semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. doi: . /bjp. . . corpus id: the impact of molecular genetics on our understanding of the psychoses. @article{mullan theio, title={the impact of molecular genetics on our understanding of the psychoses.}, author={m. mullan and r. murray}, journal={the british journal of psychiatry : the journal of mental science}, year={ }, volume={ }, pages={ - } } m. mullan, r. murray published psychology, medicine the british journal of psychiatry : the journal of mental science studies demonstrating the linkage to separate chromosomal locations of alzheimer's disease, manic depression, and schizophrenia require re-evaluation of our ideas of their genetic aetiology. this article reviews the findings, and explores the increasing contribution of the 'new genetics' to our understanding of the organic and functional psychoses. view on pubmed cambridge.org save to library create alert cite launch research feed share this paper citations view all topics from this paper psychoses, substance-induced psychotic disorders bipolar disorder schizophrenia molecular genetics (discipline) alzheimer's disease citations citation type citation type all types cites results cites methods cites background has pdf publication type author more filters more filters filters sort by relevance sort by most influenced papers sort by citation count sort by recency the potential and the pitfalls of molecular genetics for psychiatry: an overview r. murray, m. gill biology save alert research feed genetics and psychiatry: an unheralded window on the environment. d. reiss, r. plomin, e. hetherington psychology, medicine the american journal of psychiatry save alert research feed ethical implications of the new genetics for psychiatry a. pelosi, a. david psychology save alert research feed new findings in psychiatric genetics: implications for social work practice. e. takahashi, j. turnbull psychology, medicine social work in health care save alert research feed ethics, molecular genetics, and psychiatric disorders m. gill psychology save alert research feed research strategies in 'slow' infections in psychiatry k. bechter, a. hodgkiss medicine history of psychiatry save alert research feed schizophrenia: a neuropathological perspective. g. roberts psychology, medicine the british journal of psychiatry : the journal of mental science save alert research feed brain dopamine receptor plasticity: testing a diathesis-stress hypothesis in an animal model s. cabib, a. oliverio, r. ventura, f. lucchese, s. puglisi‐allegra psychology, medicine psychopharmacology save alert research feed lewy bodies in psychiatric patients d. peter birkett, a. desouky, l. han, m. kaufman psychology save alert research feed families at risk for psychopathology: who becomes affected and why? r. rende, r. plomin psychology save alert research feed ... ... references showing - of references sort byrelevance most influenced papers recency molecular genetics and human disease. implications for modern psychiatric research and practice. m. baron, j. d. rainer medicine the british journal of psychiatry : the journal of mental science save alert research feed family history studies: v. the genetics of mania. t. reich, p. clayton, g. winokur medicine the american journal of psychiatry save alert research feed the continuum of psychosis and its implication for the structure of the gene. t. crow psychology, medicine the british journal of psychiatry : the journal of mental science save alert research feed down's syndrome and alzheimer's disease: a review. c. oliver, a. holland psychology, medicine psychological medicine save alert research feed partly dominant transmission of schizophrenia in iceland. j. karlsson psychology, medicine the british journal of psychiatry : the journal of mental science save alert research feed bipolar affective disorders linked to dna markers on chromosome j. egeland, d. gerhard, + authors d. housman biology, medicine nature save alert research feed localisation of a susceptibility locus for schizophrenia on chromosome . m. owen, d. craufurd, d. st clair biology, medicine the british journal of psychiatry : the journal of mental science save alert research feed linkage between glucose- -phosphate dehydrogenase deficiency and manic-depressive psychosis. j. mendlewicz, p. linkowski, j. wilmotte psychology, medicine the british journal of psychiatry : the journal of mental science save alert research feed the genetic defect causing familial alzheimer's disease maps on chromosome . p. st george-hyslop, r. tanzi, + authors d. drachman biology, medicine science , save alert research feed a polymorphic dna marker genetically linked to huntington's disease j. gusella, n. wexler, + authors joseph b. martin biology, medicine nature , save alert research feed ... ... related papers abstract topics citations references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue mennofolk: mennonite and amish folk traditions (review) mennofolk: mennonite and amish folk traditions (review) alan l. chan journal of american folklore, volume , number , winter , pp. - (review) published by american folklore society doi: for additional information about this article [ this content has been declared free to read by the pubisher during the covid- pandemic. ] https://doi.org/ . /jaf. . https://muse.jhu.edu/article/ https://doi.org/ . /jaf. . https://muse.jhu.edu/article/ journal of american folklore ( ) ideology and gender politics, especially in its relationship to the classical jewish languages and the majority tongues that surrounded and overlapped its territory. although katz painstakingly charts the his- tory of speakers of yiddish and provides an excel- lent framework for understanding how the lan- guage emerged and grew, he is rather parsimonious with the details of how the lan- guage itself changed over time and distance. he delves into this subject most deeply in the chap- ter “genesis,” in which he shows not only how historical analysis of word variants and grammar allows for a rough estimate of the place and time of the language’s origin but also how newly ar- rived jewish immigrants from southern europe and the near east to germany acclimated to the environment, playfully assigning biblical names to the european territories in which they found themselves. (ashkenaz, the name given to ger- many and later to all of yiddishland, comes from the book of jeremiah.) then again, katz is clearly concerned primarily with elucidating the social contexts of yiddish rather than linguistic nuts and bolts. as a professional linguist, katz has covered the technical details of yiddish in depth in many previous publications. the final chapter of the book addresses the most controversial aspect of yiddish: its future. katz treats this topic with admirable clarity and honesty, and he states unapologetically what yid- dish enthusiasts consider, to put it gently, to be a bitter pill to swallow: the linguistic and demo- graphic evidence suggests that, outside of aca- demia, the world of secular yiddish is doomed to die a natural death, albeit one tragically has- tened by the holocaust and stalin’s purges. the future of yiddish lies with the hasidic sects for whom the language has always been their native tongue and an important literary vehicle. katz makes the claim that yiddish as a living language cannot exist without its speakers maintaining intimate contact with the world of traditional jewish scholarship and its associated classical languages—what he summarizes as the “trilin- gualism of old ashkenaz” (p. ) —as well as retaining a privileged place in the home and in daily life. as he observes, even the most radical leftist yiddish writers were steeped in traditional learning before breaking with religion. without the classical teaching, katz argues, too many of the nuanced expressions of hebrew or aramaic derivation lose their psychosocial significance and disappear from the lexicon. likewise, with- out pride of place in ordinary communication, yiddish will gradually cede ground to the host languages that surround it in every community. in short, yiddish cannot long survive outside of a jewish community that largely keeps to itself and uses yiddish in at least some aspects of daily life. katz therefore ends with a call for linguists to focus seriously upon the living language of the hasidim, even as masters of secular yiddish literature offer a few last pearls of their craft for us to appreciate. mennofolk: mennonite and amish folk tra- ditions. by ervin beck. (scottsdale, ny: herald press, . pp. , foreword, preface, pho- tographs and illustrations, notes, suggested readings, credits.) alan l. chan lutheran theological seminary, hong kong the forty-sixth addition to the studies in ana- baptist and mennonite history book series published by herald press, ervin beck’s men- nofolk: mennonite and amish folk traditions demonstrates that mennonites and amish con- stitute a religious faith with folk traditions that can be traced to the anabaptists in europe in the sixteenth century. the nine chapters cover diverse traditional genres such as ethnic slurs, origin tales and beliefs, trickster tales, urban legends, protest songs, material culture, and festival. the author was an english professor at goshen college from to and is con- sidered to be an insider of the mennonite and amish culture. beck’s purpose for writing this book is to make both mennonites and interested non- mennonites more aware of the group’s cultural traditions. these traditions have been learned by word of mouth or customary example and have been transmitted to succeeding generations of mennonites. they involve both long-estab- lished materials and creative variants, and they express feelings, ideas, and values that are im- portant for the individuals who pass them on in informal performance venues and also for the community that unselfconsciously sponsors them (pp. – ). the study does not only focus on narrative. as the mennonites and amish are famous for their conscientious objection to war, there is a chapter on protest songs. glass paint- ings of flowers, birds, and butterflies with moral statements are a common genre of folk art in the culture, and beck provides an examination of this kind of cultural production. almost every mennonite home has a family record book, and genealogy is a vigorous form of historical mem- ory practiced within the community, including the maintenance of detailed birth, marriage, and death records. the relief sale festival is a folk festival, not a fair, organized by the mennonites and for the mennonites. beyond these genres, this is, most importantly, a book of countless tales. it shows how individual stories can be re- told in differing versions with various under- standings and interpretations, and it also ex- plores humorous narratives. in sum, beck’s mennofolk is an interesting introduction to the mennonite folk culture through stories and other traditions. the lan- guage used in the book is plain and clear, and the concepts conveyed are easy to grasp. if a picture is worth a thousand words, the generous inclu- sion of photographs and illustrations in the book has definitely aided my understanding of the mennonites’ uniqueness as a people. finally, this study is recommended to all who want to gain a general knowledge of mennonite religious and folk traditions from an insider’s perspective. bodies: sex, violence, disease, and death in contemporary legend. by gillian bennett. (jackson: university of mississippi press, . pp. x + , preface, key texts, references, after- word, index.) stiofán Ó cadhla university college cork, ireland when we consider the s, our attention can- not help but be drawn to urban and contempo- rary legends. this decade has taken on the con- notations of revolution, rock and roll, sex, hippies, and feminism, all jostling in the final and fateful confrontation of tradition and mo- dernity. here, fairies and monsters are replaced by aliens and hook-handed killers, and myth and folktale are replaced by news and history—but legend continues to partake of both. this is, per- haps, legend’s central problematic. in her mar- velously accessible but scholarly style, gillian bennett goes straight to the heart of this prob- lematic, “the cultural clash of discordant catego- ries and concepts” (p. xv). she reminds us that one of the key facts about the legend is that it is difficult to define. legends are marked by their longevity, geographical spread, style, the multi- plicity of audio and visual media through which they are disseminated, and the recurrence of specific details or motifs. avoiding the carto- graphic pedantry (that is, the historical-geo- graphical or finnish method) of definition and delimitation, bennett points out that legend is not a scientific term and, as such, it has no real referent. legend can be superstition, relic, delu- sion, and curiosity, or it can be cool, new, sexy, urban, and teenaged. in the unfolding reassess- ments of the discipline, legend has been decon- structed or at least “declassified”—the distinc- tion between reality and legend is no longer considered to be clear-cut. contemporary leg- end, itself an orphan of the s, has in many ways become an exemplar of the contemporary life of the discipline. bennett’s bodies, therefore, is about folklore as much as it is about contemporary legend. in her encyclopedic detail and analysis, bennett draws attention away from the supposed nov- elty of the genre to broader generalizations about the discipline. following paul klee’s ap- proach to painting, bennett takes “a line for a walk,” exploring thematically the evolving shape and form of six particular legend case studies from their early variants to their con- temporary inflections (p. xv). here the shape- shifting element of story is exemplified. story is information, entertainment, strategy, news, gossip, rumor, warning, lesson, joke, photocopy, graffiti, fallacy, or political