of receptor capping mouse t-lymphoma cells [ ] inhtbltlon of growth rye seedhngs [ ] , pelhu ] transport of molecule.~ recognition of independent secretory pathways acetylchohne receptor and acetylchohnesterase [ ] , membrane glycoprotems/ assembly of uukunlerm virus [ ] , ca +-dependent and ca +-mdependent secretion of a-amylase [ ] , proteoglycan and hyaluronate [ ] , prolactln [ ] ; galactosyl receptor [ ] maturation and/or transport of viral coat proteins vesicular stomatltis virus [ , ] , herpes sxmplex varus [ , ] , semhkj forest wrus [ ] , uukumerm wrus [ ] , alphavtrus [ ] , coronawrus glycoprotean [ ] , bovine herpes virus type glycoprotelns [ ] st~mulatlon of sugar and sugar nucleoude transport avian erythrocytes, isolated rat and mouse dmphragm muscle, and red cells [ , , ] ; mouse thymocytes [ ] redirection of secretory product plasmalemma to tonoplast [ ] inhibition of mtracellular transport: protein to rod outer segments [ ] , myeloperoxtdase [ ] , hcg subumts [ ] , accumulation of lammln [ ] ; gp glycoprotein [ ] , procollagen [ ] , fibronectm [ ] interactions wtth other toxm~ enhancement of toxaclty tlamuhn m swine [ ] , dlsulfide-hnked methotrexate-anti-transferrln receptor conjugate [ ] , specific cytotoxlcxty of a breast cancer-associated antigen lmmunotoxan m humans [ ] reduction of toxicity selenmm and vitarmn e [ ] monensm; although, a more direct influence revolving differenes in membrane energetlcs also has been implicated [ ] monensln also may decrease the degradation of dietary protein in the rumen and, thus, increase the amount of protein avaalable for dlgesuon and uptake in the small intestine [ ] . both a reduction in overall cell numbers m the rumen and a direct effect of monensln on bacterial protelnase and dearmnase activity have been suggested as contributing to this effect [ , ] . one of the first subcellular effects observed in relation to the topical apphcatlon of monensin was vacuolatlon of golgi apparatus clsternae [ ] . subsequently, xn vitro studies clearly demonstrated that monensin altered or inhibited numerous membrane-located phenomena (table i) . among these were the transfer of a -macroglobuhn from coated pits to receptosomes [ ] , recycling of low-density hpoprotem receptors [ ] , pinocytosis [ ] , transfer of product from endoplasmac reticulum to golgl apparatus [ ] , maturation and/or transport of viral coat proteins [ , , , , , , , ] , inhibition of transport of membrane proteins to rod outer segments [ ] , xnhibltion of cholesterol transport from the golgl apparatus to the mltochondnal site of steroidogenesis [ ] , blockage of phytohemagglutinln transport out of golgl apparatus and into protein bodies [ ] , inhibition of procollagen and fibronectm secretion from cultured human fibroblasts [ ] , inhibition of carbohydrate processing in cultured human flbroblasts [ ] , and inhibition of processing and cellular secretion [ , , , [ ] [ ] [ ] . additionally, cellular effects of monensm vary markedly depending upon the organism and the route of adrmnlstratlon. cultured cells, cells of tissue shces or explants, and plant organs that have received a topical exposure to monensin sufficient to inhibit growth or some cellular processes, usually show deviations in golgl apparatus structure and function. in contrast, ceils from animals poisoned by ingested monensin often exhibit gross mltochondrlal lesions without the corresponding golgl apparatus modifications. the reasons for these fundamental differences in cellular responses to monensin provide one focus for the present review and illustrate the many complexities surrounding the use of monensln as a probe specific to a single metabolic process. the primary functional unit of the golgi apparatus is a stack of membranous compartments (i e., the clsternae) each of which differs chemically, structurally, and functionally from the others [ ] [ ] [ ] [ ] . the number of cisternae per stack varies widely; although, in most animal cells and higher plant cells, there are about - cisternae per stack. each stack is polarized in the sense that product and membrane maturation appear to occur sequentially from a cls (fornung) face on one side to a trans (matunng) face on the other side [ ] . for simplicity, the stack may be divided into umts (measured from cis to trans faces) each of which represents a known set of functions. currently, there appear to be some - such units that make up each stack [ , ] . in reahty, however, it seems more likely that these changes in function occur gradually across the stack of clsternae rather than in discrete steps. there is, also, one or more membraneous structures (e.g., the trans golgl network [ ] or tgn and the partially coated retlculum [ ] or pcr) that he just off the trans poles of the stacks in plant cells, these structures appear to be derived from sloughed trans clsternae [ ] . tgn and pcr participate in the separation (i.e., sorting) of both secretion and endocytic products [ , [ ] [ ] [ ] [ ] and regulate the release of endocytosed substances through a ph-sensltlve mechamsm [ ] . the functions of these post-golgi apparatus structures are rapidly affected by monensin. several mechanisms for the movement of membrane and product through the golgi apparatus have been postulated. for example, movement may occur by sequential maturation of golgi apparatus elements (i.e., formation, maturation and loss of cxsternae) through the golgl apparatus stack [ ] . this would require the formation of new clsternae on one face of a golgl apparatus sack and commensurate loss of clsternae from the opposite face of the stack the source of these new clsternae is a special region of endoplasmic retlculum which gives rise to transition vesicles that move and condense on the forming (cls) face of the stack where they fuse together to form the new osternae [ ] [ ] [ ] product movement may also occur by shuttle vesicles at the peripheries of the clsternae that move proteins from one cisterna to the next [ ] . however, both direct (i e., nonvesicular) movement of substances into golgi apparatus cisternae and an endoplasmlc reticulum-mediated movement of product through the penpheral tubules of the clsternae must also be considered as viable options for the delivery and transfer of substances in and out of the golgl apparatus [ ] . the post-golgl apparatus structures appear to move membrane and product almost entirely via shuttle vesicles, many of which are coated [ ] [ ] [ ] monensin exerts its most profound effects on the trans cxsternae of the golgi apparatus stacks in those regions of the apparatus primarily associated with the final stages of secretory vesicle maturation and in post-golgl apparatus structures primarily associated with endocytosis and membrane/product sorting. because of its relative specificity, biologists have used monensln extensively as an inhibitor of trans golgl apparatus function. incorporation of radiolabeled [ s]methlonine into secreted lmmunoglobulin m molecules in monensintreated cells was reduced as was slalylatlon of immunoglobulin m and lymphoid cell surface glycoprotelns [ ] . these latter findings showed that the intracellular processing of n-asparagine-hnked oligosacchandes is altered in the presence of monensln with an effect primarily on those sugars (e.g., slalic acid, galactose, fucose) added late in the processing continuum [ ] flbronectin, secreted in human flbroblasts, was incompletely processed in the presence of monensln and exhibited a greater incorporation of mannose than did control protein molecules [ ] inhibition of fibronectln secretion in human melanoma also has been reported [ ] . similarly, when treated with monensln, rat astrocytes in primary culture