Mutations in KPTN Cause Macrocephaly, Neurodevelopmental Delay, and Seizures


REPORT

Mutations in KPTN Cause Macrocephaly,
Neurodevelopmental Delay, and Seizures

Emma L. Baple,1,9 Reza Maroofian,1,9 Barry A. Chioza,1,9 Maryam Izadi,2,9 Harold E. Cross,3

Saeed Al-Turki,4 Katy Barwick,1 Anna Skrzypiec,5 Robert Pawlak,5 Karin Wagner,6 Roselyn Coblentz,6

Tala Zainy,7 Michael A. Patton,1 Sahar Mansour,7 Phillip Rich,8 Britta Qualmann,2 Matt E. Hurles,4

Michael M. Kessels,2 and Andrew H. Crosby1,*

The proper development of neuronal circuits during neuromorphogenesis and neuronal-network formation is critically dependent on a

coordinated and intricate series of molecular and cellular cues and responses. Although the cortical actin cytoskeleton is known to play a

key role in neuromorphogenesis, relatively little is known about the specific molecules important for this process. Using linkage analysis

and whole-exome sequencing on samples from families from the Amish community of Ohio, we have demonstrated that mutations in

KPTN, encoding kaptin, cause a syndrome typified by macrocephaly, neurodevelopmental delay, and seizures. Our immunofluorescence

analyses in primary neuronal cell cultures showed that endogenous and GFP-tagged kaptin associates with dynamic actin cytoskeletal

structures and that this association is lost upon introduction of the identified mutations. Taken together, our studies have identified

kaptin alterations responsible for macrocephaly and neurodevelopmental delay and define kaptin as a molecule crucial for normal

human neuromorphogenesis.
Extremes of brain growth have frequently been associated

with impaired neurodevelopment and cognition. Occipi-

tofrontal circumference is an indirect measure of brain

growth and the one most widely used in clinical practice

in which macrocephaly (R2 SDs above the mean) is indic-

ative of brain overgrowth (megalencephaly) in the absence

of hydrocephalus and cranial thickening.1 The differential

diagnosis of macrocephaly relates to the underlying

presence or absence of structural brain anomalies. The

strong association between macrocephaly and neuro-

developmental disability, autism, and other pervasive

developmental disorders is well recognized.2–4 Where

macrocephaly is associated with developmental disability,

there appears to be a significantly increased risk of sei-

zures.4 Over recent years, family studies have begun to

identify gene mutations that might cause inherited forms

of developmental disability. These studies have shed

important new light on the molecular and cellular pro-

cesses that orchestrate the human neuronal circuitry and

that might be dysfunctional in neurological disorders.

The establishment of the incredibly intricate human neu-

ral circuitry is critically dependent upon a complex and

tightly regulated myriad of cellular processes and migra-

tional cues. The actin cytoskeleton is known to play an

important role in the formation, propagation, and steering

of cell motility and migration during brain development.

This in turn leads to the astonishing morphological intri-
1Monogenic Molecular Genetics, University of Exeter Medical School, St. Luke

I, Jena University Hospital and Friedrich Schiller University Jena, D-07743 Jena

of Arizona School of Medicine, 655 N. Alvernon Way, Tucson, AZ 85711, USA;

ton, Cambridge CB10 1SA, UK; 5Laboratory of Neuronal Plasticity & Behaviour

Road, Exeter EX4 4PS, UK; 6Windows of Hope Genetic Study, Holmes County, O

Healthcare NHS Trust, London SW17 0QT, UK; 8Department of Neuroradiolog
9These authors contributed equally to this work

*Correspondence: a.h.crosby@exeter.ac.uk

http://dx.doi.org/10.1016/j.ajhg.2013.10.001. �2014 The Authors
This is an open-access article distributed under the terms of the Creative Comm

reproduction in any medium, provided the original author and source are cre

The A

. Open access u
cacy that neurons acquire during neuronal differentia-

tion, which is required for the formation of the complex

functional neuronal networks underlying human higher

brain functions. Mutations in genes encoding molecules

important for normal function of the actin cytoskeleton

have previously been implicated in inherited forms of

developmental disability and brain development,5–7 high-

lighting the important role of the actin cytoskeleton in

neuromorphogenesis.