commentary—in short, a palimpsest of life. as a popular poetics of interpretation, legends may be better under- stood within contemporary discursive para- digms or contexts. they are a kind of social, book reviews edinburgh research explorer linkage disequilibrium mapping of the replicated type diabetes linkage signal on chromosome q citation for published version: prokopenko, i, zeggini, e, hanson, rl, mitchell, bd, rayner, nw, akan, p, baier, l, das, sk, elliott, ks, fu, m, frayling, tm, groves, cj, gwilliam, r, scott, lj, voight, bf, hattersley, at, hu, c, morris, ad, ng, m, palmer, cna, tello-ruiz, m, vaxillaire, m, wang, cr, stein, l, chan, j, jia, w, froguel, p, elbein, sc, deloukas, p, bogardus, c, shuldiner, ar & mccarthy, mi , 'linkage disequilibrium mapping of the replicated type diabetes linkage signal on chromosome q', diabetes , vol. , no. , pp. - . https://doi.org/ . /db - digital object identifier (doi): . /db - link: link to publication record in edinburgh research explorer document version: publisher's pdf, also known as version of record published in: diabetes publisher rights statement: readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered. see http://creativecommons.org/licenses/by-nc-nd/ . / for details. general rights copyright for the publications made accessible via the edinburgh research explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. take down policy the university of edinburgh has made every reasonable effort to ensure that edinburgh research explorer content complies with uk legislation. if you believe that the public display of this file breaches copyright please contact openaccess@ed.ac.uk providing details, and we will remove access to the work immediately and investigate your claim. download date: . apr. https://doi.org/ . /db - https://doi.org/ . /db - https://www.research.ed.ac.uk/portal/en/publications/linkage-disequilibrium-mapping-of-the-replicated-type- -diabetes-linkage-signal-on-chromosome- q(e fb -fb - a -adef- d bad).html linkage disequilibrium mapping of the replicated type diabetes linkage signal on chromosome q inga prokopenko, , eleftheria zeggini, , robert l. hanson, braxton d. mitchell, n. william rayner, , pelin akan, leslie baier, swapan k. das, , katherine s. elliott, mao fu, timothy m. frayling, christopher j. groves, , rhian gwilliam, laura j. scott, benjamin f. voight, , , , andrew t. hattersley, cheng hu, andrew d. morris, maggie ng, colin n.a. palmer, marcela tello-ruiz, martine vaxillaire, cong-rong wang, lincoln stein, , juliana chan, weiping jia, philippe froguel, , steven c. elbein, panos deloukas, clifton bogardus, alan r. shuldiner, and mark i. mccarthy, , , for the international type diabetes q consortium objective—linkage of the chromosome q – region to type diabetes has been demonstrated in multiple ethnic groups. we performed common variant fine-mapping across a -mb interval in a multiethnic sample to search for variants responsi- ble for this linkage signal. research design and methods—in all, , single nucleotide polymorphisms (snps) were successfully genotyped in , type diabetes case and control subjects from eight populations with evidence of q linkage. samples were ascer- tained using strategies designed to enhance power to detect variants causal for q linkage. after imputation, we estimate � % coverage of common variation across the region (r � . , europeans). association signals of interest were evaluated through in silico replication and de novo genotyping in � , case subjects and , control subjects. results—association mapping of the -mb region identified two strong signals, both of which were restricted to the subset of european-descent samples. the first mapped to the nos ap (capon) gene region (lead snp: rs , odds ratio . [ % ci . – . ], p � . � � , in case subjects and , control subjects); the second mapped within an extensive region of linkage disequilibrium that includes the ash l and pklr genes (lead snp: rs , odds ratio . [ . – . ], p � . � � , under a dominant model). however, there was no evidence for association at either signal on replication, and, across all data (� , subjects), there was no indication that these variants were causally related to type diabetes status. conclusions—detailed fine-mapping of the -mb region of replicated linkage has failed to identify common variant signals contributing to the observed signal. future studies should focus on identification of causal alleles of lower frequency and higher penetrance. diabetes : – , g enome-wide association (gwa) analysis has provided a powerful stimulus to the discovery of common variants influencing type diabetes risk, and, to date, � susceptibility loci have been identified with high levels of statistical confidence ( ). however, these known variants account for only a small proportion of the inherited component of disease risk (probably � %), and the molecular basis of the majority of the genetic predisposition to type diabetes has yet to be established ( ). the success of the gwa approach contrasts with the slow progress that characterized previous efforts to map susceptibility loci through genome-wide linkage ( ). how- ever, now that many of the common variants of largest effect have been identified (in european-descent popula- tions at least), there are cogent reasons to revisit regions previously identified through genome-wide linkage. first, variants within the genomic intervals representing repli- cated linkage signals can be considered to have raised prior odds for a susceptibility effect, and this information can be used to prioritize gwa signals (particularly those with only modest evidence of association) for targeted replication. second, genuine linkage signals are likely to be driven by causal variants—particularly low-frequency snps or copy number variants not captured by the com- from the wellcome trust centre for human genetics, university of oxford, oxford, u.k; the oxford centre for diabetes, endocrinology and metabo- lism, university of oxford, oxford, u.k.; the wellcome trust sanger institute, wellcome trust genome campus, hinxton, cambridge, u.k.; the phoenix epidemiology and clinical research branch, national institute of diabetes and digestive and kidney diseases, national institutes of health, phoenix, arizona; the school of medicine, university of maryland, balti- more, maryland; the endocrinology section, medical service, central arkansas veterans healthcare system, little rock, arkansas; the division of endocrinology and metabolism, department of internal medicine, col- lege of medicine, university of arkansas for medical sciences, little rock, arkansas; the institute of clinical and biomedical science, peninsula medical school, exeter, u.k.; the department of biostatistics and center for statistical genetics, university of michigan, ann arbor, michigan; the broad institute of harvard and massachusetts institute of technology, cambridge, massachusetts; the center for human genetic research, massachusetts general hospital, boston, massachusetts; the department of medicine, massachusetts general hospital, boston, massachusetts; the department of medicine, harvard medical school, boston, massa- chusetts; the shanghai diabetes institute, department of endocrinol- ogy & metabolism, shanghai jiaotong university no. people’s hospital, shanghai, china; the diabetes research group, biomedical research institute, university of dundee, dundee, u.k.; the department of medicine and therapeutics, chinese university of hong kong, shatin, hong kong, sar; the biomedical research institute, ninewells hospi- tal and medical school, dundee, u.k.; the cold spring harbor labora- tory, new york, new york; cnrs umr , institute of biology and lille university, pasteur institute, lille, france; informatics & biocomputing, ontario institute for cancer research, toronto, ontario, canada; genomic medicine, hammersmith hospital, imperial college london, london, u.k.; and the oxford national institute for health research biomedical research centre, churchill hospital, oxford, u.k. corresponding author: mark mccarthy, mark.mccarthy@drl.ox.ac.uk. received january and accepted april . i.p. and e.z. contributed equally to this work. published ahead of print at http://diabetes.diabetesjournals.org on april . doi: . /db - . © by the american diabetes association. readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered. see http://creativecommons.org/licenses/by -nc-nd/ . / for details. the costs of publication of this article were defrayed in part by the payment of page charges. this article must therefore be hereby marked “advertisement” in accordance with u.s.c. section solely to indicate this fact. brief report diabetes, vol. , july modity gwa arrays—with effect sizes larger than those currently detectable by gwa ( ). because alleles with these characteristics will have a more marked impact on individual disease predisposition than the common vari- ants found by gwa, identification of causal variants underpinning replicated linkage signals should accelerate efforts to obtain better predictors of disease ( ). for type diabetes, there appears to be only limited overlap between the regions identified by genome-wide linkage and those revealed by gwa ( ). although the discovery of tcf l was prompted by a search for causal variants within a region of replicated type diabetes linkage, neither the common variants in tcf l nor those in hhex and ide (a second nearby gwa signal) account for that linkage signal ( ). thus, the discovery of tcf l reflects either serendipity or the co-localization of com- mon and rare causal variants in the same locus—the former driving the association and the latter the linkage. similarly, whereas common variants in hnf a have been reported to explain the chromosome linkage signals seen in finns and ashkenazim ( , ), these associations have proved difficult to replicate ( ). chromosome q (in particular the -mb stretch adja- cent to the centromere) ranks alongside the regions on chromosomes and as among the strongest in terms of the replicated evidence for genome-wide linkage to type diabetes. linkage has been reported in samples of european (u.k., french, amish, utah), east asian (chi- nese, hong kong), and native american (pima) origin (summarized in supplementary table , which is available in the online-only appendix at http://diabetes.diabetes journals.org/cgi/content/full/db - /dc ; ref. ). the region concerned is gene rich and contains a dispropor- tionate share of excellent biological candidates ( ). the homologous region has also emerged as a diabetes sus- ceptibility locus from mapping efforts in several well- characterized rodent models ( – ). the international q consortium represents a coordi- nated effort by the groups with the strongest evidence for q linkage to identify variants causal for that signal. here, we report efforts to map causal variants using a custom linkage-disequilibrium (ld) mapping approach, predomi- nantly based around common snp variants, applied to a well-powered set of multiethnic samples. to improve power, ascertainment of type diabetes cases for this study aimed to enrich for q causal alleles through ) a focus on populations and samples that had shown q linkage; ) selection for positive family history; and ) for some samples, preferential recruitment on the basis of patterns of identity by descent sharing in the q region. for each set of case subjects, we selected a control sample of individuals from the same population. details of the recruitment have been reported previously ( ) and are summarized in the supplementary material available in the online appendix. in all, the case-control part of the study included , samples ( , case subjects, , control subjects) of european descent, ( case subjects, control subjects) of east asian origin, and ( case subjects, control subjects) who were native american (pima) (supplementary table ). we also included a small sample of individuals of african american origin ( case subjects, control subjects) and an additional pima individuals ( affected, nondia- betic after age years) from families who, after combination with the pima case-control set, were used for family-based association analyses. these samples were submitted to dense-map snp typing of the core region of interest (from . to . mb [build ]) using a series of , -plex beadarray designs (golden gate, illumina, san diego, ca). design of these arrays was contemporaneous with development of dbsnp and hapmap ( ). thus, whereas the first arrays were ld-agnostic and compiled using genomic localization as the primary consideration for inclusion, subsequent arrays used ld information from the ceu (european ancestry) and chb/jpt (asian ancestry) components of hapmap to guide snp selection and maximize coverage of the region. in all, we designed assays for , snps, of which , provided reliable data in all populations after passing through our extensive quality control (see the supplemen- tary material). we estimate that after imputation (using the appropriate set of hapmap data as a reference), coverage of the region (minor allele frequency � . ; r � . ) reaches � % in the european and � % in the east asian samples. coverage is harder to estimate (and impu- tation likely to be less valuable) in pima and african american samples, since reference data from these popu- lations are not available, although we estimate � % coverage in west africans based on yri data. genotyping quality was generally good, with over % of snps passing quality control in each population (see the supplementary material) and � . % of snps failing (p � � ) tests of within-sample hardy-weinberg equi- librium. significant departures from expectation in the distributions of test statistics observed in the amish and pima samples (as revealed by qq plots; see supplemen- tary material) likely reflect residual relatedness between subjects from those populations. we adjusted for this (and any population stratification effects) through