accumulated lamimn, another matrix glycoprotem involved in cell adhesion [ ] . not only do the monovalent lonophores block transport and surface expression of several secretory glycoproteins in normal cell functioning [ , , ] and the transport of membrane glycoproteins or enveloped viruses [ , , , , , , , ] , they inhibit formation of cell surfaces including assembly of peripheral myelin [ , ] . in mouse thymocytes, monensin leads to ( stimulated incorporation of labeled sialyl-, galactosyl-, and n-acetyl glycosaminyl residues [ ] . this enhanced accumulation was not due to a &rect effect of monensin on glycosyltransferase activities but, rather, as a consequence of a greater entry and accumulation of labeled sugar nucleotides in the swollen clsternae_ galactosyl transferase itself was translocated through the golga apparatus at a slower rate with monensin_ however, the sialylatlon of the o- nked ohgosaccharides of the enzyme was unaffected by monensln treatment [ ] effects of monensin on glycosyltransferases also may be indirect. monensin has been reported to decrease galactosyltransferase activity m golgl apparatus of rat embryo fibroblasts [ ] although it had no effect on this activity in baby hamster kidney cells [ ] monensln is an especially useful inhibitor, since it blocks lntracellular transport of protein at the level of the golgl apparatus without directly affecting protein synthesis [ , ] the effect of monensin is considered to be on transport rather than on processing per se [ , ] one argument is that oligosaccharide processing of those glycoprotelns that reach the appropriate site occurs normally even xn monensin-treated cells [ , , , ] . however, these observations could be explained as well if processing of ollgosacchande chains of different secreted glycoprotelns occurred at different sites, only some of which were sensitive to monensln [ , ] . the ablhty of monensln to effectively 'freeze' processing of molecules at a particular stage had lead to its use in identifying transitory synthetic intermediates. examples include the insulin receptor where several polypeptlde precursors have been described [ ] , the intracellular accumulation of non-cleaved precursors of pituitary hormones that occur in the presence of monensin [ ] , and dissection of the pathway for secretion of gonadotropin by cultured human trophoblastic cells [ ] . in some instances, the effect of monensin may be to redirect, rather than block, the movement of golgl apparatus-derived product. for example, under normal conditions, proteins of developing seeds accumulate in a central vacuole which then partitions into smaller units of storage protein (i.e, the protein bodies). however, when treated with monensin, the golgi apparatus-derived transport of the protein vlclhn in pea cotyledon was redirected from the vacuole to the plasmalemma and the newly synthesized viclhn was released from the cotyledon cells to accumulate between the plasmalemma and cell wall [ ] monensin lnhibmon of golgi apparatus function ~s sufficiently well established [ , , , ] that the phenomenon is used widely as one criterion for verifying the passage of a biochemical entity through the golgi apparatus. thus, based on partial monensm inhibition, hammerschlag and co-workers [ , ] concluded that passage through the golgl apparatus was an obllgator~ step m the lntracellular routing of materials m ta,~t axonal transport_ bartalena and robblns [ ] showed that rnonensin ~mpeded the exit of thyroxin-binding globulin from the golgj apparatus w~thout affecting the terminal glycosylatlon of the protein yanagashito and hascail [ ] reported that monensin reduced and delayed transport of both secretory and membrane-associated forms of proteoglycans, suggesting passage through the golgl apparatus of rat ovarian granulosa cells m culture similarly, an involvement of the golgi apparatus m the transport of sulfatldes to myelin [ ] and phytohemaghitlnln to protein bodies m bean cotyledons [ ] were deduced from monensin mhlbmon fhckinger and co-workers [ ] using [ h]leucine, showed that all, or nearly all, of the protein secretory product of mouse epididymis principal cells pass through the golg~ apparatus in times approximately eqmvalent to those reported m other tissues. this transfer of product from golgi apparatus to the cell surface was largely blocked by monensin swelling of golgi apparatus cisternae observed in the electron microscope following fixation with glutaraldehyde is, perhaps, the most consistent visual in vitro demonstration of a monensin-mduced effect on a membranous cell compartment [ , , , , [ ] [ ] [ ] the swollen clsternae usually appear devoid of contents by electron microscopy (figs. and ) but an electron-dense substance may be precipitated through the osmium tetroxlde-zmc iodide reaction (unpubhshed data) although all clsternae of the golgi apparatus may swell in response to monensin ( fig. and a) , the major effect appears to be associated with the mature, or trans, parts of the golgi apparatus stacks (figs and b) [ , , ]_ gnffiths and co-workers [ ] showed that monensm inhibited the transport of viral membrane proteins from medml to trans golg~ apparatus cisternae, thus indicating a monensln block between medial and trans cisternae monensm also blocked tlamrmng of the high mannose bound to the viral membrane proteins and their conversion to complex ohgosacchartdes similarly, niemann and co-workers [ ] found that monensm blocked glycosylation of e glycoproteln of corona virus in infected mouse cells. srinlvas and co-workers [ ] reported failure to process simple endo-h-sensitive to complex endo-h-reslstant ohgosacchandes and reduced efficiency of cleavage of the prenv glycoprotein precursor to gp for evehne mouse cells infected with friend munne leukemia virus these findings indicate a block prior to entry into the golgl apparatus also, m cultured hepatoma cells, transport of vesicular stomatltis wrus (vsv) g protein was arrested prior to acquisition of endo-h resistance, suggesting a block early in the processing pathway [ ] . strous and co-workers [ ] showed that monensin affects primarily the galactosyltransferase-containlng c~sternae of the golgi apparatus based on studies of the metabohsm, localization, and biosynthesis of n-and o-linked oligosaccharides of galactosyltransferase in helz cells. the accumulation of incompletely processed glycoproteins indicates either an up-stream accumulation of secretory materials behind a golgl apparatus blockage by monensm [ ] or a monensin block near the exit site from endoplasmlc reticulum [ ] . monensin effects on golgi apparatus have been observed in a wide range of plant and animal species and appear to be a universal response to the topxcal applicatton of monensln. as pointed out above, monensln action is exerted on the trans half of the stacked clsternae (fig ) , often near the point of exit of secretory vesicles [ , , , , , , ] or, especially at low monensm concentrations or short exposure times, sometimes m the rmdreglon of the stacked cisternae [ , ] . intracellular transport may be blocked [ , , , , , ] , often wlthxn rmnutes after exposure to monensln [ , , , , ] . swollen units usually accumulate near the golgi apparatus [ , ] a monensm effect is quite rapid in both animal and plant cells; e, changes in golgi apparatus have been observed after only - rmn of treatment [ , , , ] . these early effects have been documented particularly well is suspension cultures of carrot (daucus carota l ) [ ] . when carrot cells were exposed to monensln at - m (which is approxamately the minimum concentration that will elicit a strong monensm response m plants), production of secretory vesicles ceased