The studies described here derive from the analysis of

blood samples obtained for DNA extraction (informed

consent was obtained from families from the Anabaptist

communities of Ohio according to protocols approved by

the institutional review board at the University of Arizona

and the Wandsworth Regional Ethics Committee). Nine

family members present in four nuclear families were

affected by an inherited variable form of neurodevelop-

mental delay. The most consistent features were global

developmental delay, macrocephaly with frontal bossing,

high levels of anxiety, and some features suggestive of a

pervasive developmental disorder. Additional features

included craniosynostosis, recurrent pneumonia, and sple-

nomegally. Neuroimaging was performed in four cases,

and no significant intracranial abnormalities were re-

ported. A primary seizure disorder, involving absence or

generalized tonic-clonic seizures, was described in three

of the nine cases. Dysmorphic features were subtle and
’s Campus, Magdalen Road, Exeter EX1 2LU, UK; 2Institute for Biochemistry

, Germany; 3Department of Ophthalmology and Vision Science, University
4Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinx-

, University of Exeter Medical School, Hatherly Laboratories, Prince of Wales

H 44687, USA; 7South West Thames Regional Genetics Service, St. George’s

y, St. George’s Hospital, London SW17 0QT, UK

ons Attribution License, which permits unrestricted use, distribution, and

dited.

merican Journal of Human Genetics 94, 87–94, January 2, 2014 87

nder CC BY license.

mailto:a.h.crosby@exeter.ac.uk
http://dx.doi.org/10.1016/j.ajhg.2013.10.001
http://crossmark.crossref.org/dialog/?doi=10.1016/j.ajhg.2013.10.001&domain=pdf
http://creativecommons.org/licenses/by/3.0/


Figure 1. Family Pedigree and Gene Mapping
(A) Pedigree diagram showing all four investigated nuclear families (families 1–4), which interlink into a single extended family.
Segregation of the two mutations identified (c.776C>A [p.Ser259*] is denoted by X, and c.714_731dup [p.Met241_Gln246dup] is
denoted by Dup) is shown (all genotypings were validated by dideoxy sequence analysis).
(B) Pictorial representation of the SNP genotype data encompassing the chromosome 19 homozygous (solid box) and compound-
heterozygous (dashed box) regions in affected individuals. The locus containing the pathogenic variant is demarcated by SNPs
rs2253022 and rs7246244 (2.59 Mb; families 1 and 2).
included frontal bossing, broad nasal tip, scaphocephaly,

hooded eyelids with small, downslanting palpebral fis-

sures, and a prominent chin (Table S1 and Figure S1, avail-

able online).

In order to map the chromosomal location of the patho-

genic variant, we genotyped samples from families 1 and

2 genome-wide by using Illumina Human CytoSNP-12

Beadchip arrays incorporating ~330,000 genetic markers.

A single notable homozygous 2.59 Mb region in

19q.13.32 was found to be shared by all affected individ-

uals in families 1 and 2, although no notable homozygous

regions were detected in affected members of families 3 or

4 (Figures 1A and 1B). Considered likely to harbor the path-

ogenic variant in these families, the homozygous region

identified in families 1 and 2 is delimited by recombinant

SNP markers rs2253022 and rs7246244 and contains 149

genes. Autozygosity across this interval was corroborated

by microsatellite-marker analysis in all family members,

which defined a haplotype cosegregating with the disease

phenotype (data not shown). To identify the causative

mutation, we undertook whole-exome sequence analysis

of a single affected individual (IX:3, Figure 1A) to generate

a profile of variants not present in publically available

databases and rare sequence variants. Coding regions

were captured with a SureSelect Target Enrichment System

(50 Mb) and sequencing on a HiSeq system (Illumina) with

76 bp paired-end reads. We obtained 7.6 Gb of reads, of
88 The American Journal of Human Genetics 94, 87–94, January 2, 20
which 93% had a quality score R 30. Approximately 8%

of the reads were marked as duplicates by Picard (v.1.46)

and were excluded before mapping to the human genome

reference sequence (GRCh37). The Genome Analysis

Toolkit (GATK, v.1.0.5777) was used to realign reads near

potential indel sites and to recalibrate base qualities;

single-nucleotide variants were called with GATK and

SAMtools (v.0.1.16), whereas indels were called with

GATK and Dindel (v.1.01). All variants were annotated

with dbSNP (134) and the 1000 Genomes pilot study

(May 2011) for minor allele frequency. The variant conse-

quences on protein structure were predicted by the Variant

Effect Predictor (VEP v.2.1) with the use of Ensembl (v.63).

Variants were filtered out if the read depth was <43

or >1,2003, if the consensus quality was <20, or if the

SNP quality was <25. After filtering, only one likely delete-

rious variant (g.47983131G>T [NC_000019.9] [c.776C>A

(NM_007059.2); p.Ser259* (NP_008990.2)]) in exon 8 of

KPTN, encoding the 436 amino acid protein kaptin, was

identified within the critical region. The presence of the

variant was confirmed by dideoxy sequencing, which

also confirmed its cosegregation within families 1 and 2

(Figure 1A). Seven heterozygous carriers were identified

in 560 examined control chromosomes, indicating an

allele frequency of approximately 0.012 in this commu-

nity. The variant is also listed in the National Heart,

Lung, and Blood Institute (NHLBI) Exome Sequencing
14



Project Exome Variant Server, and one heterozygote has

been reported in 8,285 European American chromosomes.