genomic control methods ( ). association analyses treated each study as a separate stratum and used standard meta-analysis approaches to deliver estimates of joint effect size and statistical significance (see supplementary material). a series of nested meta-anal- yses were performed including ) european-descent samples only (“ -way”); ) non–african-descent samples only (“ -way”); and ) all samples (“ -way”). under an additive model with allele frequency of . , our sample provides � % power to detect per-allele odds ratios (ors) of � . (“ -way”) or � . (“ -way”) for � � � � . given that the region covers � % of the genome, we consider this a reasonable benchmark for “region- wide” significance (equivalent to consensus genome-wide thresholds of � � ). these power calculations are conservative: given the case ascertainment enrichment strategies used in this study, we would expect to detect variants with population-level effects in the . – . range. under reasonable assumptions (three independent alleles contributing to a linkage signal with a locus-specific sibling relative risk of � . ), we can expect the effect size of the variants we were seeking to detect (i.e., those responsible for the q linkage) to be substantially greater than this (e.g., allelic or . for a variant with risk allele frequency of %). our study was therefore well powered to detect putatively causal alleles within the european and/or combined datasets. across these analyses, none of the snps showed an association with type diabetes that withstood genome- wide correction (p � � � ) ( ). however, two clusters of snps showed association signals that ap- proached or exceeded “region-wide” significance thresh- olds. the first of these, involving rs and nearby i. prokopenko and associates diabetes, vol. , july snps, mapped to a . -kb interval (at � . mb) within the first intron of nos ap (nitric oxide synthase [neu- ronal] adaptor protein) with an estimated per allele or (in the -way, european-only analysis) of . ( % ci . – . , p � . � � , additive model, table , fig. ). rs lies � . kb from one of the snps (rs ) table association results for rs in the nos ap gene case subjects (n) control subjects (n) risk allele frequency in case subjects risk allele frequency in control subjects additive model or ( % ci) p u.k. . . . ( . – . ) . � � french . . . ( . – . ) . utah . . . ( . – . ) . � � amish* . . . ( . – . ) . meta-analysis: european descent populations , . ( . – . ) . � � shanghai . . . ( . – . ) . hong kong . . . ( . – . ) . pima* . . . ( . – . ) . meta-analysis: non-african populations , , . ( . – . ) . � � african american . . . ( . – . ) . meta-analysis: qc populations , , . ( . – . ) . � � replication samples independent wtccc sample , , . . . ( . – . ) . w c vs. bc , . . . ( . – . ) . ukt dgc , , . . . ( . – . ) . diabetes genetics initiative , , . . . ( . – . ) . fusion , , . . . ( . – . ) . meta-analysis: all replication samples , , . ( . – . ) . meta-analysis: all european descent populations , , . ( . – . ) . meta-analysis: all data , , . ( . – . ) . *p value for amish and pima was adjusted using estimated lambda for genomic control. wtccc, wellcome trust case control consortium. fig. . single-point type diabetes associations within the q region. this plot shows the “ -way” (european-descent samples only) meta-analysis using the additive model (cochran-armitage trend test). directly typed snps are shown in orange and imputed snps in blue. the pale blue track (and secondary y-axis) represents recombination rates (for hapmap ceu) across the region. blue diamonds represent the strongest association p value in the two regions taken forward for replication. in the case of the pklr/ash l region, the strongest association was seen for a dominant model (the equivalent additive model result is denoted with the red diamond). only a small subset of genes within the region is denoted on the gene track. chromosome q and type diabetes diabetes, vol. , july previously shown to influence cardiac repolarization and qt interval ( ): the two snps are in modest ld (r � . in hapmap ceu), and rs shows some evidence for association with type diabetes (p � . � � ) in the same -way meta-analysis. the second signal includes � snps in a -kb region of extensive ld at � . mb. this region includes the coding sequences of the genes encoding liver pyruvate kinase (pklr) and ash (absent, small, or homeotic)-like (drosophila) (ash l) among others. at the lead snp (rs ), the estimated or for the -way analysis was . ( . – . ) (p � . � � ) under the additive model. the effect size and significance were marginally greater ( . [ . – . ], p � . � � ), under a domi- nant model (table , fig. ). both signals were most prominent in the european samples, and there was no evidence that an equivalent association signal extended to the east asian, native american, or african american samples. though the asso- ciation p values for these two signals remained strong in the -way meta-analysis of all data ( . � � for rs and . � � for rs , tables and ), in each case they were driven by the larger european samples. analyses in the larger pima family-based associ- ation dataset also found no evidence of association (rs , p � . ; rs [r of one with rs in ceu and chb/jpt hapmap], p � . ). although neither signal was of sufficient effect size to be considered causal for the q linkage signal (the estimated sibling relative risk attributable to these loci in combination is only . ), we reasoned that these signals might nevertheless be pointers toward nearby causal variants (of lower frequency but higher pen- etrance) that were inadequately tagged by the snps we had typed. however, before proceeding to resequencing and fine-mapping, we first sought replication of our findings in independent datasets. mindful that our case ascertainment strategies may have led to inflated esti- mates of effect size compared with those evident in unselected case subjects, we recognized that large sample sizes would be required to test the observed associations. because the signals were clearest in european- descent samples, we focused replication on samples from northern europe. first, we used gwa data from the wellcome trust case control consortium ( , ). after removing overlap- ping case subjects, we examined , additional type diabetes case subjects and , control subjects with affymetrix k data (using imputation to test for associ- ation at the lead snps in each interval). no evidence of association was evident (rs , p � . ; rs , p � . ). similarly, analysis of gwa data from the diabetes genetics initiative ( ) and fusion ( ) studies provided no corroboration of either signal. furthermore, when analyzed jointly ( , case subjects, , control subjects), these three studies also failed to reveal any additional common variant signals of interest (p � � ) across the wider q region ( ) and no corroboration of any of the lesser signals evident in the q consortium analyses. tabl association results for rs in the pklr/ash l region case subjects (n) control subjects (n) risk allele frequency in case subjects risk allele frequency in control subjects additive model or ( % ci) p * u.k. . . . ( . – . ) . french . . . ( . – . ) . utah . . . ( . – . ) . amish* . . . ( . – . ) . � � meta-analysis: european descent populations , , . ( . – . ) . � � shanghai . . . ( . – . ) . hong kong . . . ( . – . ) . pima* . . . ( . – . ) . meta-analysis: non-african populations , , . ( . – . ) . � � african american . . . ( . – . ) . meta-analysis: qc populations , , . ( . – . ) . � � replication samples independent wtccc sample , , . . . ( . – . ) . w c vs. bc , . . . ( . – . ) . ukt dgc , , . . . ( . – . ) . diabetes genetics initiative , , . . . ( . – . ) . fusion , , . . . ( . – . ) . meta-analysis: all replication samples , , . ( . – . ) . meta-analysis: all european descent populations , , . ( . – . ) . meta-analysis: all data , , . ( . – . ) . *p value for amish and pima was adjusted using estimated lambda for gc. bc, british birth cohort; ukt dgc, united kingdom type diabetes genetics consortium; w c, warren cases; wtccc, wellcome trust case control consortium. i. prokopenko and associates diabetes, vol. , july finally, we genotyped the two lead snps (rs , rs ) using fluorogenic �-nuclease (taqman) as- says in , case subjects and , control subjects from the u.k. (the uk type diabetes genetics consortium and warren cases/ british birth cohort strata in tables and ). once again, there was no evidence of replication. taking into account all replication samples (� , case subjects, � , control subjects), there was no significant association with type diabetes (rs , or . [ % ci . – . ], p � . ; rs , or . [ . – . ], p � . [additive], . [ . – . ], p � . [dominant]). nominal significance was retained when these replication data were combined with the original q consortium case-control data (rs , p � . ; rs , p � . ), but these associations are unimpressive in either the region-wide or genome-wide context. even allowing for some heteroge- neity of effect size between the primary and replication datasets (due to ascertainment differences and the “win- ner’s curse”), there seems to be no substantive evidence that the association signals observed in the nos ap and the pklr/ash l region are genuinely associated with type diabetes. in summary, we have undertaken a detailed survey of common variants across the region of replicated q link- age, achieving coverage that exceeds that of available gwa data for the region. despite analysis of multiple ethnic groups in samples sufficiently powered (in the european-descent component at least) to have detected common variants causal for the linkage, we found no compelling signals. should we conclude therefore that the original evi- dence for q linkage was false? although this possibility cannot be discounted, it is worth considering that recent experience from gwa studies has shown that, for common susceptibility variants at least, effect sizes are modest and that none is of magnitude sufficient to generate a linkage signal detectable in achievable sam- ple sizes. efforts to explain the “missing heritability” for type diabetes (that is, the disparity between the predisposition attributable to the known loci and inde- pendent estimates of overall heritability and familiality) are now shifting toward the search for low-frequency, medium-penetrance alleles. alleles with these charac- teristics are likely to have escaped detection through the genome-wide approaches available so far, since they would be insufficiently penetrant to be detected with traditional linkage approaches applied to monogenic families and too infrequent to be reliably identified through gwa studies ( ). yet, low-frequency, medium- penetrance alleles could, particularly if several indepen- dent alleles map to the same locus, generate the kinds of linkage signals detectable in family-based studies (as is the case for nod /card and crohn’s, for example) ( ). detection of low-frequency susceptibility variants will require new approaches based around next-generation resequencing and large-scale fine-mapping. genome-wide resequencing of large case-control samples remains eco- nomically and logistically unfeasible, but targeted rese- quencing of selected regions is not, and the future plans of the q consortium include deep resequencing of the q region of interest, focusing at least initially on exons and conserved sequence. acknowledgments the principal funding for this study was provided as a supplement to niddk through r -dk and as a supplement to u -dk . other major support was provided by the national institutes of health (t - ag , r -dk , r -dk , k -dk , k - ca , r -dk , u -dk , and intramural funds); the university of maryland and arkansas general clinical research centers; the national center for re- search resources (m rr ); the department of vet- eran affairs and american diabetes association (u.s.); “ familles pour vaincre le diabète et l’obésité” and association française des diabétiques (france); diabetes u.k.; the hong kong research grants committee (cuhk / m; / c), chinese university of hong kong stra- tegic grant program (srp ) and hong kong innovation and technology support fund (its/ / ) (hong kong); and the national nature science foundation of china ( ), shanghai medical pioneer development project ( - - ; ) and shanghai science technol- ogy development foundation ( zb ) (china). we also recognize the funding support of the u.k. medical research council (g ), the oxford national insti- tute for health research biomedical research centre, the general clinical research centers program, the baltimore veterans administration geriatric research and educa- tion clinical center, and the wellcome trust (gr ). e.z. is a wellcome trust research career development fellow. for the birth cohort, venous blood collection was funded by the u.k. medical research council, and cell line production and dna extraction and processing was funded by the juvenile diabetes research foundation and the wellcome trust. no potential conflicts of interest relevant to this article were reported. we thank all the subjects participating in this study and those who contributed to collection of the clinical re- sources. in particular, we acknowledge members of the diabetes genetics initiative and the finland-u.s. investi- gation of niddm genetics (fusion) for sharing data from their studies. references . prokopenko i, mccarthy mi, lindgren cm. type diabetes: new genes, new understanding. trends genet ; : – . mccarthy mi. growing evidence for diabetes susceptibility genes from genome scan data. curr diab rep ; : – . risch n, merikangas k. the future of genetic studies of complex human diseases. science ; : – . mccarthy mi, abecasis gr, cardon lr, goldstein db, little j, ioannidis jp, hirschhorn jn. genome-wide association studies for complex traits: consensus, uncertainty and challenges. nat rev genet ; : – . mccarthy mi, zeggini e, jafar