and, almost immediately, an increased number of clsternae in the dlctyosome stacks was observed. an average of one additional clsterna per stack was formed within the first - mln of monensin treatment and, in some experiments, a second clsterna was formed within about man. these effects occurred without significant swelling of cisternae. thereafter, vacuoles, representing intact swollen clsternae, began to accumulate in the cytoplasm at a rate of about one every - min (fig. ) . the mechanism postulated for this momentary increase of d~ctyosome clsternae was that monensln, acting on the trans pole of the dictyosome, blocked normal formation [ ] for details of procedure) the two samples differed onl~¢ m that the one dlustrated m {a) was adjacent to a 'natural' ( e_ uncut) surface of the hver lobe, whereat (b) was from a cell near the 'cut' surface of the tissue slice in both instances, come golgx apparatus (ga) clsternae were sv~ollen, however, m (a) swelling was progresse~e from cls to trans pole (direction of arrow) whereas m (b) swelling was t.onfined to the trans c~sterna note that m~tochondrm (m) were condensed of secretory vesicles but did not block the formation of new clsternae at the cis face of the apparatus however, as the trans clsternae began to swell, the swollen clsternae were eventually released as intact units that neither fragmented nor integrated (fused) with other cellular constituents (e.g., plasma membrane). with the scale producing green alga pyramimonas lnconstans, exposures of to several hours to monensln resulted m disorientation of the golg~ apparatus and disruption of scale morphogenesls [ ] . these effects were reversible more recent studies indicate that a similar pattern of swelling and accumulation of clsternae in the cytoplasm occurs in cultured animal cells [ ] . when h- hepatoma cells were treated for varying times with ~ to m monensin, one swollen clsterna per stack of clsternae was produced after - rain of treatment during tlus time, approximately one additional clsterna per stack was formed (fig. , inset) . as the clsternae veslculated, vacuoles began to appear m the cytoplasm these large swollen vacuoles were formed at the rate of one sin concentrations, the vacuoles were larger and appeared more rapidly than at low concentrations of monensln but the kinetics of vacuole formation were qualitatively similar. however, by h following treatment with - m momensin, all clsternae of the golgi apparatus appeared as vacuoles. the swollen trans compartments that accumulate in the golgl apparatus region with monensln inhibition may contain regmns that are clathrin coated; e.g., condensing secretory material (prolnsuhn) in pancreatic cells [ ] . the response of golgi apparatus of hver slices to monensin was qualitatively similar to that with hepatoma cells in culture [ ] . with liver shces, a fraction enriched in vacuoles was isolated and demonstrated to contain the trans golgl apparatus markers, galactosyltransferase, and thiarmne pyrophosphatase, in ratios sirmlar to those of golgl apparatus proper [ ] . in barley aleurone layers, the a-amylase and acid phosphatase activities that accumulated within aleurone cells following treatment with monensin, were localized in cellular components with buoyant densities intermediate between endoplasrmc reticulum and mitochondria and cosedimented with latent inoslne diphos-phatase activity, a putative golgi apparatus marker in plants [ ] . heupke and robinson [ ] reported a shift to higher density of golgi apparatus membranes from monensin-treated barley cells, a response no obvious from work with mammalian cells. the golgi apparatus clsternae that accumulated behind a monensin block in semlikl forest virus-infected bhk cells bound viral nucleocapsids, and the resulting increase in density permltted their separation by gradient centnfugatlon from other golgi apparatus elements [ ] . the effects of monensin on golgl apparatus, at least up to several hours of exposure, appear to be fully reversible [ , , , ] in carrot cells, normal secretory activity was resumed within nun after transfer of cells to a monensln-free medium; although, in these cells, the vacuoles formed during the monensln block, remained in the vicinity of the golgi apparatus for several hours or more, even after apparently normal secretory activity had resumed however, with the longer treatment times of several hours [ ] or days [ ] monensin apparently causes swelhng of golgi apparatus cisternae through a na+-in/h+-out exchange across the membranes leading to a net uptake of na ++ ci and entry of water [ , ] evidence in support of this concept was provided by studies with isolated chromaffin granules which lysed readily after brief exposure to monensln in na +-or k+-contalnlng isotomc media for swelling to occur, the membrane must normally be lmpermeant to cations as is known for the chromaffin granule_ the chromaffln granule membrane contains a h+-atpase which is electrogenexc and, in the presence of a permeant anion, acidifies the granule interior to ph _ thus, the operation of this pump in the presence of monensin drives net salt uptake [ ] . to test whether net salt uptake driven by the presence of a proton gradient also would explain the monensininduced swelling of golgi apparatus cisternae, wild-carrot cells in suspension culture were treated with drugs and inhlbltors known to interfere with proton gradients [ ] monensin-induced swelling of golgl apparatus in sjtu could be inhibited by the protonophore, carbonylcyanlde-p-trlfluoromethoxyphenylhydazone (fccp), but was only little affected by the inhibitor of lysosomal acidification, quercetln, or by the lysosomotropic amines, chloroquine, and ammonia. cyanide also dramatically decreased swelling, and arsenate (with prolonged treatments) reduced the number of swollen cisternae organic acids, by providing a readily permeable counterlon, promoted monensln-lnduced swelhng these data imply that the monensin-induced swelling of golgi apparatus cisternae involves a proton gradmnt at or near the mature poles of the golgi apparatus because monensin induces a " na+/h + exchange, and since the van't hoft factors for h + and na + are practically the same [ ] , the osmolanty of the cell content should not increase to cause swelhng without a net proton influx one explanation would be that the ph of golgi apparatus vesicles is highly regulated proton translocatlng atp hydrolyzing enzymes (h +-atpases) are associated with several components of cells that develop acidic intermrs such as endosomes, coated vesicles, lysosomes, and trans golgl apparatus clsternae [ ] . ewdence for the presence of an h +-atpase has been the demonstration of atp-dependent vesicle acxdlflatlon in golgl apparatus isolated from rodent liver [ ] [ ] [ ] , corn coleoptlles [ ] , and sycamore cells [ ] acldificatmn was demonstrated both by [lac]methylamlne uptake and by spectrophotometric assays of amd-quenched dye fluorescence (acridine orange, neutral red, or quinacrme) several lines of evidence confine the golgi apparatus h +-atpase to the trans cisternae. as emphasized in the preceding section, the early in sltu effects of monensm are frequently localized to the trans faces of the golgl apparatus the resultant swelling, whmh is proposed io be due to the accumulation of osmotically active ions in exchange for protons [ . ] , occurs predominantly m trans clsternae additionally, a basic congener o] dmltrophenol ( -( , -dlnitroanlhn o)- '-amlno-nmethyldlpropylamine, damp), which concentrates m acidic compartments as shown in fibroblasts by lmmunocytochemlstry is present onl) clsternae and vesicles associated with the trans faces of the golgl apparatus [ ] moreover, damp