We next investigated other Amish families with chil-

dren showing similar unexplained developmental delay

associated with macrocephaly, leading to the detection

of the c.776C>A mutation in the heterozygous state in

affected members of 2 of 20 such families (families 3 and

4). Compared with this mutation’s occurrence in Amish

control studies, this frequency was higher than expected,

prompting us to evaluate KPTN for a second mutation

that could be acting in conjunction with the c.776C>A

mutation in these families. Subsequent dideoxy sequence

analysis of all coding regions and associated splice

junctions of KPTN in these families revealed that all

affected children were indeed compound heterozygous

for the c.776C>A variant, as well as an in-frame 18 bp

duplication (g. 47983176_47983193dup [NC_000019.9]

[c.714_731dup (NM_007059.2); p.Met241_Gln246dup

(NP_008990.2)]) in exon 8. Both the c.776C>A and the

c.714_731dup sequence mutations completely cosegregate

with the disease phenotype, as would be expected of

causative compound-heterozygous mutations (Figure 1A,

LODMAX ¼ 10.33 Simwalk28). The c.714_731dup sequence
duplication is not listed in genomic sequence databases,

and one heterozygote was detected in 560 Amish control

chromosomes.

KPTN encodes a largely uncharacterized protein

(Figure S2). Our sequence analyses of kaptin identified no

protein domains or homologous human proteins that

could provide clues to the functional basis of the neurolog-

ical deficits associated with its alteration. We therefore

investigated the expression and localization of kaptin in

neurons. In order to do so, we first cloned human kaptin

from human embryonic kidney 293 cell cDNA obtained

by RNA isolation and RT-PCR as previously described.9

Full-length kaptin (amino acids 1–436) was generated by

PCR using primers BQ2046 (50-AAGAATTCATGATGGGGG
AGGCG-30) and BQ2047 (50-AAGGATCCTTAAGAGGCTG
CATT-30). The PCR product was digested with EcoRI and
BamH1 and cloned in-frame into pEGFP-c2 and subcl-

oned into pCMV-Tag2. Primary rat hippocampal cultures

were prepared and cultured as previously described.10,11

Neurons were transfected with Lipofectamine 2000 (Invi-

trogen) on days 3, 13, and 23 in vitro, fixed in 4% parafor-

maldehyde in PBS for 7 min at room temperature 24 and

48 hr after transfection, and processed for immunofluores-

cence microscopy.12 Confocal imaging was performed

with a Zeiss Axio Observer equipped with ApoTome and

Zeiss Plan-Apochromat 633/1.4 and 403/1.3 objectives

and an AxioCam MRm CCD camera (Zeiss). Primary rat

hippocampal neurons, identifiable by anti-MAP2 immu-

nostaining (Sigma, Abcam), were transfected with wild-

type Flag-tagged kaptin (Flag-kaptin) at DIV3 and imaged

2 days later. Wild-type Flag-kaptin was observed to be local-

ized at F-actin-rich foci in close proximity to the cell bodies

and at growth cones (Figures 2A and 2B, arrow heads). At

later stages of development, when neurons established
The A
synapses (DIV14), wild-type Flag-kaptin again colocalized

with F-actin-rich sites. Along dendrites, these sites

appeared mainly to represent F-actin-rich postsynapses,

given that almost all kaptin-enriched puncta were

contacted by presynaptic structures containing bassoon

(a marker for presynaptic active zones) (Figure 2C). To be

able to undertake immunolabeling experiments of endog-

enous kaptin, we first characterized polyclonal rabbit anti-

kaptin (Sigma) in COS-7 cells. Cells expressing wild-type

Flag-kaptin were highlighted by anti-kaptin immuno-

labeling (Figure S3A). Coimmunostaining of primary rat

hippocampal neurons at DIV24 with anti-kaptin and

anti-Shank2 (Neuromab) demonstrated that the dendritic

accumulations of Flag-kaptin at F-actin-rich puncta are

indeed of physiological relevance and reflect the locali-

zation of endogenous kaptin at postsynapses. The vast

majority of anti-kaptin-immunolabeled puncta were not

only enriched with F-actin but were additionally immuno-

positive for Shank2, a postsynaptic scaffold protein inter-

acting with F-actin binding proteins;12,13 Figure 2D).

Kaptin thus appears to be associated with dynamic actin

cytoskeletal structures of neuronal cells. Consistent with

this, wild-type Flag-kaptin accumulated at COS-7 cell

lamellipodia (Figure S3B), the subcellular regions marked

by dense arrays of dynamic actin filaments in mobile fibro-

blasts. In neurons, the cortical actin cytoskeleton is known

to be important for proper neuronal-network formation

during development. Our observations therefore suggest

a role for kaptin in neuromorphogenesis.