b, timpson nj, al-hasani n, frayling tm, weedon mn, elliott ks, lindgren cm, lango h, perry jrb, rayner nw, freathy rm, hattersley at, for the wellcome trust case control and ukt d consortia: analysis of overlap between type diabetes signals identified through genome-wide linkage and association approaches. dia- betes ; s :a . grant sf, thorleifsson g, reynisdottir i, benediktsson r, manolescu a, sainz j, helgason a, stefansson h, emilsson v, helgadottir a, styrkars- dottir u, magnusson kp, walters gb, palsdottir e, jonsdottir t, gud- mundsdottir t, gylfason a, saemundsdottir j, wilensky rl, reilly mp, rader dj, bagger y, christiansen c, gudnason v, sigurdsson g, thor- steinsdottir u, gulcher jr, kong a, stefansson k. variant of transcription factor -like (tcf l ) gene confers risk of type diabetes. nat genet ; : – . silander k, mohlke kl, scott lj, peck ec, hollstein p, skol ad, jackson au, deloukas p, hunt s, stavrides g, chines ps, erdos mr, narisu n, conneely kn, li c, fingerlin te, dhanjal sk, valle tt, bergman rn, chromosome q and type diabetes diabetes, vol. , july tuomilehto j, watanabe rm, boehnke m, collins fs. genetic variation near the hepatocyte nuclear factor- alpha gene predicts susceptibility to type diabetes. diabetes ; : – . love-gregory ld, wasson j, ma j, jin ch, glaser b, suarez bk, permutt ma. a common polymorphism in the upstream promoter region of the hepatocyte nuclear factor- alpha gene on chromosome q is associated with type diabetes and appears to contribute to the evidence for linkage in an ashkenazi jewish population. diabetes ; : – . barroso i, luan j, wheeler e, whittaker p, wasson j, zeggini e, weedon mn, hunt s, venkatesh r, frayling tm, delgado m, neuman rj, zhao j, sherva r, glaser b, walker m, hitman g, mccarthy mi, hattersley at, permutt ma, wareham nj, deloukas p. population-specific risk of type diabetes conferred by hnf a p promoter variants: a lesson for replica- tion studies. diabetes ; : – . gauguier d, froguel p, parent v, bernard c, bihoreau mt, portha b, james mr, penicaud l, lathrop m, ktorza a. chromosomal mapping of genetic loci associated with non-insulin dependent diabetes in the gk rat. nat genet ; : – . galli j, li ls, glaser a, östenson cg, jiao h, fakhrai-rad h, jacob hj, lander es, luthman h. genetic analysis of non-insulin dependent diabetes mellitus in the gk rat. nat genet ; : – . masuyama t, fuse m, yokoi n, shinohara m, tsujii h, kanazawa m, kanazawa y, komeda k, taniguchi k. genetic analysis for diabetes in a new rat model of nonobese type diabetes, spontaneously diabetic torii rat. biochem biophys res commun ; : – . wallace kj, wallis rh, collins sc, argoud k, kaisaki pj, ktorza a, woon py, bihoreau mt, gauguier d. quantitative trait locus dissection in congenic strains of the goto-kakizaki rat identifies a region conserved with diabetes loci in human chromosome q. physiol genomics ; : – . zeggini e, damcott cm, hanson rl, karim ma, rayner nw, groves cj, baier lj, hale tc, hattersley at, hitman ga, hunt se, knowler wc, mitchell bd, ng mc, o’connell jr, pollin ti, vaxillaire m, walker m, wang x, whittaker p, xiang k, jia w, chan jc, froguel p, deloukas p, shuldiner ar, elbein sc, mccarthy mi. variation within the gene encoding the upstream stimulatory factor does not influence susceptibility to type diabetes in samples from populations with replicated evidence of linkage to chromosome q. diabetes ; : – . international hapmap consortium: a haplotype map of the human ge- nome. nature ; : – . devlin b, roeder k. genomic control for association studies. biometrics ; : – . dudbridge f, koeleman bp. efficient computation of significance levels for multiple associations in large studies of correlated data, including genome- wide association studies. am j hum genet ; : – . arking de, pfeufer a, post w, kao wh, newton-cheh c, ikeda m, west k, kashuk c, akyol m, perz s, jalilzadeh s, illig t, gieger c, guo cy, larson mg, wichmann he, marban e, o’donnell cj, hirschhorn jn, kaab s, spooner pm, meitinger t, chakravarti a. a common genetic variant in the nos regulator nos ap modulates cardiac repolarization. nat genet ; : – . wellcome trust case control consortium: genome-wide association study of , cases of seven common diseases and , shared controls. nature ; : – . zeggini e, weedon mn, lindgren cm, frayling tm, elliott ks, lango h, timpson nj, perry jr, rayner nw, freathy rm, barrett jc, shields b, morris ap, ellard s, groves cj, harries lw, marchini jl, owen kr, knight b, cardon lr, walker m, hitman ga, morris ad, doney as; wellcome trust case control consortium (wtccc), mccarthy mi, hattersley at. replication of genome-wide association signals in uk samples reveals risk loci for type diabetes. science ; : – . saxena r, voight bf, lyssenko v, burtt np, de bakker pi, chen h, roix jj, kathiresan s, hirschhorn jn, daly mj, hughes te, groop l, altshuler d. genome-wide association analysis identifies loci for type diabetes and triglyceride levels. science ; : – . scott lj, mohlke kl, bonnycastle ll, willer cj, li y, duren wl, erdos mr, stringham hm, chines ps, jackson au, prokunina-olsson l, ding cj, swift aj, narisu n, hu t, pruim r, xiao r, li xy, conneely kn, riebow nl, sprau ag, tong m, white pp, hetrick kn, barnhart mw, bark cw, goldstein jl, watkins l, xiang f, saramies j, buchanan ta, watanabe rm, valle tt, kinnunen l, abecasis gr, pugh ew, doheny kf, bergman rn, tuomilehto j, collins fs, boehnke m. a genome-wide association study of type diabetes in finns detects multiple susceptibility variants. science ; : – . zeggini e, scott lj, saxena r, voight bf, marchini jl, hu t, de bakker pi, abecasis gr, almgren p, andersen g, ardlie k, bostrom kb, bergman rn, bonnycastle ll, borch-johnsen k, burtt np, chen h, chines ps, daly mj, deodhar p, ding cj, doney as, duren wl, elliott ks, erdos mr, frayling tm, freathy rm, gianniny l, grallert h, grarup n, groves cj, guiducci c, hansen t, herder c, hitman ga, hughes te, isomaa b, jackson au, jorgensen t, kong a, kubalanza k, kuruvilla fg, kuusisto j, langenberg c, lango h, lauritzen t, li y, lindgren cm, lyssenko v, marvelle af, meisinger c, midthjell k, mohlke kl, morken ma, morris ad, narisu n, nilsson p, owen kr, palmer cn, payne f, perry jr, pettersen e, platou c, prokopenko i, qi l, qin l, rayner nw, rees m, roix jj, sandbaek a, shields b, sjogren m, steinthorsdottir v, stringham hm, swift aj, thorle- ifsson g, thorsteinsdottir u, timpson nj, tuomi t, tuomilehto j, walker m, watanabe rm, weedon mn, willer cj, illig t, hveem k, hu fb, laakso m, stefansson k, pedersen o, wareham nj, barroso i, hattersley at, collins fs, groop l, mccarthy mi, boehnke m, altshuler d. meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type diabetes. nat genet ; : – . hugot jp, chamaillard m, zouali h, lesage s, cezard jp, belaiche j, almer s, tysk c, o’morain ca, gassull m, binder v, finkel y, cortot a, modigliani r, laurent-puig p, gower-rousseau c, macry j, colombel jf, sahbatou m, thomas g. association of nod leucine-rich repeat variants with suscep- tibility to crohn’s disease. nature ; : – i. prokopenko and associates diabetes, vol. , july mutations in kptn cause macrocephaly, neurodevelopmental delay, and seizures report mutations in kptn cause macrocephaly, neurodevelopmental delay, and seizures emma l. baple, , reza maroofian, , barry a. chioza, , maryam izadi, , harold e. cross, saeed al-turki, katy barwick, anna skrzypiec, robert pawlak, karin wagner, roselyn coblentz, tala zainy, michael a. patton, sahar mansour, phillip rich, britta qualmann, matt e. hurles, michael m. kessels, and andrew h. crosby ,* the proper development of neuronal circuits during neuromorphogenesis and neuronal-network formation is critically dependent on a coordinated and intricate series of molecular and cellular cues and responses. although the cortical actin cytoskeleton is known to play a key role in neuromorphogenesis, relatively little is known about the specific molecules important for this process. using linkage analysis and whole-exome sequencing on samples from families from the amish community of ohio, we have demonstrated that mutations in kptn, encoding kaptin, cause a syndrome typified by macrocephaly, neurodevelopmental delay, and seizures. our immunofluorescence analyses in primary neuronal cell cultures showed that endogenous and gfp-tagged kaptin associates with dynamic actin cytoskeletal structures and that this association is lost upon introduction of the identified mutations. taken together, our studies have identified kaptin alterations responsible for macrocephaly and neurodevelopmental delay and define kaptin as a molecule crucial for normal human neuromorphogenesis. extremes of brain growth have frequently been associated with impaired neurodevelopment and cognition. occipi- tofrontal circumference is an indirect measure of brain growth and the one most widely used in clinical practice in which macrocephaly (r sds above the mean) is indic- ative of brain overgrowth (megalencephaly) in the absence of hydrocephalus and cranial thickening. the differential diagnosis of macrocephaly relates to the underlying presence or absence of structural brain anomalies. the strong association between macrocephaly and neuro- developmental disability, autism, and other pervasive developmental disorders is well recognized. – where macrocephaly is associated with developmental disability, there appears to be a significantly increased risk of sei- zures. over recent years, family studies have begun to identify gene mutations that might cause inherited forms of developmental disability. these studies have shed important new light on the molecular and cellular pro- cesses that orchestrate the human neuronal circuitry and that might be dysfunctional in neurological disorders. the establishment of the incredibly intricate human neu- ral circuitry is critically dependent upon a complex and tightly regulated myriad of cellular processes and migra- tional cues. the actin cytoskeleton is known to play an important role in the formation, propagation, and steering of cell motility and migration during brain development. this in turn leads to the astonishing morphological intri- monogenic molecular genetics, university of exeter medical school, st. luke i, jena university hospital and friedrich schiller university jena, d- jena of arizona school of medicine, n. alvernon way, tucson, az , usa; ton, cambridge cb sa, uk; laboratory of neuronal plasticity & behaviour road, exeter ex ps, uk; windows of hope genetic study, holmes county, o healthcare nhs trust, london sw qt, uk; department of neuroradiolog these authors contributed equally to this work *correspondence: a.h.crosby@exeter.ac.uk http://dx.doi.org/ . /j.ajhg. . . . � the authors this is an open-access article distributed under the terms of the creative comm reproduction in any medium, provided the original author and source are cre the a . open access u cacy that neurons acquire during neuronal differentia- tion, which is required for the formation of the complex functional neuronal networks underlying human higher brain functions. mutations in genes encoding molecules important for normal function of the actin cytoskeleton have previously been implicated in inherited forms of developmental disability and brain development, – high- lighting the important role of the actin cytoskeleton in neuromorphogenesis. the studies described here derive from the analysis of blood samples obtained for dna extraction (informed consent was obtained from families from the anabaptist communities of ohio according to protocols approved by the institutional review board at the university of arizona and the wandsworth regional ethics committee). nine family members present in four nuclear families were affected by an inherited variable form of neurodevelop- mental delay. the most consistent features were global developmental delay, macrocephaly with frontal bossing, high levels of anxiety, and some features suggestive of a pervasive developmental disorder. additional features included craniosynostosis, recurrent pneumonia, and sple- nomegally. neuroimaging was performed in four cases, and no significant intracranial abnormalities were re- ported. a primary seizure disorder, involving absence or generalized tonic-clonic seizures, was described in three of the nine cases. dysmorphic features were subtle and ’s campus, magdalen road, exeter ex lu, uk; institute for biochemistry , germany; department of ophthalmology and vision science, university wellcome trust sanger institute, wellcome trust genome campus, hinx- , university of exeter medical school, hatherly laboratories, prince of wales h , usa; south west thames regional genetics service, st. george’s y, st. george’s hospital, london sw qt, uk ons attribution license, which permits unrestricted use, distribution, and dited. merican journal of human genetics , – , january , nder cc by license. mailto:a.h.crosby@exeter.ac.uk http://dx.doi.org/ . /j.ajhg. . . http://crossmark.crossref.org/dialog/?doi= . /j.ajhg. . . &domain=pdf http://creativecommons.org/licenses/by/ . / figure . family pedigree and gene mapping (a) pedigree diagram showing all four investigated nuclear families (families – ), which interlink into a single extended family. segregation of the two mutations identified (c. c>a [p.ser *] is denoted by x, and c. _ dup [p.met _gln dup] is denoted by dup) is shown (all genotypings were validated by dideoxy sequence analysis). (b) pictorial representation of the snp genotype data encompassing the chromosome homozygous (solid box) and compound- heterozygous (dashed box) regions in affected individuals. the locus containing the pathogenic variant is demarcated by snps rs and rs ( . mb; families and ). included frontal bossing, broad nasal tip, scaphocephaly, hooded eyelids with small, downslanting palpebral fis- sures, and a prominent chin (table s and figure s , avail- able online). in order to map the chromosomal location of the patho- genic