rapidly leaves these compartments when cells are incubated with monensm, thus further indicating that accumulation of damp is due to the acid ph some involvement of a low ph compartment is evidenced by the observatmn that some monensln effects on processing, ke, proteolytlc conversion of proalbumln [ ] , are mimicked by amines however, in promyelocytlc leukemia cells, processing of myeloperoxldase, while blocked by both monensln and chloroqulne, was not affected by nh~ cations, thus indicating that processmg is not necessarily influenced by ph-dependent mechanisms [ ] these results were interpreted as indicative of processing in golgl apparatus based on inhibition of transport by monensin and chloroquine rather than processing m lysosomes and other late, acidic compartments involving a ph-dependent mechanism [ confirmatmn of a trans location of the h ~-atpase has come from free-flow electrophoresis separations of golgl apparatus yielding cls, medial, and trans compartments m fractions of diffenng electrophoretic mobility [ , ] _ in these separatmns, proton pumping activity was found exclusively in the most electronegative fractions coming from the trans-most goigl apparatus re-gion_ gnfflng and ray [ ] have offered the suggestion that acldificatmn of clsternal lumlna may be part of an osmotic mechanism to compress and flatten the cisternae the latter, for example, might aid in the transfer of content into secretory vesmles. the inward pumping of protons would tend to favor the exit of na + and k + out of the clsternae furthermore, as the ph falls, those monovalent cations remaining would tend to combine with acidm groups of the golgx apparatus membranes, further reducing the osmolanty of the clsternal content relative to that of the external cytoplasm. thus, water would be driven osmotically out of the clsternae to both compress the clsternae, as seen along a pronounced cls to trans gradient for plant golgl apparatus [ ] , and, perhaps, to account for the condensation of secretory materials m condensing vacuoles and other trans golgi apparatus compartments (e.g, ref ). other cell compartments, including endocytic vesicles [ , ] , lysosomes [ , ] , multivesicular bodies [ ] , and coated vesicles [ ] [ ] [ ] have h+-atpases. all use h+-atpases to acidify their interiors and the enzymes responsible have been solubdized from lyso-somes and reconstituted into liposomes [ ] . vacuole (tonoplast) membranes [ ] , and possibly also plasma membranes of fungi [ ] , contain h÷-atpase. similarly, a gradient of acidification within the endocyuc pathway has been indicated from immuno-electron microscopy with protein a-colloidal gold and monospecific antibodies to the weak base pnmaquine [ ] . however, not all compartments with h+-atpases (e.g., cells, vacuoles, lysosomes, coated vesicles) swell in response to monensin. cell and/or vacuole swelhng may be hmlted due to the very large internal volumes revolved. the contracnon of contractile vacuoles of paramectum was inhibited reversibly by monensin and in a manner dependent upon the presence of na + [ ] but marked swelling was not observed. little is known about the swelhng response, ff any, of lysosomes, coated vesicles and other endocync compartments m response to monensin lntubition. their functions, however, are inhabited by monensin as will be emphasized in the section that follows. carboxyhc lonophores strongly inhibit proton uptake by photosynthenc preparations [ ] . in chloroplasts, swelling of thylakolds (inner membrane compartments) but not of the space between tuner and outer plastld membranes has been observed to result from monensln treatment [ ] . thylakold swelling, in contrast to swellmg of mitochondrial cristae and of golgl apparatus clsternae, was reduced upon mcubanon in darkness, again suggesting a relationship between swelling in the presence of monensln and the hght-driven proton gradient used for photophosphorylatlon [ ] mltochondrla have an outwardly directed energy-hnked proton pump and do not swell with monensln (rather, they tend to condense, see figs. , a and b) while the light-driven proton pump of chloroplasts and chromatophores, and that of the golgi apparatus pump, are directed reward causing the vesicles to swell. evidence for a secretory pathway bypassing the golga apparatus in the monensln-blocked cells is provided by kubo and pigeon [ ] who lnvesngated the effects of monensin on the synthesis and expression of membrane igm of a human lymphoblastold hne. they found altered processing of both /l, k chains and incomplete terminal glycosylations. yet, transport of the altered molecules was observed. that the aberrant processing did not influence markedly the membrane expression of the igm is consistent with a secretory pathway bypassing the golgl apparatus m monensin-blocked cells. slmdarly, a dual secretory pathway, only one part of which was suscepnble to monensin, was deduced from studies of a-amylase secretion m rice seed scutellum [ ] . in zea majze roots, monensln lnhib~ted secretion of aamylase but not polysaccharide slime [ ] . the blocked secretion that results m the intracellular accumulation of secretory products frequently is not absolute. some portion of the material synthesized is released from the monensm-mhabited cells and this material frequently exhibits an abnormal type of posttranslational modification. for example, those proteoglycans from chicken embryo chondrocytes secreted m the presence of monensln are vastly undersulfated [ , , , ] . thus, membrane and secreted molecules leaving the cell following a monensin block appear to have been denied the full range of processing enzymes they would normally encounter during transit through the cell however, whether the incompletely processed molecules bypass one or more parncular lntracelhilar compartments (eg, the golgi apparatus), or whether they pass through functionally incomplete compartments, remains to be determined. during maturation of uukunieml virus m baby hamster kidney cells, monensin appeared to mhibit a terminal step of virus assembly, but not the expression of virus membrane glycoproteins g and g at the cell surface. these findings suggest that both g and g could enter a functional transport pathway in the presence of monensm that bypasses the trans golgi apparatus compartment to become expressed at the cell surface [ ] . evidence for a golgi apparatus bypass has been presented m liver where secretory hpoproteins may move directly from endoplasnuc reticulum to the cell surface without direct golgl apparatus involvement [ , ] . at concentrations of - m or higher, monensin inhibited secretion of albumin, transferrln, and vsv proteins g and x destined for delivery to the cell surface to the same extent m rat hepatoma cells [ ] . this was taken as evidence that the same vesicles were used by all four proteins m their movement from golgl apparatus to the plasma membrane however, the time required to move from er to the golgi apparatus, based on sensitivity to endoglycosidase h, differed for secretory and membrane proteins. an even more striking observation was that following the monensm block, secretory proteins accumulated in an endo-h-sensitive form, whereas, membrane proteins were already endo-h-resistant. this strongly implies that membrane and secretory proteins are not m the same compartment initially and would support the concept of peripheral input of secretory proteins into the secretory vesicles of the golgi apparatus, at least in hver [ , , ] alonso and compans [ ] provided evidence for two distract pathways of glycoprotein transport in madin-darby canine kidney (mdck) cells only one of which was blocked by monensm however, in baby hamster kidney (bhk ) cells, both influenza virus and vsv maturation were sensitive to monensin. the vsv particles were synthesized m both mdck and bhk cells, but transport to the cell surface was blocked only in the mdck cells thus, there appear to be two distinct pathways of transport of glycoproteins to the plasma membrane in mdck cells, only one of which is blocked by monensln there is no information on the nature of the alternative transport vesicle that carries mfhienza virus to the cell surface of mdck cells if, in fact, a vesicle is involved. melroy and jones [ ] reported accumulation of normally secreted a-amylase within barley aleurone layers after monensln treatment. however, only isozyme was secreted normally whereas isozymes , and were not secreted also, in the perfused rat hver, monensin treatment has less of an effect on blliary secretion than on secretion of plasma proteins [ ] . sn-nllarly, in the transport of hla-dr a-and / chains [ ] , processing of n-linked carbohydrate chains to full endo-h resistance occurs however, with the associated i-chain, processing of both o-and n-linked carbohydrate chains ~s inhibited, and carbohydrate chains remain predornlnantly endo-h susceptible. here, the processing of membrane-associated proteins that occurs despite a monensln block may reside in intercalary clsternae that constitute the golgi apparatus region recently termed medial [ a ] there is now considerable evidence for monenslnsusceptible compartments in the endocytotic pathway. transfer of product to secondary lysosomes [ ] as well as virus penetration into cultured cells [ ] are impaired by monensm. stein and co-workers [ ] have shown that monensin blocks transfernn recycling by causing internahzed hgand to accumulate in the perinuclear regmn, primarily in multivesicular bodies, of the k cells used in the study. based on studies of hrp uptake in rat fibroblasts, wilcox and co-workers [ ] suggested that inhibition of endocytic events may be the consequence of an inhibition of membrane recycling within the cell rather than a direct effect of monensin at the cell surface. maxfleld [ ] reported that ~tm monensln resulted m an mcrease in internal ph of endocytic vesicles of cultured mouse fibroblasts from to above to account for its effects on receptor-mediated endocytosis similarly, marsh and co-workers [ ] concluded that the lnhlbmon of semhki forest virus penetration into cultured cells was the result of this increase in ph of endocyuc vacuoles and lysosomes above ph , the threshold for fusion activity of viral membranes monensln has also been shown to inhibit lysosomal degradation of protein by affecting lysosomal ph [ ] and to abolish aslaloglycoprotein degradation in cultures of rat hepatocytes through a ph shift in prelysosomal endocytlc vesicles [ ] . using digttal image analysis, tyco and co-workers [ ] showed that monensin raised the ph of endocytic vesicles in cultured human hepatoma cells and caused a hgand-lndependent loss o! receptors in other studies, monensln did not prevent lnternahzatlon of s-labeled proteoglycans by rat ovarian granulosa cells although their lntracellular degradation was completely inhibited [ ] . yet, degradation pathways involving proteolysls of both dermatin and heparln sulfate and limited endoglycosldlc cleavage of heparln sulfate continued_ these findings, while consistent with an involvement of both acidic and nonacldlc compartments, show that monensm inhibition is primarily on those processes that normally occur in acidic compartments such as endosomes or lysosomes by raising their ph. sirmlarly, with isolated hepatocytes, whittaker et al [ ] found no effect of monensin on insulin internalization but, rather, an impairment of ~ts degradation once lnternahzed. rustan and co-workers [ ] suggested that monensm inhibits both endo-and exo-cytosls by a similar mechanism, namely, disruption of proton gradients their conclusions were based on studies of rat hepatocytes in which monensm inhibited both secretion of very-lowdensity hpoprotelns, and binding and degradation of aslalofetuin both secretion and receptor binding were markedly decreased after only rmn of monensin treatment although no effect on protein synthesis was observed. however, secretion was more sensitive [o monensln than endocytosis, suggesting that monensin independently intubits endocytlc and secretory functions although the mechanisms may be similar. marnell et al [ ] explained the monensin block of the cytotoxic effect of &ptheria toxin on a sirmlar basis following endocytosls of the toxin, the toxin was assumed to penetrate the membrane of the endosome and enter the cytoplasm in response to an acid environment by neutralizing the ability of endosomes to acidify their interiors, monensin, like the lysosomotroplc amines, was able to block the low ph-dependent dissociation of receptor-hgand complexes and subsequent release of ligands either to the cytoplasm (viruses and toxins) or to lysosomes (endocytosed proteins such as ldl). this in turn would prevent recycling of receptors and membrane and eventually bring endocytosls to a halt due, not necessardy to an inhibition of the uptake processes per se, but perhaps, to blockage of an internal step very similar to that believed to be blocked at the goln apparatus. also consistent with sirmlar modes of monensin mhibition in processing both endocytlc and exocytic vesicles are findings that a single mutatmn in chinese hamster ovary cells impaired both golg¢ apparatus and endosomal functions in parallel included were the monensin sensitive steps of virus and toxin penetration from endosomes into the cytoplasm and of golgl apparatus-associated maturation of smbis virus [ ] . the alterations correlated with losses of atp-dependent vacuole acidification as if the atpase of endosome and golg~ apparatus shared a common genetically regulated subunit. ono et al. [ ] studied a monensln-reslstant mutant of mouse balb/ t cells which also proved to be a poor host for either vesicular stomatltis virus or semllkl forest virus multiplication. the mutant cells resistant to monensln, bound virus normally and contained acidic compartments. however, movement of virus from the cell surface to the endosome and lysosome compartments was extremely slow. thus, the ablhty of monensln to block processing of endocytic vesicles by making prelysosomal compartments less acidic, suggests a mechanism for perturbation of endocytosls based on its ionophorlc properties the mechanism could be slmxlar to the monensm-medlated exchange of monovalent alkah tons for protons that induces, by osmotic means, the observed swelhng of golgl apparatus clsternae. clearly, monensm does not interfere with the uptake and binding of particles at the cell surface. monensm is ineffective against activities that occur at the cell surface. hedm and thyberg [ ] showed that uptake of igg prebound to the cell surface was unaffected by monensln similar findings have been made in studies of receptor-medmted endocytosls of various other ligands [ , , ] . however, monensm may secondarily affect mternahzation through depletion of monensln-sens~tive receptor sites at the cell surface. this would occur if the cell surface receptors are recycled back into the cell and then blocked in the post-golgi region by monensin so that they could not return to the cell surface [ , , ] . thus, monensin inhibition of endocytlc events seems to be at the site of transfer from endocytlc vesicles to lysosomes [ , , , ] or, in monensin-sensltive endosomes, inhibition of the dissociation of ligand-receptor complexes [ ] most animal cells show a dose-related response to monensm that falls off rapidly at monensm concentrations less than - m