The c.776C>A sequence variant is predicted to introduce

a premature stop codon and result in loss of function as

a result of degradation of the mutated transcript by

mRNA-surveillance mechanisms; however, because of a

lack of patient material, we have been unable to confirm

whether a truncated protein (lacking the C-terminal amino

acids 259–436) is produced. In contrast, the in-frame

c.714_731dup mutation is likely to result in the insertion

of six amino acids (Met-Trp-Ser-Val-Leu-Gln) into the full-

length kaptin. In order to investigate the functional

outcome of this mutation, we undertook in silico analysis

of the secondary structural elements of wild-type and

altered kaptin. This revealed that the N-terminal half of

kaptin is likely to comprise a series of relatively densely

organized b sheets, interspersed by only three a helices,

and becomes more a-helical starting with a-helix 4 (span-

ning amino acids 234–245; Figure 3A). Sequence and pre-

dicted structural conservation of both the N-terminal and

C-terminal portions of kaptin are very high even between

evolutionarily distant mammalian species (Figure S2).

Strikingly, duplication of the six amino acids (241–246) is

predicted to disrupt a-helix 4 and result in its conversion

into an extended b sheet (Figure 3C) and is therefore likely

to have a profound effect on kaptin function.

In order to experimentally explore the functionality of

any protein arising from translated mutant transcripts, we

generated both disease-associated GFP-tagged mutants.

We generated the p.Met241_Gln246dup altered kaptin
merican Journal of Human Genetics 94, 87–94, January 2, 2014 89



Figure 2. Kaptin Immunolocalization Studies
(A and B) Flag-kaptin colocalized with F-actin-rich foci at the cell body and in growth cones (examples of both are marked by arrow heads
in A) in DIV5 rat hippocampal neurons transfected at DIV3. For clarity, the anti-MAP2 immunostaining was omitted from the merged
images. Scale bars represent 10 mm.
(C and D) Endogenous kaptin immunostained together with the presynaptic marker bassoon at DIV14 (C) and with the postsynaptic
marker Shank2 at DIV24 (D). Puncta enriched with anti-kaptin immunoreactivity (marked by arrow heads) were rich in F-actin, as shown
by fluorescently labeled phalloidin. (C) Furthermore, they were usually contacted by presynapses. The scale bar represents 5 mm. (D)
Postsynapses marked by Shank2 were largely positive for both F-actin and anti-kaptin immunolabeling (arrow heads). For clarity, the
anti-F-actin staining was omitted from the merged image in (D). High-magnification images are shown. The scale bar represents 2.5 mm.
(GFP-kaptinp.Met241_Gln246dup) by fusing an N-terminal

portion carrying the duplication and a SmaI site introduced

as a silent mutation (primers BQ2046 [50-AAGAATTCAT
GATGGGGGAGGCG-30] and BQ2050 [50-TCACCCGGGA
GATGGGCCCGTCTTGCAACACGCTCCACATCTGCAGG

ACCGACCAC-30]) with a C-terminal portion contain-
ing a SmaI site also introduced by silent mutation

(primers BQ2048 [50-ATCTCCCGGGTGATTGTGTTCAG-30]
and BQ2047 [50-AAGGATCCTTAAGAGGCTGCATT-30]).
We generated the p.Ser259* altered kaptin (GFP-

kaptin1–258) by PCR using primers BQ2046 (50-AAGAATTC
ATGATGGGGGAGGCG-30) and BQ2070 (50-AAGTCGAC
CtAGAGGCTGAACAC-30). PCR products were cloned in-
frame into pEGFP-c2. Whereas wild-type GFP-tagged kaptin

(GFP-kaptin) was found to localize at F-actin-rich lamellipo-

dia of COS-7 cells, both altered forms of kaptin displayed no

F-actin association but instead accumulated at irregular

perinuclear sites (Figures 3D–3F). GFP-kaptin1–258 showed

a more pronounced tendency to form such accumulations;

almost all cells were marked with little additional cyto-

plasmic staining outside of these foci. Alternatively, GFP-

kaptinp.Met241_Gln246dup typically displayed fewer and

slightly smaller accumulations; there were slightly higher

levels of cytoplasmatic staining outside of these foci (Fig-
90 The American Journal of Human Genetics 94, 87–94, January 2, 20
ures 3D–3F). This indicates that both proteins are likely to

benonfunctional, although wecannot exclude thepossibil-

ity that misfolded altered protein might accumulate in neu-

rons of affected individuals and lead to dominant-negative

effects on other neuronal proteins or cell processes.

Finally, because KPTN mutations result primarily in a

form of neurodevelopmental disease, we also analyzed the

behavior of the altered forms of kaptin in primary hippo-

campal neurons during early development. Whereas wild-

typeGFP-kaptin was againfoundtocolocalizewith dynamic

F-actin in growth cones and foci at the cell body, both GFP-

kaptin1–258 and GFP-kaptinp.Met241_Gln246dup were found to

accumulate in a manner reminiscent of the COS-7 studies

in the cell body or at perinuclear sites (Figures 3G–3I).