variant, we genotyped samples from families and genome-wide by using illumina human cytosnp- beadchip arrays incorporating ~ , genetic markers. a single notable homozygous . mb region in q. . was found to be shared by all affected individ- uals in families and , although no notable homozygous regions were detected in affected members of families or (figures a and b). considered likely to harbor the path- ogenic variant in these families, the homozygous region identified in families and is delimited by recombinant snp markers rs and rs and contains genes. autozygosity across this interval was corroborated by microsatellite-marker analysis in all family members, which defined a haplotype cosegregating with the disease phenotype (data not shown). to identify the causative mutation, we undertook whole-exome sequence analysis of a single affected individual (ix: , figure a) to generate a profile of variants not present in publically available databases and rare sequence variants. coding regions were captured with a sureselect target enrichment system ( mb) and sequencing on a hiseq system (illumina) with bp paired-end reads. we obtained . gb of reads, of the american journal of human genetics , – , january , which % had a quality score r . approximately % of the reads were marked as duplicates by picard (v. . ) and were excluded before mapping to the human genome reference sequence (grch ). the genome analysis toolkit (gatk, v. . . ) was used to realign reads near potential indel sites and to recalibrate base qualities; single-nucleotide variants were called with gatk and samtools (v. . . ), whereas indels were called with gatk and dindel (v. . ). all variants were annotated with dbsnp ( ) and the genomes pilot study (may ) for minor allele frequency. the variant conse- quences on protein structure were predicted by the variant effect predictor (vep v. . ) with the use of ensembl (v. ). variants were filtered out if the read depth was < or > , , if the consensus quality was < , or if the snp quality was < . after filtering, only one likely delete- rious variant (g. g>t [nc_ . ] [c. c>a (nm_ . ); p.ser * (np_ . )]) in exon of kptn, encoding the amino acid protein kaptin, was identified within the critical region. the presence of the variant was confirmed by dideoxy sequencing, which also confirmed its cosegregation within families and (figure a). seven heterozygous carriers were identified in examined control chromosomes, indicating an allele frequency of approximately . in this commu- nity. the variant is also listed in the national heart, lung, and blood institute (nhlbi) exome sequencing project exome variant server, and one heterozygote has been reported in , european american chromosomes. we next investigated other amish families with chil- dren showing similar unexplained developmental delay associated with macrocephaly, leading to the detection of the c. c>a mutation in the heterozygous state in affected members of of such families (families and ). compared with this mutation’s occurrence in amish control studies, this frequency was higher than expected, prompting us to evaluate kptn for a second mutation that could be acting in conjunction with the c. c>a mutation in these families. subsequent dideoxy sequence analysis of all coding regions and associated splice junctions of kptn in these families revealed that all affected children were indeed compound heterozygous for the c. c>a variant, as well as an in-frame bp duplication (g. _ dup [nc_ . ] [c. _ dup (nm_ . ); p.met _gln dup (np_ . )]) in exon . both the c. c>a and the c. _ dup sequence mutations completely cosegregate with the disease phenotype, as would be expected of causative compound-heterozygous mutations (figure a, lodmax ¼ . simwalk ). the c. _ dup sequence duplication is not listed in genomic sequence databases, and one heterozygote was detected in amish control chromosomes. kptn encodes a largely uncharacterized protein (figure s ). our sequence analyses of kaptin identified no protein domains or homologous human proteins that could provide clues to the functional basis of the neurolog- ical deficits associated with its alteration. we therefore investigated the expression and localization of kaptin in neurons. in order to do so, we first cloned human kaptin from human embryonic kidney cell cdna obtained by rna isolation and rt-pcr as previously described. full-length kaptin (amino acids – ) was generated by pcr using primers bq ( -aagaattcatgatggggg aggcg- ) and bq ( -aaggatccttaagaggctg catt- ). the pcr product was digested with ecori and bamh and cloned in-frame into pegfp-c and subcl- oned into pcmv-tag . primary rat hippocampal cultures were prepared and cultured as previously described. , neurons were transfected with lipofectamine (invi- trogen) on days , , and in vitro, fixed in % parafor- maldehyde in pbs for min at room temperature and hr after transfection, and processed for immunofluores- cence microscopy. confocal imaging was performed with a zeiss axio observer equipped with apotome and zeiss plan-apochromat / . and / . objectives and an axiocam mrm ccd camera (zeiss). primary rat hippocampal neurons, identifiable by anti-map immu- nostaining (sigma, abcam), were transfected with wild- type flag-tagged kaptin (flag-kaptin) at div and imaged days later. wild-type flag-kaptin was observed to be local- ized at f-actin-rich foci in close proximity to the cell bodies and at growth cones (figures a and b, arrow heads). at later stages of development, when neurons established the a synapses (div ), wild-type flag-kaptin again colocalized with f-actin-rich sites. along dendrites, these sites appeared mainly to represent f-actin-rich postsynapses, given that almost all kaptin-enriched puncta were contacted by presynaptic structures containing bassoon (a marker for presynaptic active zones) (figure c). to be able to undertake immunolabeling experiments of endog- enous kaptin, we first characterized polyclonal rabbit anti- kaptin (sigma) in cos- cells. cells expressing wild-type flag-kaptin were highlighted by anti-kaptin immuno- labeling (figure s a). coimmunostaining of primary rat hippocampal neurons at div with anti-kaptin and anti-shank (neuromab) demonstrated that the dendritic accumulations of flag-kaptin at f-actin-rich puncta are indeed of physiological relevance and reflect the locali- zation of endogenous kaptin at postsynapses. the vast majority of anti-kaptin-immunolabeled puncta were not only enriched with f-actin but were additionally immuno- positive for shank , a postsynaptic scaffold protein inter- acting with f-actin binding proteins; , figure d). kaptin thus appears to be associated with dynamic actin cytoskeletal structures of neuronal cells. consistent with this, wild-type flag-kaptin accumulated at cos- cell lamellipodia (figure s b), the subcellular regions marked by dense arrays of dynamic actin filaments in mobile fibro- blasts. in neurons, the cortical actin cytoskeleton is known to be important for proper neuronal-network formation during development. our observations therefore suggest a role for kaptin in neuromorphogenesis. the c. c>a sequence variant is predicted to introduce a premature stop codon and result in loss of function as a result of degradation of the mutated transcript by mrna-surveillance mechanisms; however, because of a lack of patient material, we have been unable to confirm whether a truncated protein (lacking the c-terminal amino acids – ) is produced. in contrast, the in-frame c. _ dup mutation is likely to result in the insertion of six amino acids (met-trp-ser-val-leu-gln) into the full- length kaptin. in order to investigate the functional outcome of this mutation, we undertook in silico analysis of the secondary structural elements of wild-type and altered kaptin. this revealed that the n-terminal half of kaptin is likely to comprise a series of relatively densely organized b sheets, interspersed by only three a helices, and becomes more a-helical starting with a-helix (span- ning amino acids – ; figure a). sequence and pre- dicted structural conservation of both the n-terminal and c-terminal portions of kaptin are very high even between evolutionarily distant mammalian species (figure s ). strikingly, duplication of the six amino acids ( – ) is predicted to disrupt a-helix and result in its conversion into an extended b sheet (figure c) and is therefore likely to have a profound effect on kaptin function. in order to experimentally explore the functionality of any protein arising from translated mutant transcripts, we generated both disease-associated gfp-tagged mutants. we generated the p.met _gln dup altered kaptin merican journal of human genetics , – , january , figure . kaptin immunolocalization studies (a and b) flag-kaptin colocalized with f-actin-rich foci at the cell body and in growth cones (examples of both are marked by arrow heads in a) in div rat hippocampal neurons transfected at div . for clarity, the anti-map immunostaining was omitted from the merged images. scale bars represent mm. (c and d) endogenous kaptin immunostained together with the presynaptic marker bassoon at div (c) and with the postsynaptic marker shank at div (d). puncta enriched with anti-kaptin immunoreactivity (marked by arrow heads) were rich in f-actin, as shown by fluorescently labeled phalloidin. (c) furthermore, they were usually contacted by presynapses. the scale bar represents mm. (d) postsynapses marked by shank were largely positive for both f-actin and anti-kaptin immunolabeling (arrow heads). for clarity, the anti-f-actin staining was omitted from the merged image in (d). high-magnification images are shown. the scale bar represents . mm. (gfp-kaptinp.met _gln dup) by fusing an n-terminal portion carrying the duplication and a smai site introduced as a silent mutation (primers bq [ -aagaattcat gatgggggaggcg- ] and bq [ -tcacccggga gatgggcccgtcttgcaacacgctccacatctgcagg accgaccac- ]) with a c-terminal portion contain- ing a smai site also introduced by silent mutation (primers bq [ -atctcccgggtgattgtgttcag- ] and bq [ -aaggatccttaagaggctgcatt- ]). we generated the p.ser * altered kaptin (gfp- kaptin – ) by pcr using primers bq ( -aagaattc atgatgggggaggcg- ) and bq ( -aagtcgac ctagaggctgaacac- ). pcr products were cloned in- frame into pegfp-c . whereas wild-type gfp-tagged kaptin (gfp-kaptin) was found to localize at f-actin-rich lamellipo- dia of cos- cells, both altered forms of kaptin displayed no f-actin association but instead accumulated at irregular perinuclear sites (figures d– f). gfp-kaptin – showed a more pronounced tendency to form such accumulations; almost all cells were marked with little additional cyto- plasmic staining outside of these foci. alternatively, gfp- kaptinp.met _gln dup typically displayed fewer and slightly smaller accumulations; there were slightly higher levels of cytoplasmatic staining outside of these foci (fig- the american journal of human genetics , – , january , ures d– f). this indicates that both proteins are likely to benonfunctional, although wecannot exclude thepossibil- ity that misfolded altered protein might accumulate in neu- rons of affected individuals and lead to dominant-negative effects on other neuronal proteins or cell processes. finally, because kptn mutations result primarily in a form of neurodevelopmental disease, we also analyzed the behavior of the altered forms of kaptin in primary hippo- campal neurons during early development. whereas wild- typegfp-kaptin was againfoundtocolocalizewith dynamic f-actin in growth cones and foci at the cell body, both gfp- kaptin – and gfp-kaptinp.met _gln dup were found to accumulate in a manner reminiscent of the cos- studies in the cell body or at perinuclear sites (figures g– i). we investigated a number of families from the anabaptist communities of ohio and found that multiple individuals aged – years were affected by a syndrome in which the cardinal features include macrocephaly, global develop- mental delay, behavioral abnormalities, and seizures. our molecular studies determined that two distinct founder mutations affecting the same gene (kptn, encoding kaptin), both of which have become entrapped within the community, are responsible. compared with individuals found to be compound heterozygous for p.ser * figure . immunolocalization studies of altered kaptin (a–c) schematic representation of wild-type human kaptin (a), the truncated p.ser * (c. c>a; gfp-kaptin – ) (b), and the dupli- cation (gfp-kaptinp.met _gln dup) (c). on the left is a graphic overview of secondary structures; b sheets are shown as red boxes, and a-helices are shown as blue ellipsoids. on the right are amino acids and secondary-structure elements around amino acid . a-helix is predicted to be converted into a b sheet by the insertion of amino acids – , as shown in yellow. (d–f) localizations of gfp-kaptin, gfp-kaptin – , and gfp-kaptinp.met _gln dup (green in merges) in cos- cells counterstained with phalloidin (red in merged images). note that whereas wild-type kaptin was distributed in the cytosol and accumulated at f-actin-rich lamellipodia (d), both alterations showed accumulations at perinuclear regions (e and f). (legend continued on next page) the american journal of human genetics , – , january , and p.m _q dup, those individuals found to be homozygous for the p.ser * nonsense alteration ap- peared to be more severely affected given that they had a higher incidence of seizures and a greater degree of intel- lectual impairment. this might indicate that p.met _ gln dup retains a limited functionality in vivo, and perhaps consistent with this, we observed that p.met _gln dup showed a slightly lesser tendency than p.ser * to form perinuclear accumulations in our transfection studies. however, the sample cohort is currently too small for confidently determining any geno- type-phenotype correlation. kaptin is a largely uncharacterized protein originally iso- lated from human blood platelets but