consequently, most studies of monensln effects use monensin concentrations of - m or higher however, a few reports indicate a cellular response at monensm concentrations less than - m for example, receptor capping by lymphocytes is stimulated by low concentrations of monensin in the range - to - m and inhibited by monensm concentrations above - m [ ] cultured adrenal chromaffin [ ] and heart [ ] cells also are stimulated by low concentrations of monensln. though these effects occur at concentrations below the threshold effects for most golgl apparatus responses, they still presumably result from increased levels of cytoplasmic sodium due primarily to the ~onophore insertion at the plasma membrane fig (a) outer cap cells from a control (nontreated) maize root txp preserved by freeze-subsututlon [ ] . the form of dlctyosome (d) was normal and slrmlar to that following glutaraldehyde/osmlum tetroxade fixation (b) same except that root tip was treated for h with -s m monen~m before being preserved by freeze-substitution. the trans clsternae and/or secretory vesicles (arrowheads) were swollen, and mltochondna (m) were condensed (compare with mltochondna of a) w, cell wall, v, central vacuole swelling of golgl apparatus clsternae occurs in a wide range of plant and animal cells (see subsection iii-b ) and may be a universal response to monensln poisoning. however, in plants, and to a lesser extent animals, swelhng is influenced by the fixative used to preserve the cells specifically, morphological evidence of swelhng is less (in animal golgl apparatus) or nonexistent (in plant golgl apparatus) when the tissues are fixed in potassium permanganate as compared to fixation in ghitaraldehyde/osmium tetroxade [ ] . these effects could be due either to fixation artifacts or to differences between plant and animal golgl apparatus (e.g, ref_ ) this problem was evaluated by comparing the images of golgl apparatus preserved by various chemical fixatives as well as preservation by freezing and low temperature substitution in acetone and osmium tetroxade. presumably, the image following freeze sub-stitutlon would reflect the true ultrastructure more closely than the image following chemical fixation. the results of freeze substitution in both animal cells [ ] and maize root (figs a and b) , show swollen golgi apparatus c~sternae following monensln exposure in a pattern similar to that observed after glutaraldehyde/ osmium tetroxide fixation [ ] . however, using videoenhanced light microscopy and cultured bovine mammary epithelial cells, a marked swelling response to monensln was observed only after the addition of glutaraldehyde fixative to the monensln-incubated cells (morr , d j., mollenhauer, h h., spring, h., trendlenberg, m, morr , d m. and kartenbeck, j, unpubhshed data)_ thus, whether monensin-lnduced swelhng occurs m vlvo or is in response to aldehyde fixations remains an important questiion. no swelling was observed in golgl apparatus of protoplasts of carrot cells freshly prepared by digestion of cell walls when exposed to monensin even though such a response was obtained in the same cultures prior to wall dissolution [ ] . similarly, in thin slices of hver incubated in monensin, the golgl apparatus adjacent to cut edges of tissue slices showed a different swelling response than golgl apparatus adjacent to the uncut natural surfaces of the lobe (unpublished data) adjacent to a cut edge, fewer cisternae swelled and those that swelled were only in the most trans positions the basis for such differences is unknown but might, for example, indicate changes in cisternal proton pumping ability, or monensln uptake, in response to changes in the physiological state of the golgi apparatus brought about by the tissue excision the mechanism by which monensin interacts with coccldla and rumen rmcroflora is well documented [ , ] however, the interaction between monensm and the tissue of the host animal is less well understood even though the chnlcal manifestations of monensln poisoning are well known_ most striking are differences between the in wtro monensln effect ohserved in cultured plant and animal cells, and plants, and the in vwo effects observed m animals when used at recommended levels, either as a coccidlostat for poultry [ , ] or for cattle [ , , ] , monensin seldom causes poisoning nonetheless, misuse of the product, usually from improperly mixed or improperly distributed feed, may cause toxlcosis and death [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] [ ] . horses, ponies and other equine species are particularly sensitive to monensln poisoning [ , . ] . the median lethal dosage (ldso) for the horse js - mg monensin per kg body weight compared to - mg per kg body weight for cattle and mg per kg body weight for poultry [ , , ] in mammals, the physical signs of monensln toxlcosls commonly include anorexia, diarrhea, depression, sweating, ataxm, palpitations of the heart, and sudden death following exercise [ , , , , [ ] [ ] [ ] [ ] stiffness of hindquarters and swollen gluteus muscles [ , ] , elevated pulse rate [ , , ] , and ecg abnormalities [ , , , ] also have been reported in fowl, the outstanding signs of monensln toxlcosls are drowsiness, excessive thirst, anorexia, depression and paralysis [ , , ] marked congestion in a variety of organs also has been noted [ ] severely poisoned birds may die in sternal recombency [ ] . routine clinical tests on serum from horses poisoned by monensm may show abnormally high values for blood urea nitrogen, total billrubin, creatlne kinase, lactate dehydrogenase and aspartate armnotransferase [ , , ] however, chnlcal manifestations are often variable makang interpretation and diagnosis difficult. moreover, serum levels of sodium, potassium, chlorine, calcium, phosphorus, and urea may remain at near-normal levels following monensin treatment [ ] _ in poisoned mammals and fowl, generalized congestion, hemorrhage, and macroscopic injury to striated muscle [ , , , ] , spleen [ , ] , lung [ ] , liver [ ] , and kidney [ , , , , ] have been noted. the most consistent macroscopic observation in ponies, cattle, pigs and fowl, has been cardiac myocyte degeneration and vacuollzatlon [ , , , [ ] [ ] [ ] [ ] [ ] [ ] [ ] in animals poisoned with relatively high doses of monensin, an initial condensation of heart mltochondria is often seen (fig ) however, with longer exposure times, some mitochondria swell and vacuolate with an almost total loss of matnx substance (fig ) _ intracnstae spaces generally remain unchanged with swelling being restricted to the mitochondrial matrix this is followed by loss or dilution of matnx components and a reduction in size of cnstae so that the rmtochondna appear as empty vacuoles with residual cristae typically, only some mitochondrla in a particular fiber become swollen and appear as vacuoles, and fig section of left ventricle from a rat treated wath a single mtraperitoneal mjecaon of mg monensm per kg body weight most rmtochondna (m) were either condensed or swollen in swollen rmtochondna, cnstae (arrowheads) were greatly reduced in extent but, otherwise, were of approxamately normal ttuckness thas dosage level (e_g, mg monensln per kg body wexght) is quite tugh for rats and often resulted m significant generahzed damage to the muscle fiber as dlustrated in the lower part of the rmcrograph however, rmtochondnal swelhng (but not condensauon) may occur as well at lower monensln dosages, even when no fiber damage can be identified ultrastructurally swelling and vacuohzatlon of mltochondna are progresslve with time whereas rmtochondnal condensation was dose-dependent and often occurred rapidly , a few were normal (arrowhead), but most were rmldly condensed