We investigated a number of families from the Anabaptist

communities of Ohio and found that multiple individuals

aged 1–30 years were affected by a syndrome in which the

cardinal features include macrocephaly, global develop-

mental delay, behavioral abnormalities, and seizures. Our

molecular studies determined that two distinct founder

mutations affecting the same gene (KPTN, encoding

kaptin), both of which have become entrapped within the

community, are responsible. Compared with individuals

found to be compound heterozygous for p.Ser259*
14



Figure 3. Immunolocalization Studies of Altered Kaptin
(A–C) Schematic representation of wild-type human kaptin (A), the truncated p.Ser259* (c.776C>A; GFP-kaptin1–258) (B), and the dupli-
cation (GFP-kaptinp.Met241_Gln246dup) (C). On the left is a graphic overview of secondary structures; b sheets are shown as red boxes, and
a-helices are shown as blue ellipsoids. On the right are amino acids and secondary-structure elements around amino acid 230. a-helix 4 is
predicted to be converted into a b sheet by the insertion of amino acids 241–246, as shown in yellow.
(D–F) Localizations of GFP-kaptin, GFP-kaptin1–258, and GFP-kaptinp.Met241_Gln246dup (green in merges) in COS-7 cells counterstained
with phalloidin (red in merged images). Note that whereas wild-type kaptin was distributed in the cytosol and accumulated at
F-actin-rich lamellipodia (D), both alterations showed accumulations at perinuclear regions (E and F).

(legend continued on next page)

The American Journal of Human Genetics 94, 87–94, January 2, 2014 91



and p.M241_Q246dup, those individuals found to be

homozygous for the p.Ser259* nonsense alteration ap-

peared to be more severely affected given that they had

a higher incidence of seizures and a greater degree of intel-

lectual impairment. This might indicate that p.Met241_

Gln246dup retains a limited functionality in vivo, and

perhaps consistent with this, we observed that

p.Met241_Gln246dup showed a slightly lesser tendency

than p.Ser259* to form perinuclear accumulations in

our transfection studies. However, the sample cohort is

currently too small for confidently determining any geno-

type-phenotype correlation.

Kaptin is a largely uncharacterized protein originally iso-

lated from human blood platelets but subsequently found

to be expressed in fibroblasts and intestinal and sensory

epithelia.14 A previous study of this molecule suggested a

role at stereocilia tips, and so KPTN was proposed as a

candidate gene for hearing loss.15 However, the affected

individuals described in this study have no evidence of

sensorineural hearing deficits. During development, the

actin cytoskeleton plays a pivotal role in neuronal cell

morphology and migration, including the generation, pro-

trusion, and steering of growth cones and the formation of

postsynapse and dendritic spines.16–18 Our studies confirm

kaptin expression in neuronal (MAP2-positive) cells. Given

that kaptin was found to localize to F-actin-rich structures,

it is conceivable that loss of kaptin function could either

directly or indirectly lead to impairment of the neuronal

actin cytoskeleton, required for dendritic arborization

and/or spine formation, and result in the disease pheno-

type described. Support for this has been provided by

studies of Rab39B, a small GTPase associated with the

Golgi apparatus;19 alterations in this protein lead to its

downregulation and a concomitant reduction in dendritic

arborization and synapse formation. This was previously

associated with a disease phenotype comprising mental

retardation, epilepsy, and macrocephaly,20,21 features

which overlap with those described here as arising from

kaptin alterations. Similarly, deficiencies of Rho GTPases,

which regulate the actin cytoskeleton by a growing variety

of effector proteins, have been associated with intellectual

disability and defects in spine structure.22–25 Several other

actin-associated proteins, including drebrin A, cortactin,

and Abp1, have also been found to decrease spine density

or formation,26–28 and a growing body of evidence sup-

ports a role for the Arp2/3 complex and directly and indi-

rectly associated proteins in postsynapse formation and

proper development of neuronal morphology.10,11,27,29–38

Our analyses reveal that wild-type kaptin is enriched in

neuronal growth cones and at discrete cortical sites of neu-

rons at early developmental stages. Furthermore, wild-type

kaptin was found to accumulate at postsynapses of neu-
(G–I) Transfection of DIV3 rat hippocampal neurons with wild-type a
kaptin was found throughout the cell and showed accumulations at g
In contrast, both alterations accumulated in areas of the cell body (H a
green, MAP2 in red, and phalloidin in blue. Scale bars represent 10 m

92 The American Journal of Human Genetics 94, 87–94, January 2, 20
rons undergoing synaptogenesis (DIV14), as indicated by

spatial correlation along dendrites of kaptin accumula-

tions by phalloidin and synaptic-marker immunostaining.