subsequently found to be expressed in fibroblasts and intestinal and sensory epithelia. a previous study of this molecule suggested a role at stereocilia tips, and so kptn was proposed as a candidate gene for hearing loss. however, the affected individuals described in this study have no evidence of sensorineural hearing deficits. during development, the actin cytoskeleton plays a pivotal role in neuronal cell morphology and migration, including the generation, pro- trusion, and steering of growth cones and the formation of postsynapse and dendritic spines. – our studies confirm kaptin expression in neuronal (map -positive) cells. given that kaptin was found to localize to f-actin-rich structures, it is conceivable that loss of kaptin function could either directly or indirectly lead to impairment of the neuronal actin cytoskeleton, required for dendritic arborization and/or spine formation, and result in the disease pheno- type described. support for this has been provided by studies of rab b, a small gtpase associated with the golgi apparatus; alterations in this protein lead to its downregulation and a concomitant reduction in dendritic arborization and synapse formation. this was previously associated with a disease phenotype comprising mental retardation, epilepsy, and macrocephaly, , features which overlap with those described here as arising from kaptin alterations. similarly, deficiencies of rho gtpases, which regulate the actin cytoskeleton by a growing variety of effector proteins, have been associated with intellectual disability and defects in spine structure. – several other actin-associated proteins, including drebrin a, cortactin, and abp , have also been found to decrease spine density or formation, – and a growing body of evidence sup- ports a role for the arp / complex and directly and indi- rectly associated proteins in postsynapse formation and proper development of neuronal morphology. , , , – our analyses reveal that wild-type kaptin is enriched in neuronal growth cones and at discrete cortical sites of neu- rons at early developmental stages. furthermore, wild-type kaptin was found to accumulate at postsynapses of neu- (g–i) transfection of div rat hippocampal neurons with wild-type a kaptin was found throughout the cell and showed accumulations at g in contrast, both alterations accumulated in areas of the cell body (h a green, map in red, and phalloidin in blue. scale bars represent m the american journal of human genetics , – , january , rons undergoing synaptogenesis (div ), as indicated by spatial correlation along dendrites of kaptin accumula- tions by phalloidin and synaptic-marker immunostaining. consistent with this, kaptin was also found to be present in the postsynapses of mature neurons. the sites demar- cated by kaptin localization represent areas of high f-actin content and high actin dynamics. an association between kaptin and dynamic f-actin was also indicated by the observed accumulations of flag-kaptin at the dynamic lamellipodia as opposed to the more static stress fibers in cos- cells. these observations are consistent with the suggestion of a lamellipodial localization of kaptin in chicken embryonic fibroblasts and with the original iso- lation of kaptin from blood cells with the use of f-actin columns. taken together, our studies indicate that both of the identified kptn mutations are likely to result in loss of function of kaptin, either by degradation of the mutant transcript via mrna-surveillance mechanisms (c. c>a) or by the production of mislocalized and/or nonfunc- tional protein products. these kptn mutations result in a distinctive clinical syndrome, and the presence of macrocephaly combined with global developmental delay should prompt the diagnostic analysis of kptn in affected individuals from anabaptist communities. the potential benefits of early diagnosis in this condition are indicated by the improvement in developmental markers in our study’s youngest two affected individuals, both of whom received early and intensive developmental interventions, although the lack of seizures in these individuals might also have been beneficial. finally, our identification of two kptn founder mutations within this anabaptist population parallels the situation seen for a number of other genes with multiple mutations that also commonly cause inherited diseases globally (e.g., gjb mutations in inherited hearing loss, and atm mutations in ataxia telangiectasia), indicating that kaptin developmental delay might be similarly widespread. supplemental data supplemental data include four figures and one table and can be found with this article online at http://www.cell.com/ajhg. acknowledgments first, we are very grateful to the amish families for partaking in this study and to the amish community for their continued support of the windows of hope project. we are grateful to olivia wenger for contributing clinical data. rabbit polyclonal anti- bassoon was a generous gift from e.d. gundelfinger (leibniz insti- tute for neurobiology, magdeburg). illumina cytosnp analysis and sanger sequencing were carried out at the medical biomics centre nd altered kaptin (cells were fixed and imaged at div ). wild-type rowth cones and f-actin-rich sites of the cell body (g; arrow heads). nd i; arrows). merged images show wild-type and altered kaptin in m. http://www.cell.com/ajhg (st. george’s university of london). the work was supported by the medical research council (g , g ), wellcome trust (wt ), newlife foundation, and research to prevent blindness. received: july , accepted: october , published: november , web resources the urls for data presented herein are as follows: genomes, http://browser. genomes.org/index.html ensembl genome browser, http://www.ensembl.org/index.html gatk, http://www.broadinstitute.org/gatk/about/citing-gatk ncbi, http://www.ncbi.nlm.nih.gov/ nhlbi exome sequencing project (esp) exome variant server, http://evs.gs.washington.edu/evs/ online mendelian inheritance in man (omim), http://www. omim.org polyphen- , http://genetics.bwh.harvard.edu/pph / provean, http://provean.jcvi.org/seq_submit.php pubmed, http://www.ncbi.nlm.nih.gov/pubmed/ samtools, http://samtools.sourceforge.net sift, http://sift.jcvi.org/ variant effect predictor (vep), http://useast.ensembl.org/info/ docs/tools/vep/index.html ucsc human genome browser, http://www.genome.ucsc.edu references . stevenson, r.e., schroer, r.j., skinner, c., fender, d., and simensen, r.j. ( ). autism and macrocephaly. lancet , – . . kanner, l. ( ). autistic disturbances of affective contact. acta paedopsychiatr. , – . . klein, s., sharifi-hannauer, p., and martinez-agosto, j.a. ( ). macrocephaly as a clinical indicator of genetic subtypes in autism. autism res. , – . . nevo, y., kramer, u., shinnar, s., leitner, y., fattal-valevski, a., villa, y., and harel, s. ( ). macrocephaly in children with developmental disabilities. pediatr. neurol. , – . . drévillon, l., megarbane, a., demeer, b., matar, c., benit, p., briand-suleau, a., bodereau, v., ghoumid, j., nasser, m., decrouy, x., et al. ( ). kbp-cytoskeleton interactions underlie developmental anomalies in goldberg-shprintzen syndrome. hum. mol. genet. , – . . ropers, f., derivery, e., hu, h., garshasbi, m., karbasiyan, m., herold, m., nürnberg, g., ullmann, r., gautreau, a., sperling, k., et al. ( ). identification of a novel candidate gene for non-syndromic autosomal recessive intellectual disability: the wash complex member swip. hum. mol. genet. , – . . rivière, j.-b., van bon, b.w.m., hoischen, a., kholmanskikh, s.s., o’roak, b.j., gilissen, c., gijsen, s., sullivan, c.t., christian, s.l., abdul-rahman, o.a., et al. ( ). de novo mutations in the actin genes actb and actg cause baraitser-winter syndrome. nat. genet. , – , s –s . . sobel, e., and lange, k. ( ). descent graphs in pedigree analysis: applications to haplotyping, location scores, and marker-sharing statistics. am. j. hum. genet. , – . the a . haag, n., schwintzer, l., ahuja, r., koch, n., grimm, j., heuer, h., qualmann, b., and kessels, m.m. ( ). the actin nucle- ator cobl is crucial for purkinje cell development and works in close conjunction with the f-actin binding protein abp . j. neurosci. , – . . pinyol, r., haeckel, a., ritter, a., qualmann, b., and kessels, m.m. ( ). regulation of n-wasp and the arp / complex by abp controls neuronal morphology. plos one , e . . ahuja, r., pinyol, r., reichenbach, n., custer, l., klingen- smith, j., kessels, m.m., and qualmann, b. ( ). cordon- bleu is an actin nucleation factor and controls neuronal morphology. cell , – . . qualmann, b., boeckers, t.m., jeromin, m., gundelfinger, e.d., and kessels, m.m. ( ). linkage of the actin cytoskeleton to the postsynaptic density via direct interactions of abp with the prosap/shank family. j. neurosci. , – . . hering, h., and sheng, m. ( ). dendritic spines: structure, dynamics and regulation. nat. rev. neurosci. , – . . bearer, e.l., and abraham, m.t. ( ). e (kaptin): a novel actin-associated protein from human blood platelets found in lamellipodia and the tips of the stereocilia of the inner ear. eur. j. cell biol. , – . . bearer, e.l., chen, a.f., chen, a.h., li, z., mark, h.f., smith, r.j., and jackson, c.l. ( ). e /kaptin (kptn)—a candi- date gene for the hearing loss locus, dfna . ann. hum. genet. , – . . dent, e.w., merriam, e.b., and hu, x. ( ). the dynamic cytoskeleton: backbone of dendritic spine plasticity. curr. opin. neurobiol. , – . . kessels, m.m., schwintzer, l., schlobinski, d., and qualmann, b. ( ). controlling actin cytoskeletal organization and dynamics during neuronal morphogenesis. eur. j. cell biol. , – . . svitkina, t., lin, w.h., webb, d.j., yasuda, r., wayman, g.a., van aelst, l., and soderling, s.h. ( ). regulation of the postsynaptic cytoskeleton: roles in development, plasticity, and disorders. j. neurosci. , – . . chen, t., han, y., yang, m., zhang, w., li, n., wan, t., guo, j., and cao, x. ( ). rab , a novel golgi-associated rab gtpase from human dendritic cells involved in cellular endo- cytosis. biochem. biophys. res. commun. , – . . giannandrea, m., bianchi, v., mignogna, m.l., sirri, a., carra- bino, s., d’elia, e., vecellio, m., russo, s., cogliati, f., larizza, l., et al. ( ). mutations in the small gtpase gene rab b are responsible for x-linked mental retardation associated with autism, epilepsy, and macrocephaly. am. j. hum. genet. , – . . tarpey, p.s., smith, r., pleasance, e., whibley, a., edkins, s., hardy, c., o’meara, s., latimer, c., dicks, e., menzies, a., et al. ( ). a systematic, large-scale resequencing screen of x-chromosome coding exons in mental retardation. nat. genet. , – . . nakayama, a.y., and luo, l. ( ). intracellular signaling pathways that regulate dendritic spine morphogenesis. hip- pocampus , – . . kasri, n.n., govek, e.e., and van aelst, l. ( ). character- ization of oligophrenin- , a rhogap lost in patients affected with mental retardation: lentiviral injection in organotypic brain slice cultures. methods enzymol. , – . . von bohlen und halbach, o. ( ). dendritic spine abnormalities in mental retardation. cell tissue res. , – . merican journal of human genetics , – , january , http://browser. genomes.org/index.html http://www.ensembl.org/index.html http://www.broadinstitute.org/gatk/about/citing-gatk http://www.ncbi.nlm.nih.gov/ http://evs.gs.washington.edu/evs/ http://www.omim.org http://www.omim.org http://genetics.bwh.harvard.edu/pph / http://provean.jcvi.org/seq_submit.php http://www.ncbi.nlm.nih.gov/pubmed/ http://samtools.sourceforge.net http://sift.jcvi.org/ http://useast.ensembl.org/info/docs/tools/vep/index.html http://useast.ensembl.org/info/docs/tools/vep/index.html http://www.genome.ucsc.edu . ba, w., van der raadt, j., and nadif kasri, n. ( ). rho gtpase signaling at the synapse: implications for intellectual disability. exp. cell res. , – . . takahashi, h., sekino, y., tanaka, s., mizui, t., kishi, s., and shirao, t. ( ). drebrin-dependent actin clustering in den- dritic filopodia governs synaptic targeting of postsynaptic density- and dendritic spine morphogenesis. j. neurosci. , – . . tada, t., and sheng, m. ( ). molecular mechanisms of den- driticspinemorphogenesis.curr. opin.neurobiol. , – . . haeckel, a., ahuja, r., gundelfinger, e.d., qualmann, b., and kessels, m.m. ( ). the actin-binding protein abp controls dendritic spine morphology and is important for spine head and synapse formation. j. neurosci. , – . . soderling, s.h., guire, e.s., kaech, s., white, j., zhang, f., schutz, k., langeberg, l.k., banker, g., raber, j., and scott, j.d. ( ). a wave- and wrp signaling complex regulates spine density, synaptic plasticity, and memory. j. neurosci. , – . . wegner, a.m., nebhan, c.a., hu, l., majumdar, d., meier, k.m., weaver, a.m., and webb, d.j. ( ). n-wasp and the arp / complex are critical regulators of actin in the develop- ment of dendritic spines and synapses. j. biol. chem. , – . . nakamura, y., wood, c.l., patton, a.p., jaafari, n., henley, j.m., mellor, j.r., and hanley, j.g. ( ). pick inhibition of the arp / complex controls dendritic spine size and syn- aptic plasticity. embo j. , – . the american journal of human genetics , – , january , . kim, i.h., racz, b., wang, h., burianek, l., weinberg, r., yasuda, r., wetsel, w.c., and soderling, s.h. ( ). disrup- tion of arp / results in asymmetric structural plasticity of dendritic spines and progressive synaptic and behavioral abnormalities. j. neurosci. , – . . weed, s.a., karginov, a.v., schafer, d.a., weaver, a.m., kinley, a.w., cooper, j.a., and parsons, j.t. ( ). cortactin localiza- tion to sites of actin assembly in lamellipodia requires interac- tions with f-actin and the arp / complex. j. cell biol. , – . . martinez-quiles, n., ho, h.y., kirschner, m.w., ramesh, n., and geha, r.s. ( ). erk/src phosphorylation of cortactin acts as a switch on-switch off mechanism that controls its abil- ity to activate n-wasp. mol. cell. biol. , – . . koch, n., dharmalingam, e., westermann, m., qualmann, b., thomas, u., and