swollen tmtochondna always appeared randomly distributed through a fiber although significant differences m rmtochondnal swelling were often noted between fibers (e g, see fig_ ) these are randomly distributed throughout the fiber (fig. ) . we have identified early stages of mitochondrial vacuolation and swelling in both the rat and pony (unpublished data), but these mitochondria were seldom plentiful, suggesting that transition to the vacuolated state, once started, was relatively rapid non-swollen mitochondria may appear condensed, especially after exposure to high levels of monensin ( fig. and ). granulation of mitochondna ( fig. ) was observed only occasionally and those granules that were present appeared similar to the tncalclum phosphate granules often associated with normal mitochondria [ , ] . however, whether monensln-lnduced granules contain ca ~ has not been determined. granules like these have been observed in lschermc and reperfused hearts and are considered indicative of calcium overload [ ] [ ] [ ] [ ] _ ca + overload may be a potential cause of cell death or cellular dysfunction in ischerma [ , [ ] [ ] [ ] [ ] [ ] [ ] although the effects are reversible if the cell is not too severely damaged [ , ] exaggerated matochondrial swelling has also been observed immediately following reperfuslon of hearts rendered lschemlc by occluding blood flow for a few minutes [ , ] whether excess mitochondrial ca + occurs as a result of monensin is not clear under appropriate condiuons, either monensin or na + in excess can block ca + accumulation and promote its release from both mitochondrla and sarcoplasrmc reticulum over a broad range of monensin and na + concentrations [ , , ] it is probable that the release of ca + by monensln can occur as the result of an increase in cytoplasmac na + from a monensin shuttle although monensin (at relatwely high concentrations) has been shown to release ca + directly m a na+-lndependent manner from cardiac sarcoplasmic retlculum [ ] in all probability, however, monensin is not present in myocytes at high concentrations since swelling of golgl apparatus cxsternae (a characteristic response to monensin) ~s never observed in these cells. the picture is further comphcated by the fact that ca + release patterns may vary according to type of cell (e g., white vs red muscle cells [ ] ) as well as the availability of extracellular ca + [ ] . although not related to this report, it may be of some interest to note that both mitochondrlal condensation and granulation are much more intense in x- a-treated animals (and cultured cells as well) than in comparable animals (or cells) treated with monensin [ ] _ the percentage of affected mltochondrla vaned markedly between muscle types and species of animal. analyses of striated muscle m ponies showed that there was a much greater ( -times) hkehhood of finding altered mltochondrla in heart tissues than m diaphragm or appendicular muscle [ ] a similar relationship existed in rats except that most swollen mitochondria were m the &aphragm [ ] . some antibioucs (e g, tiamuhn and avoparcm) may act synergistically with monensln to induce shifts in the distribution of swollen mltochondria [ ] and other cellular damage. differences in distribution patterns of swollen mltochondrla also were observed between red and white muscle fibers of the rat diaphragm [ ] . red and white fibers were dffferentmted structurally by size, mltochondrlal content, and z-band configuration [ , [ ] [ ] [ ] swollen matochondrm were present in all fiber types when the number of affected rmtochondna was small. however, when large numbers of swollen matochondrm were present, the dxsmbutlon pattern was heavily skewed toward the white muscle fibers (fig_ ). a differential effect of monensln was also noted by van vleet and co-workers [ ] who observed in swine severe damage m the diaphragm, vastus lateralls, sem~tendlnosus, triceps and intercostal muscles: moderate damage m longissimus lumborum muscle, and little (or minimal) damage in tongue. damage was greatest m muscles containing a high proportion of type fibers these distribution patterns, coupled with the characteristic form of the degenerating rmtochondrla, are not common observations and, therefore, may be strong indtcatots of monensin poisoning in animals_ swollen rmtochondrla have not been observed in any of the nonmuscle cells of the heart, diaphragm, or appendicular tissues or in hver, adrenal, or kidney cells thus, monensm adrmnistered to mammals in vlvo tends to induce rmtochondrial changes only m selected tissues and/or types of muscle fibers the mechanisms for these rmtochondrlal changes and reasons for the specificity are not known. these problems are compounded by the fact that matochondnal condensation, but not subsequent swelling and degeneration, occurs in cells exposed topically to monensin. whale mitochondnal aberrations are the primary morpholog~c indicators of monensin poisomng in striated muscle, other aspects of muscle ultrastructure may show deterioration [ ] or may remain relatively normal even with gross mltochondnal damage [ ] . generalized fiber and cell degeneration may occur following monensin poisoning [ , , ] . the extent of monensin-induced injuries appears to be time and dosage dependent. if death occurs shortly after monensin exposure, there may be httle or no recognizable evidence of pathologtcal change, at least in liver, kidney, and striated muscle. generalized necrosis appears to occur most often when monensln is administered over long periods of time. even with single doses of monensin, structural aberrations in striated muscle develop progressively over several days and then regress if the animal survives the imtial insult (unpublished data). we have not observed permanent injury in either striated muscle or liver of monensin-treated rats although such effects have been noted in other animals [ ] . many of the effects on striated muscle attributed to monensxn occur also with other lonophores irrespective of their ion specxficlties [ , ] this implies, again, that na + is not the direct cause of muscle perturbation but, rather, that the iomc imbalance resulting from the intracellular influx of na + triggers other cellular responses that lead to the observed perturbations. monensin is known to both inhibit and promote ca + accumulation in myocytes depending on the absence or availability, respectively, of external ca + stores [ , ] ; alter na + gradient-dependent ca + transfer through the basolateral plasma membranes of rat small intestine [ ] ; increase myocardial calcium activity [ ] , inhibit ca + accumulation by cardiac macrosomes or cause release of accumulated ca + stores [ ] ; and release ca + from macrosomes [ , ] . digitalis and other cardiac glycosides (which increase myocardial contractility) appear to act by altering intracellular na + concentration through inhibition of membrane-bound na +-, k+-actlvated adenosine triphosphatase which secondarily results in an increase in mtracellular ca + [see ] . calcium ionophores such as lasalocld and a have been suggested as potential probes for studying the effects of calcium imbalance on myocardial function [ ] . in retrospect, monensin affects the myocardlum in much the same way as do the calcium lonophores and, in some instances, to an even greater extent [ ] . these observations suggest that the xonotropic effects of monensln may be partially indirect; e g., through release of histamine and endogenous amines [ ] , or stimulation of synthesis and/or release of prostaglandln [ , , ] . thus, na + balance plays an indirect but critical role in modulating myocardial function however, a calcium-independent catecholamine depleting