Consistent with this, kaptin was also found to be present

in the postsynapses of mature neurons. The sites demar-

cated by kaptin localization represent areas of high F-actin

content and high actin dynamics. An association between

kaptin and dynamic F-actin was also indicated by the

observed accumulations of Flag-kaptin at the dynamic

lamellipodia as opposed to the more static stress fibers in

COS-7 cells. These observations are consistent with the

suggestion of a lamellipodial localization of kaptin in

chicken embryonic fibroblasts and with the original iso-

lation of kaptin from blood cells with the use of F-actin

columns.14

Taken together, our studies indicate that both of the

identified KPTN mutations are likely to result in loss

of function of kaptin, either by degradation of the mutant

transcript via mRNA-surveillance mechanisms (c.776C>A)

or by the production of mislocalized and/or nonfunc-

tional protein products. These KPTN mutations result

in a distinctive clinical syndrome, and the presence of

macrocephaly combined with global developmental delay

should prompt the diagnostic analysis of KPTN in affected

individuals from Anabaptist communities. The potential

benefits of early diagnosis in this condition are indicated

by the improvement in developmental markers in our

study’s youngest two affected individuals, both of whom

received early and intensive developmental interventions,

although the lack of seizures in these individuals might

also have been beneficial. Finally, our identification of

two KPTN founder mutations within this Anabaptist

population parallels the situation seen for a number of

other genes with multiple mutations that also commonly

cause inherited diseases globally (e.g., GJB2 mutations

in inherited hearing loss, and ATM mutations in ataxia

telangiectasia), indicating that kaptin developmental delay

might be similarly widespread.
Supplemental Data

Supplemental Data include four figures and one table and can be

found with this article online at http://www.cell.com/AJHG.
Acknowledgments

First, we are very grateful to the Amish families for partaking in

this study and to the Amish community for their continued

support of the Windows of Hope Project. We are grateful to Olivia

Wenger for contributing clinical data. Rabbit polyclonal anti-

bassoon was a generous gift from E.D. Gundelfinger (Leibniz Insti-

tute for Neurobiology, Magdeburg). Illumina cytoSNP analysis and

Sanger sequencing were carried out at the Medical Biomics Centre
nd altered kaptin (cells were fixed and imaged at DIV5). Wild-type
rowth cones and F-actin-rich sites of the cell body (G; arrow heads).
nd I; arrows). Merged images show wild-type and altered kaptin in
m.

14

http://www.cell.com/AJHG


(St. George’s University of London). The work was supported by

the Medical Research Council (G1002279, G1001931), Wellcome

Trust (WT098051), Newlife Foundation, and Research to Prevent

Blindness.

Received: July 23, 2013

Accepted: October 1, 2013

Published: November 14, 2013
Web Resources

The URLs for data presented herein are as follows:

1000 Genomes, http://browser.1000genomes.org/index.html

Ensembl Genome Browser, http://www.ensembl.org/index.html

GATK, http://www.broadinstitute.org/gatk/about/citing-gatk

NCBI, http://www.ncbi.nlm.nih.gov/

NHLBI Exome Sequencing Project (ESP) Exome Variant Server,

http://evs.gs.washington.edu/EVS/

Online Mendelian Inheritance in Man (OMIM), http://www.

omim.org

PolyPhen-2, http://genetics.bwh.harvard.edu/pph2/

PROVEAN, http://provean.jcvi.org/seq_submit.php

PubMed, http://www.ncbi.nlm.nih.gov/pubmed/

SAMtools, http://samtools.sourceforge.net

SIFT, http://sift.jcvi.org/

Variant Effect Predictor (VEP), http://useast.ensembl.org/info/

docs/tools/vep/index.html

UCSC Human Genome Browser, http://www.genome.ucsc.edu
References

1. Stevenson, R.E., Schroer, R.J., Skinner, C., Fender, D., and

Simensen, R.J. (1997). Autism and macrocephaly. Lancet

349, 1744–1745.

2. Kanner, L. (1968). Autistic disturbances of affective contact.

Acta Paedopsychiatr. 35, 100–136.

3. Klein, S., Sharifi-Hannauer, P., and Martinez-Agosto, J.A.

(2013). Macrocephaly as a clinical indicator of genetic

subtypes in autism. Autism Res. 6, 51–56.

4. Nevo, Y., Kramer, U., Shinnar, S., Leitner, Y., Fattal-Valevski, A.,

Villa, Y., and Harel, S. (2002). Macrocephaly in children with

developmental disabilities. Pediatr. Neurol. 27, 363–368.

5. Drévillon, L., Megarbane, A., Demeer, B., Matar, C., Benit, P.,

Briand-Suleau, A., Bodereau, V., Ghoumid, J., Nasser, M.,

Decrouy, X., et al. (2013). KBP-cytoskeleton interactions

underlie developmental anomalies in Goldberg-Shprintzen

syndrome. Hum. Mol. Genet. 22, 2387–2399.

6. Ropers, F., Derivery, E., Hu, H., Garshasbi, M., Karbasiyan, M.,

Herold, M., Nürnberg, G., Ullmann, R., Gautreau, A., Sperling,

K., et al. (2011). Identification of a novel candidate gene

for non-syndromic autosomal recessive intellectual disability:

the WASH complex member SWIP. Hum. Mol. Genet. 20,

2585–2590.

7. Rivière, J.-B., van Bon, B.W.M., Hoischen, A., Kholmanskikh,

S.S., O’Roak, B.J., Gilissen, C., Gijsen, S., Sullivan, C.T.,

Christian, S.L., Abdul-Rahman, O.A., et al. (2012). De novo

mutations in the actin genes ACTB and ACTG1 cause

Baraitser-Winter syndrome. Nat. Genet. 44, 440–444, S1–S2.