kessels, m.m. ( ). abp utilizes the arp / complex activator scar/wave in bristle development. j. cell sci. , – . . irie, f., and yamaguchi, y. ( ). ephb receptors regulate den- dritic spine development via intersectin, cdc and n-wasp. nat. neurosci. , – . . michaelsen, k., murk, k., zagrebelsky, m., dreznjak, a., jock- usch, b.m., rothkegel, m., and korte, m. ( ). fine-tuning of neuronal architecture requires two profilin isoforms. proc. natl. acad. sci. usa , – . . djagaeva, i., and doronkin, s. ( ). cop limits dendritic branching via cullin -dependent degradation of the actin- crosslinking btb-domain protein kelch. plos one , e . mutations in kptn cause macrocephaly, neurodevelopmental delay, and seizures supplemental data acknowledgments web resources references cells of origin in the embryonic nerve roots for nf -associated plexiform neurofibroma cancer cell article cells of origin in the embryonic nerve roots for nf -associated plexiform neurofibroma zhiguo chen, chiachi liu, amish j. patel, , chung-ping liao, yong wang, and lu q. le , , ,* department of dermatology cancer biology graduate program harold c. simmons cancer center utsw neurofibromatosis clinic university of texas southwestern medical center, dallas, tx - , usa *correspondence: lu.le@utsouthwestern.edu http://dx.doi.org/ . /j.ccell. . . summary neurofibromatosis type is a tumor-predisposing genetic disorder. plexiform neurofibromas are common nf tumors carrying a risk of malignant transformation, which is typically fatal. little is known about mech- anisms mediating initiation and identity of specific cell type that gives rise to neurofibromas. using cell-line- age tracing, we identify a population of gap + plp+ precursors in embryonic nerve roots as the cells of origin for these tumors and report a non-germline neurofibroma model for preclinical drug screening to iden- tify effective therapies. the identity of the tumor cell of origin and facility for isolation and expansion provides fertile ground for continued analysis to define factors critical for neurofibromagenesis. it also provides unique approaches to develop therapies to prevent neurofibroma formation in nf patients. introduction the tumor predisposition disorder neurofibromatosis type i (nf ) is among the most common human genetic diseases and is caused by mutation in the nf tumor suppressor gene, which encodes a gtpase activating protein (gap) that negatively regu- lates p -ras signaling (ballester et al., ; xu et al., ). nf patients have defects in neural crest-derived tissues, leading to a wide spectrum of clinical presentations, including develop- mental, pigment or neoplastic aberrations of the skin, nervous system, bones, endocrine organs, blood vessels, and the eyes (cichowski and jacks, ; ward and gutmann, ; zhu et al., ). while nf patients are predisposed to developing multiple tumor types (cichowski et al., ; jett and friedman, ; le and parada, ; shannon et al., ; vogel et al., ), the most common occurring are neurofibromas. neurofi- bromas are unique and complex tumors that contain proliferating schwann-like cells and other local supporting elements of the nerve fibers, including perineurial cells, fibroblasts, and blood significance in this study, we utilized a genetically engineered mouse mod broma. using cell-lineage tracing, we showed that the embryon nal nerve roots are the cells of origin for plexiform neurofibroma immediate progenitors in the initiation of tumors, consistent w primitive precursors and that most cells in an organ do not gene ular cancer (the cells of origin) will permit greater understandin for their treatment. can vessels, as well as infiltration of mast cells. neurofibromas are classified into different subtypes. however, for clinical and prog- nostic implications, many clinicians simply refer to these tumors as either dermal or plexiform. dermal neurofibromas are exclu- sively in the skin and occur in virtually all individuals with nf . they initially appear at puberty and increase in number with age. although similar to dermal neurofibromas at the cellular and ultrastructural levels, plexiform neurofibromas develop along a nerve plexus or involve multiple nerve bundles and are capable of forming large tumors. unlike their dermal counterpart, plexi- form neurofibromas are thought to be congenital and progres- sively enlarge throughout life. they carry a risk of malignant transformation that can metastasize widely and are often fatal. plexiform neurofibromas can occur anywhere along peripheral nerve plexus. in fact, deep-tissue neurofibromas occur in %– % of adult nf patients (tonsgard et al., ). the majority of internal plexiform neurofibromas manifest in the para-spinal re- gion associated with dorsal root ganglia (drg). their chance of malignant transformation is much higher compared with other el as a tool to identify the cell of origin for plexiform neurofi- ic gap + plp+ schwann cell precursors originate from spi- s. our studies point to the importance of stem cells and their ith the notion that these neoplasms originate in a subset of rate tumors. identifying which cell type gives rise to a partic- g of their pathogenesis and inform better design approaches cer cell , – , november , ª elsevier inc. mailto:lu.le@utsouthwestern.edu http://dx.doi.org/ . /j.ccell. . . http://crossmark.crossref.org/dialog/?doi= . /j.ccell. . . &domain=pdf cancer cell cells of origin for plexiform neurofibroma forms of plexiform neurofibromas and carries a poorer prognosis, in part because they are not evident clinically in the early stage. in addition, because of their location at the neural foramina of the vertebral column, they can impinge on the spinal cord and nerve roots, causing pain and neurological deficits. thus, these para- spinal neurofibromas represent a serious complication of nf . a large body of direct and indirect studies has provided evidence that nf gene deletion is the requisite initial step that precedes the cascade of interactions with other cell types in the microenvironment as well as additional cell autonomous modifications for neurofibromagenesis (joseph et al., ; le et al., ; wu et al., ; zheng et al., ; zhu et al., ). early speculation regarding the cells of origin for neurofi- bromas came from genetic studies examining the participation of different cell types including neural crest derivatives in the pathogenesis of many of the clinical presentations of nf , including neurofibroma. in human neurofibromas, schwann- like cells with biallelic nf mutations are the most consistently found cell type, leading to the argument that the tumors initiate in schwann cells or their earlier precursors. indeed, genetic mouse models have demonstrated that nf deletion in the schwann cell lineage is the genetic bottleneck for neurofibroma development (cichowski et al., ; joseph et al., ; vogel et al., ; wu et al., ; zheng et al., ; zhu et al., ). during the development of peripheral nerves, neural crest cells generate schwann cells in a process that parallels embryonic development. migrating neural crest stem cells emerge from the dorsal horns of the neural tube and move through immature connective tissue before the time of nerve formation and then differentiate into schwann cell precursors (scps). these scps then become immature schwann cells in the developing periph- eral nerves until early neonatal stages. the differentiation of immature schwann cells to form the non-myelinating and myeli- nating cells of mature nerves essentially occurs postnatally (jes- sen and mirsky, ; woodhoo and sommer, ). given that the majority of plexiform neurofibromas in human are congenital and generally detected at birth or in early infancy, they must arise from the early schwann cell lineage. indeed, genetic mouse models have demonstrated that nf deletion in the embryonic schwann cell lineage is the genetic bottleneck for neurofibroma development (cichowski et al., ; joseph et al., ; vogel et al., ; wu et al., ; zheng et al., ; zhu et al., ). however, the exact developmental stage and embryonic loca- tion of the schwann cell lineage that initiate neurofibroma forma- tion remain unknown. nf patients frequently have plexiform neurofibromas in the para-spinal region at the neural foramina associated with drg. in addition, existing mouse models of nf also develop neurofibromas at the drg regions. we wish to identify the cells of origin for these para-spinal plexiform neurofibromas. we reason that they reside in the vicinity of the embryonic drgs or at the nearby nerve roots. results loss of nf in embryonic drg/nerve root neurosphere cells gives rise to classic plexiform neurofibroma in vivo recent studies have established the value of in vitro sphere assay to identify cancer stem cells as well as neural stem/pro- cancer cell , – , november , ª elsevier inc genitor cells (le et al., ; williams et al., ). therefore, we examined whether nf -deficient embryonic drg/nerve root neurosphere cells (dnscs) could contain the elusive cells of origin of para-spinal neurofibromas. to obtain nf �/� dnscs, we dissected drgs/nerve roots from e . nf flox/flox; rosa (r r) mouse embryos (hall, ) and performed the neurosphere culture. these neurosphere cells have high self- renewal and proliferative potential (figures s a–s d available online). they were subsequently infected with adenovirus car- rying the cre recombinase (ad-cmv-cre) to ablate nf and generate nf �/�;lacz+ dnscs, which was verified by genomic analysis of nf (figure a). we next implanted nf �/�;lacz+ dnscs into the sciatic nerves where close proximity to the nerve environment could be achieved as previously established through an in vivo neuro- fibromagenesis assay (le et al., ). the transplanted nf �/�;lacz+ dnscs gave rise to plexiform neurofibroma within four months post implantation, whereas the transplanted nf flox/flox;r r controls showed no signs of tumor growth (figures ba– bd and table ). these tumors exhibited all histo- logical and immunohistochemical features of human plexiform neurofibromas, including disorganized spindle cells, abundant collagen matrix, heavy infiltration of mast cells and macro- phages, expression of the schwann cell marker s b, and gap (figure c; figure s e). to verify these tumors arise from transplanted drg/nerve root neurosphere cells rather than from the host cells, we took advantage of the fact that the transplant cells carried the lacz marker gene but the host did not. x-gal staining shown that these tumor cells were lacz+, which suggested that they arose from transplanted nf �/�;lacz+ dnscs. taken together, these data indicate that when placed in a favorable microenvironment (in proximity to a peripheral nerve), nf �/�;lacz+ dnscs can give rise to bona fide plexiform neurofibromas. as such, these results show that dnscs have the full potential to generate neurofibromas and indicate that the cells of origin for para-spinal neurofibromas may be in the embryonic drgs/nerve roots. cells of origin for para-spinal plexiform neurofibromas are inside the embryonic plp+ cells although we successfully induced neurofibroma formation by transplanting embryonic nf �/� dnscs to sciatic nerves, it is un- likely that all the embryonic dnscs could give rise to plexiform neurofibroma. in genetic mouse models, nf ablation in embry- onic schwann cell lineage (plp, krox , and dhh positive cells) was sufficient to induce para-spinal plexiform neurofibromas (le et al., ; wu et al., ; zhu et al., ), suggesting that all or at least part of the cells of origin might be inside these plp+, krox +, and dhh+ embryonic schwann cell lineage. therefore, we next sought to determine this subpopulation within the em- bryonic dnscs that could give rise to neurofibroma. to achieve this, we crossed plp promoter-driven, tamoxifen- inducible cre (plpcre-ert) (leone et al., ) transgenic mice into a nf flox/flox;r r-lacz (le et al., ) and flox-stop-flox r r-yfp (chen et al., ) background to generate plpcre-ert;nf flox/flox;r r-lacz-yfp mice. we selectively ablated the embryonic nf expression by administering mg tamoxifen orally at embryonic day . (e . ) to pregnant nf flox/flox;r r-lacz-yfp female mice that have been bred . figure . loss of nf in embryonic dnscs gives rise to classic plexiform neurofibroma in vivo (a) diagram of experimental design: isolation of drgs/nerve roots from e . nf flox/flox;r r-lacz embryos (a) and dnscs culture (b); dnscs were in- fected with ad-cre to ablate nf ; ad-gfp was used as a control (c); and nf �/�;lacz+ and nf flox/flox ;lacz� dnscs were implanted to right and left sciatic nerves of nude mice, respectively (d). (b) x-gal and h&e staining were performed on left (a and b) and right (c and d) sciatic nerve. (c) tumor on right sciatic nerve was stained with antibody against s b and gap . blue scale bars, mm. white and black scale bars, mm. see also figure s . table . the cells of origin for spinal plexiform neurofibroma are inside the embryonic plp+ dnscs genotype dnscs selected ablation of nf tumors/nude mice injected percentage p value nf f/f;lacz total ad-cre / . . total ad-gfp / plpcre-ert; nf f/f;lacz- yfp yfp+ / < . yfp� / plpcre-ert; nf f/f;lacz- yfp yfp+ ad-cre / . < . yfp� ad-cre / . krox -cre; nf f/f;lacz- yfp yfp+ / . < . yfp� / krox -cre; nf f/f;lacz- yfp yfp+ ad-cre / . . yfp� ad-cre / . dhh-cre; nf f/f;lacz- yfp total ad-cre / . yfp� ad-cre / cancer cell cells of origin for plexiform neurofibroma with plpcre-ert;nf flox/flox;r r-lacz-yfp male mice. we then dissected the drgs/nerve roots from embryos at e . and per- formed dnscs culture. in order to isolate the plp+ and plp� from these e . dnscs, we used fluorescence-activated cell sorting (facs) to obtain the yfp+ and yfp� dnscs which rep- resented plp+ and plp� dnscs, respectively. next, these plp+ and plp� dnscs were transplanted in proximity to the sciatic can nerve of nude mice. thirteen of ( %) mice transplanted with plp+ dnscs developed sciatic