action of monensin in cultured rat pheochromocytoma cells [ ] and m bovine adrenal medullary cells and chromaffln granules [ ] suggests that monensln may also play a direct role in altering cellular function. similarly, sutko and co-wor~kers [ ] showed that both monensxn and mgencin produce their effects in guinea pig atria by direct action as well as by releasing catecholamines from tissue stores. differences in subcellular responses to monensin, between the whole ammal and isolated cells or organs, have been noted by us as well as by others [ ] . thus, swelling of golgl apparatus clsternae observed an cultured cells, tissue shces, and plant roots and stems, is not an aberration characteristic of the cells of animals poisoned by monensln. lack of golga apparatus welhng in animals infers that cells from monensin-poisoned ammals are bathed in body fluids containing less than - m monensln which is approximately the minimum effective dose of monensin that will cause sweulng of golgt apparatus clsternae in cultured animal cells. alternatively, lack of vacuolated and/or swollen mitochondna in cultured mammahan cells and plants generally imphes that the vacuolated and/or wollen rnttochondria observed in striated muscle from monensinpoisoned animals are secondary effects of monensin poisoning, perhaps caused by a metabohte of monensin [ , ] . alternatively, monensln could affect the synthesis and/or transport of humoral agents (e.g., catacholanunes) which, in turn, would alter muscle homeostasis and lead to the rmtochondnal aberrations observed in striated muscle. for plants, at concentrations of -s m, monensin was shown to inhibit gernunatlon and growth of ryegrass seedlings [ ] . the effects were primarily associated with poor root development and significant reduction of root mass as compared to controls leaf emergence and leaf mass was only slightly affected. at - m monensln, roots often did not emerge from the seed during germination and root mass of seedlings was often near zero. under these same conditions, shoot mass was reduced about % as compared to controls. monensin, a monovalent ion-selective ionophore, facilitates the transmembrane exchange of prinopally sodium ions for protons. the outer surface of the lonophore-ion complex as composed largely of nonpolar hydrocarbon, which tmparts a high solubility to the complexes in nonpolar solvents. in biological systems, these complexes are freely soluble in the lipid components of membranes and, presumably, diffuse or shuttle through the membranes from one aqueous membrane interface to the other. the net effect for monensin is a trans-membrane exchange of sodium ions for protons. however, the interaction of an ionophore with biologl-cal membranes, and its ionophorlc expression, is highly dependent on the blochemcial configuration of the membrane itself one apparent consequence of this exchange is the neutralization of acidic lntracellular compartments such as the trans golgi apparatus clsternae and associated elements, lysosomes, and certain endosomes. this is accompanied by a disruption of trans golgi apparatus clsternae and of lysosome and acidic endosome function. at the same time, golgl apparatus clsternae appear to swell, presumably due to osmotic uptake of water resulting from the inward movement of ions monensin effects on golga apparatus are observed in cells from a wide range of plant and animal species the action of monensin is most often exerted on the trans half of the stacked clsternae, often near the point of exit of secretory vesicles at the trans face of the stacked cisternae, or, especially at low monensln concentrations or short exposure times, near the rmddle of the stacked cisternae. the effects of monensln are quite rapid in both animal and plant cells; l.e, changes in golgl apparatus may be observed after only - min of exposure it is implicit in these observations that the uptake of osmotically active cations is accompanied by a concornltant efflux of h + and that a net influx of protons would be required to sustain the ionic exchange long enough to account for the swelling of clsternae observed in electron rmcrographs. in the golgi apparatus, late processing events such as terrmnal glycosylation and proteolytlc cleavages are most susceptible to inhibition by monensln. yet, many incompletely processed molecules may still be secreted via yet poorly understood mechanisms that appear to bypass the golgi apparatus in endocytosls, monensln does not prevent internalization however, intracellular degradation of internalized ligands may be prevented. it is becormng clear that endocytosls involves both acidic and non-acidic compartments and that monensln inhibits those processes that normally occur in acidic compartments. thus, monensln, which is capable of collapsing na + and h + gradients, has gamed wide-spread acceptance as a tool for studying golgi apparatus function and for locahzlng and identifying the molecular pathways of subcellular vesicular traffic involving acid compartments. among its advantages are the low concentrations at which inhibitions are produced ( - . /~m), a minimum of troublesome side effects (e g., little or no change of protein synthesis or atp levels) and a reversible action. because the affinity of monensin for na + is ten times that for k +, its nearest competitor, monensxn mediates primarily a na+-h + exchange monensin has little tendency to bind calcium. not only is monensin of importance as an experimental tool, it is of great commercial value as a coccidiostat for poultry and to promote more efficient utilization of feed m cattle the mechanisms by which monensln interact with cocctdla and rumen rmcroflora to achieve these benefits are reasonably well documented. however, the interactions between monensm and the tissues of the host animal are not well understood although the severe toxicological manifestations of monensln poisoning are well known equine species are particularly susceptible to monensm poisoning, and a common effect of monensln poisoning is vacuolizatton and/or swelling of rmtochondna m striated muscle other pathological injuries to striated muscle, spleen, lung, hver and kidney also have been noted a con-sistent observation is cardiac myocyte degeneration as well as vacuohzation differences m cellular response resulting from exposure to monensln (t e, golgi apparatus swelling in cultured cells, isolated tissues, and plants vs. mltochondrial swelling m animals fed monensln) suggest that myocardial damage is due either to a monensln metabohte or is a secondary response to some other derivation however, as pointed out by bergen and bates [ ] , the underlying mode of action of lonophores is on transmembrane ton fluxes which dissipate cation and proton gradients consequently, some or all of the observed monensin effects m vlvo m animals could be secondary phenomena caused by disruption of normal membrane physiology resulting from altered ion fluxes. the role of membranes in metabohc regulation polyether antibiotics -naturally occurnng acid ionophores polyether antibiotics -naturally occurnng acid ionopbores polyether antlbloucs -naturally occurnng acid ionophores polyether antibiotics -naturally occumng acid ionophores (west-icy polyether antibiotics -naturally occurring acid ionophores the role of membanes m metabohc regulalaon polyether antlbtotlcs -naturally occurnng acid ionophores comp blochem phys- o protoplasma clba found symp ongm and continuity of cell organelles (relnert endocytosls (paston, i and wdhngham proc. natl acad th ann proc equine medacane and surgery current vetennary therapy food ammal practice (howard an atlas of fine structure calcium antagomsts and cardiovascular disease