8. Sobel, E., and Lange, K. (1996). Descent graphs in pedigree

analysis: applications to haplotyping, location scores, and

marker-sharing statistics. Am. J. Hum. Genet. 58, 1323–1337.
The A
9. Haag, N., Schwintzer, L., Ahuja, R., Koch, N., Grimm, J., Heuer,

H., Qualmann, B., and Kessels, M.M. (2012). The actin nucle-

ator Cobl is crucial for Purkinje cell development and works in

close conjunction with the F-actin binding protein Abp1.

J. Neurosci. 32, 17842–17856.

10. Pinyol, R., Haeckel, A., Ritter, A., Qualmann, B., and Kessels,

M.M. (2007). Regulation of N-WASP and the Arp2/3 complex

by Abp1 controls neuronal morphology. PLoS ONE 2, e400.

11. Ahuja, R., Pinyol, R., Reichenbach, N., Custer, L., Klingen-

smith, J., Kessels, M.M., and Qualmann, B. (2007). Cordon-

bleu is an actin nucleation factor and controls neuronal

morphology. Cell 131, 337–350.

12. Qualmann, B., Boeckers, T.M., Jeromin, M., Gundelfinger, E.D.,

and Kessels, M.M. (2004). Linkage of the actin cytoskeleton to

the postsynaptic density via direct interactions of Abp1 with

the ProSAP/Shank family. J. Neurosci. 24, 2481–2495.

13. Hering, H., and Sheng, M. (2001). Dendritic spines: structure,

dynamics and regulation. Nat. Rev. Neurosci. 2, 880–888.

14. Bearer, E.L., and Abraham, M.T. (1999). 2E4 (kaptin): a novel

actin-associated protein from human blood platelets found

in lamellipodia and the tips of the stereocilia of the inner

ear. Eur. J. Cell Biol. 78, 117–126.

15. Bearer, E.L., Chen, A.F., Chen, A.H., Li, Z., Mark, H.F., Smith,

R.J., and Jackson, C.L. (2000). 2E4/Kaptin (KPTN)—a candi-

date gene for the hearing loss locus, DFNA4. Ann. Hum.

Genet. 64, 189–196.

16. Dent, E.W., Merriam, E.B., and Hu, X. (2011). The dynamic

cytoskeleton: backbone of dendritic spine plasticity. Curr.

Opin. Neurobiol. 21, 175–181.

17. Kessels, M.M., Schwintzer, L., Schlobinski, D., and Qualmann,

B. (2011). Controlling actin cytoskeletal organization and

dynamics during neuronal morphogenesis. Eur. J. Cell Biol.

90, 926–933.

18. Svitkina, T., Lin, W.H., Webb, D.J., Yasuda, R., Wayman, G.A.,

Van Aelst, L., and Soderling, S.H. (2010). Regulation of the

postsynaptic cytoskeleton: roles in development, plasticity,

and disorders. J. Neurosci. 30, 14937–14942.

19. Chen, T., Han, Y., Yang, M., Zhang, W., Li, N., Wan, T., Guo, J.,

and Cao, X. (2003). Rab39, a novel Golgi-associated Rab

GTPase from human dendritic cells involved in cellular endo-

cytosis. Biochem. Biophys. Res. Commun. 303, 1114–1120.

20. Giannandrea, M., Bianchi, V., Mignogna, M.L., Sirri, A., Carra-

bino, S., D’Elia, E., Vecellio, M., Russo, S., Cogliati, F., Larizza,

L., et al. (2010). Mutations in the small GTPase gene RAB39B

are responsible for X-linked mental retardation associated

with autism, epilepsy, and macrocephaly. Am. J. Hum. Genet.

86, 185–195.

21. Tarpey, P.S., Smith, R., Pleasance, E., Whibley, A., Edkins, S.,

Hardy, C., O’Meara, S., Latimer, C., Dicks, E., Menzies, A.,

et al. (2009). A systematic, large-scale resequencing screen of

X-chromosome coding exons in mental retardation. Nat.

Genet. 41, 535–543.

22. Nakayama, A.Y., and Luo, L. (2000). Intracellular signaling

pathways that regulate dendritic spine morphogenesis. Hip-

pocampus 10, 582–586.

23. Kasri, N.N., Govek, E.E., and Van Aelst, L. (2008). Character-

ization of oligophrenin-1, a RhoGAP lost in patients affected

with mental retardation: lentiviral injection in organotypic

brain slice cultures. Methods Enzymol. 439, 255–266.

24. von Bohlen Und Halbach, O. (2010). Dendritic spine

abnormalities in mental retardation. Cell Tissue Res. 342,

317–323.
merican Journal of Human Genetics 94, 87–94, January 2, 2014 93

http://browser.1000genomes.org/index.html
http://www.ensembl.org/index.html
http://www.broadinstitute.org/gatk/about/citing-gatk
http://www.ncbi.nlm.nih.gov/
http://evs.gs.washington.edu/EVS/
http://www.omim.org
http://www.omim.org
http://genetics.bwh.harvard.edu/pph2/
http://provean.jcvi.org/seq_submit.php
http://www.ncbi.nlm.nih.gov/pubmed/
http://samtools.sourceforge.net
http://sift.jcvi.org/
http://useast.ensembl.org/info/docs/tools/vep/index.html
http://useast.ensembl.org/info/docs/tools/vep/index.html
http://www.genome.ucsc.edu


25. Ba, W., van der Raadt, J., and Nadif Kasri, N. (2013). Rho

GTPase signaling at the synapse: implications for intellectual

disability. Exp. Cell Res. 319, 2368–2374.

26. Takahashi, H., Sekino, Y., Tanaka, S., Mizui, T., Kishi, S., and

Shirao, T. (2003). Drebrin-dependent actin clustering in den-

dritic filopodia governs synaptic targeting of postsynaptic

density-95 and dendritic spine morphogenesis. J. Neurosci.

23, 6586–6595.

27. Tada, T., and Sheng, M. (2006). Molecular mechanisms of den-

driticspinemorphogenesis.Curr. Opin.Neurobiol.16, 95–101.

28. Haeckel, A., Ahuja, R., Gundelfinger, E.D., Qualmann, B., and

Kessels, M.M. (2008). The actin-binding protein Abp1 controls

dendritic spine morphology and is important for spine head

and synapse formation. J. Neurosci. 28, 10031–10044.

29. Soderling, S.H., Guire, E.S., Kaech, S., White, J., Zhang, F.,

Schutz, K., Langeberg, L.K., Banker, G., Raber, J., and Scott,

J.D. (2007). A WAVE-1 and WRP signaling complex regulates

spine density, synaptic plasticity, and memory. J. Neurosci.

27, 355–365.

30. Wegner, A.M., Nebhan, C.A., Hu, L., Majumdar, D., Meier,

K.M., Weaver, A.M., and Webb, D.J. (2008). N-wasp and the

arp2/3 complex are critical regulators of actin in the develop-

ment of dendritic spines and synapses. J. Biol. Chem. 283,

15912–15920.

31. Nakamura, Y., Wood, C.L., Patton, A.P., Jaafari, N., Henley,

J.M., Mellor, J.R., and Hanley, J.G. (2011). PICK1 inhibition

of the Arp2/3 complex controls dendritic spine size and syn-

aptic plasticity. EMBO J. 30, 719–730.
94 The American Journal of Human Genetics 94, 87–94, January 2, 20
32. Kim, I.H., Racz, B., Wang, H., Burianek, L., Weinberg, R.,

Yasuda, R., Wetsel, W.C., and Soderling, S.H. (2013). Disrup-

tion of Arp2/3 results in asymmetric structural plasticity of

dendritic spines and progressive synaptic and behavioral

abnormalities. J. Neurosci. 33, 6081–6092.

33. Weed, S.A., Karginov, A.V., Schafer, D.A., Weaver, A.M., Kinley,

A.W., Cooper, J.A., and Parsons, J.T. (2000). Cortactin localiza-

tion to sites of actin assembly in lamellipodia requires interac-

tions with F-actin and the Arp2/3 complex. J. Cell Biol. 151,

29–40.

34. Martinez-Quiles, N., Ho, H.Y., Kirschner, M.W., Ramesh, N.,

and Geha, R.S. (2004). Erk/Src phosphorylation of cortactin

acts as a switch on-switch off mechanism that controls its abil-

ity to activate N-WASP. Mol. Cell. Biol. 24, 5269–5280.

35. Koch, N., Dharmalingam, E., Westermann, M., Qualmann, B.,

Thomas, U., and Kessels, M.M. (2012). Abp1 utilizes the Arp2/

3 complex activator Scar/WAVE in bristle development. J. Cell

Sci. 125, 3578–3589.

36. Irie, F., and Yamaguchi, Y. (2002). EphB receptors regulate den-

dritic spine development via intersectin, Cdc42 and N-WASP.

Nat. Neurosci. 5, 1117–1118.

37. Michaelsen, K., Murk, K., Zagrebelsky, M., Dreznjak, A., Jock-

usch, B.M., Rothkegel, M., and Korte, M. (2010). Fine-tuning

of neuronal architecture requires two profilin isoforms. Proc.

Natl. Acad. Sci. USA 107, 15780–15785.

38. Djagaeva, I., and Doronkin, S. (2009). COP9 limits dendritic

branching via Cullin3-dependent degradation of the actin-

crosslinking BTB-domain protein Kelch. PLoS ONE 4, e7598.
14


	Mutations in KPTN Cause Macrocephaly, Neurodevelopmental Delay, and Seizures
	Supplemental Data
	Acknowledgments
	Web Resources
	References