plexiform neurofibroma (table ). by contrast, plp� dnscs only led to neurofibroma in of ( %) mice (table ), which suggests that plp+ dnscs are more likely than plp� dnscs to contain the cells of origin and that neurofibroma development in the plp� dnscs im- planted mice is likely the result of contamination of plp+ dnscs during the sorting process as loss of nf is required for neurofi- broma development. therefore, given that the nf have been ab- lated in plp+ dnscs and not in plp� dnscs after the tamoxifen induction, we could not exclude the possibility that nf ablation in plp� dnscs would also give rise to neurofibroma. to address this issue, both plp+ and plp� dnscs were infected with ad- cmv-cre to generate the plp+;nf �/� and plp�;nf �/� dnscs. when transplanted to the sciatic nerve of nude mice, plp+; nf �/� dnscs maintained their higher capability to give rise to neurofibroma ( of , . %), whereas plp�;nf �/� dnscs could only give rise to plexiform neurofibroma in out of ( . %) mice (figure a and table ). strikingly, we also observed spontaneous transformation into malignant peripheral nerve sheath tumors (mpnst) arising from a fraction of these sciatic plexiform neurofibromas that originated from plp+; nf �/� dnscs (figures ai– al). this is consistent with human clinical observations that about % of plexiform neurofibromas undergo malignant transformation (evans et al., ). these data further indicate that the cells of origin might be within the embryonic plp+ dnscs population. however, since nf ablation in krox + and dhh+ embryonic schwann cell lineage could also give rise to para-spinal plexi- form neurofibromas, we next examined whether the cells of origin are also inside the embryonic krox + or dhh+ dnscs (wu et al., ; zhu et al., ). we utilized the same strategies as above using the krox -cre and dhh-cre transgenic mice. unexpectedly, we found that not only the krox +;nf �/� and total dnscs (contained dhh+;nf �/� dnscs) but also the cer cell , – , november , ª elsevier inc. figure . the cells of origin for para-spinal plexiform neurofibroma are inside the em- bryonic plp+ dnscs (a) facs was performed to obtain the yfp+ and yfp� dnscs from e . plpcre-ert;nf flox/flox; r r-lacz-yfp embryo, whose mother was administered with tamoxifen at e . (a and b). both yfp+ and yfp� dnscs were infected with ad-cre to ablate nf , then injected to right and left sciatic nerves of nude mice respectively (c). x-gal and h&e staining were performed on the left and right sciatic nerve (d–f). sections of right sciatic nerve were stained with antibody against s b (g) and gap (h). a fraction of these sciatic plexiform neurofibromas spontaneously trans- formed into mpnst, exhibiting both benign and malignant histologic characters (i–l). immunofluo- rescence staining of tumor on right sciatic nerve shows expression of yfp as well as gap and s b schwann cell markers (m–r). (b and c) a similar strategy to that in (a) was used for yfp+ and yfp� dnscs derived from e . embryos with genotype krox -cre;nf flox/flox; r r-lacz-yfp (b) and dhh-cre;nf flox/flox; r r-lacz-yfp (c). blue scale bars, mm. white and black scale bars, mm. cancer cell cells of origin for plexiform neurofibroma krox �;nf �/� and dhh�;nf �/� dnscs gave rise to neurofi- broma with high percentage (figures b and c and table ). these results demonstrate that plp+ dnscs encompass the cells of origin pool, whereas krox +;nf �/� and dhh+;nf �/� cancer cell , – , november , ª elsevier inc. dnscs might only account for partial population of the cells of origin. the plp+ cells of origin originate in the embryonic nerve roots to determine if the embryonic krox + and dhh+ cells are included within plp+ cell population, we administered tamox- ifen orally to mother mice at e . to activate plpcre-ert to induce the expression of yfp and genetically label the plp+ cells. we next performed immu- nofluorescence staining against krox and dhh and observed that the majority of the endogenous krox and dhh sig- nals colocalized with yfp (plp) in the nerve root, drg, and peripheral nerve (figure a), which indicated that most of the krox + and dhh+ cells were included in the plp+ cell population. we also found that plpcre+ (yfp+ cells) colo- calized with endogenous plp, suggest- ing that the plpcre+ population is inside the endogenous plp+ cell population (figure s a). we then took advantage of another marker, lacz, to compare the specific expression pattern of lacz among plp, krox , and dhh cre mice. specifically, for embryos with geno- type plpcre-ert;r r-lacz, we gave the mother mice a single dose of -hydroxytamoxifen, an active metabolic product of tamoxifen that can be cleared relatively quickly from serum figure . cells of origin for para-spinal plexiform neurofibromas are inside the em- bryonic plp+ nerve root cells (a) representative frozen sections from e . plpcre-ert;nf flox/flox;r r-lacz-yfp embryo, whose mother was administered with tamoxifen at e . , were stained for yfp, krox , dhh, and dapi. nr, nerve root; drg, dorsal root ganglia. (b–d) x-gal and h&e staining were performed on embryos with genotype plpcre-ert;r r-lacz (b, mother mouse was administered with -hy- droxytamoxifen at e . ), krox -cre;r r-lacz (c), and dhh-cre;r r-lacz (d) from e . to e . . arrow, area of enlarged view; arrow head, nerve roots; star mark, drg. (e) drg and dorsal nerve root were separated from e . embryos and cultured in neurosphere culture conditions. (f) nerve root derived neurospheres immuno- stained for nestin, gfap, s b, p , ki , and dapi. (g) immunostaining of nerve root derived neuro- sphere cells cultured in neurosphere medium (a, c, e, and g) or differentiation medium (b, d, f, and h) with antibodies against s b, gap , biii- tubulin, and olig . blue scale bars, mm. white and black scale bars, mm. see also figure s . cancer cell cells of origin for plexiform neurofibroma (robinson et al., ), to acutely induce the expression of lacz in plp+ cells at e . . on the other hand, krox -cre and dhh- cre are noninducible and, therefore, tamoxifen induction is not needed. we isolated the embryos at different time points and performed whole-mount x-gal staining. for the plpcre- ert;r r-lacz mice, the lacz (plp) positive staining began cancer cell , – , n to show up inside the nerve roots, drgs, and trigeminal ganglion (tg) at e . (figure b). histological analysis indicated that the lacz+ (plp+) cells were mainly inside the nerve roots and only few scattered lacz+ (plp+) cells could be seen in drg (figure b). from e . to e . , more lacz+ (plp+) cells appear in nerve roots, drgs, tgs, and eventually peripheral nerves (figure b). in contrast, in the krox -cre mice, the lacz+ (krox +) cells first appear in nerve roots at e . and stay in nerve roots until e . when some peripheral nerves started to express the lacz (krox ). however, there were very few lacz+ (krox +) cells inside the drg (figure c). similarly, in dhh-cre mice, we could only observe very few lacz+ (dhh+) cells in nerve roots after e . . from e . to e . , more lacz+ (dhh+) cells were detected only at nerve roots and some of the peripheral nerves (figure d), which were consistent with previous find- ings that dhh transcripts were expressed by scps both in the dorsal and ventral roots at e (parmantier et al., ). all of these data suggest that the plp+ cells first appear in embryonic nerve roots at least one day earlier and in a wider cell population than that of krox + and dhh+ cells and that plp+ dnscs represent a wider pool for the cells of origin. consistently, when we carefully separated out the e . ovember , ª elsevier inc. figure . phenotypic analysis identifies the plp+ cells of origin as embryonic schwann cell precursors (a) dnscs obtained from e . plpcre-ert; nf flox/flox;r r-yfp embryos, whose mother was administered with tamoxifen at e . , were stained for yfp, dapi, and lineage markers: nestin (a), p (b), blbp (c), gfap(d), s b (e), biii- tubulin (f), and gap (g–i). (b) formalin fixed paraffin embedded sections from e . plpcre-ert;nf flox/flox;r r-yfp em- bryos, whose mother was administered with tamoxifen at e . , were stained for yfp, dapi, and lineage markers: gap (a–c), nestin (d), p (e), blbp (f), biii-tubulin (g), gfap (h), and s b (i). drg, dorsal root ganglia; nr, nerve root; pn, peripheral nerve; sc, spinal cord. all scale bars, mm. see also figure s . cancer cell cells of origin for plexiform neurofibroma embryonic dorsal nerve roots from the drgs, we found that only the embryonic dorsal nerve roots could robustly give rise to neu- rospheres, but not the e . drgs (figure e). however, in adult mice, we found that the drgs can also give rise to neurospheres (figure s b). further immunofluorescence analyses demon- strate that these embryonic nerve roots generated neurosphere cells that express neural crest markers (nestin and p ), imma- ture schwann cell marker gfap, and proliferation marker ki- , but not the mature schwann cell marker s b (figure f). cancer cell , – , november , ª elsevier inc. under differentiation conditions, these neurosphere cells could differentiate into schwann cells and neurons, but not the oligodendrocytes (figure g). these data further narrow the candidate cells of origin to plp+ cells in the embryonic nerve roots. phenotypic analysis identifies the plp+ cells of origin as embryonic schwann cell precursors boundary cap (bc) cells are transient neural crest-derived population of stem cells located at the dorsal root entry zone and give rise to most schwann cells in the dorsal roots and drgs (coulpier et al., ; hjerling-leffler et al., ; topilko et al., ). therefore, bc cells might be the embryonic neurofibroma tu- mor cells of origin. however since krox is a marker of bc cells and both krox +; nf �/� and krox �;nf �/� dnscs could give rise to sciatic plexiform neurofi- broma, this indicates that bc cells are un- likely to be the cells of origin, but rather an even earlier cell that is plp+. to pheno- typically characterize these plp+ cells of origin, we gavaged mother mice with tamoxifen at e . , harvested drgs/ nerve roots from plpcre-ert;nf flox/flox; r r-yfp embryos at e . for neuro- sphere cell culture, and performed immunofluorescence ana- lyses. we found that the majority of neurosphere cells, either yfp+(plp+) or yfp�(plp�), expressed nestin and p , which confirms that they originate from the neural crest (figures aa and ab). we also observed the expression of embryonic schwann cell markers blbp and gfap in the minority of both yfp+(plp+) and yfp�(plp�) cells, but none expressed the immature and mature schwann cell marker s b (figures ac–a e). in addition, the majority of yfp+(plp+) cells did not figure . cell lineage tracing reveals plp+ precursors in the embryonic nerve roots as the cells of origin for plexiform neurofibromas (a) x-gal staining of whole spinal cord, drgs and partial peripheral nerves from plpcre-ert; nf flox/�;r r-lacz mouse, whose mother was administered with tamoxifen at e . . there is strong x-gal staining in the enlarged drgs (star mark), enlarged intercostal nerve (arrow head), and nerve root (arrow). (b) h&e and immunohistochemical staining for gap and s b in sections from these enlarged lacz+ drgs (star mark in a). (c) h&e staining of the drg and its associated enlarged intercostal nerve (ein) in (a) (arrow head). enlarged intercostal nerve was also stained for gap and s b. (d) representative h&e and immunohistochem- ical analyses of early neurofibroma in dorsal root and associated normal drg (arrow in a). drg, dorsal root ganglia; dr, dorsal root; sc, spinal cord; vr, ventral root. blue scale bars, mm. all other scale bars, mm. cancer cell cells of origin for plexiform neurofibroma express neuronal marker biii-tubulin (figure af). strikingly, every yfp+(plp+) cell also expressed gap , a schwann cell marker that is known to first appear at the precursor stage (fig- ures ag– ai), and sox , a marker for neural crest origin and future schwann cell lineage (figure s a) (kalcheim and rohrer, ). because these plp+gap + cells are also p positive but s b negative, they are at schwann cell precursor stage (jessen and mirsky, ). it is well known that cell culture in vitro may vary from that in vivo. therefore, we also character- ized these plp+ cells in e . plpcre-ert;nf flox/flox;r r-yfp embryos and observed that yfp+(plp+) cells were colocalized with gap mainly at nerve roots (figures ba– bc). similar to our in vitro data, they also expressed nestin, p , blbp, and sox (figures bd– bf; figure s b). they were also colocal- ized with biii-tubulin (figure bg). however, they did not express gfap and s b in vivo (figures bh and bi). these findings indicate that plp+gap + cells in the embryonic nerve roots are scps and that they may be the elusive cells of origin for para-spinal plexiform neurofibroma. cell lineage tracing confirms the plp+ precursors originate in the embryonic nerve roots as the cells of origin for plexiform neurofibromas tumor cells of origin are difficult to identify by characterizing cells within terminal stage tumors. a more definitive approach is to genetically label specific lineage early in development for cancer cell , – , n fate tracing prior to tumorigenesis. x-gal staining demonstrates that lacz+(plp+) cells are mainly located in nerve roots at e . when we gave -hydroxyta- moxifen to pregnant mother mice at e . (figure b). if these nf ablated lacz+(plp+) nerve root cells would give rise to neurofibroma, then neurofi- broma cells should carry the marker gene lacz. therefore, we crossed plpcre-ert;nf flox/flox;r r-lacz male mice with nf flox/�;r r-lacz female mice. we then administered -hydroxytamoxifen to pregnant mother mice for one dose at e . . at months of age, plpcre-ert;nf flox/�;r r-lacz progenies from these crosses began to show classic signs of illness: lethargy, weight loss, and paralyzed hind limbs. we observed the presence of plexiform neurofibromas with strong positive x-gal staining in close proximity to the cervical and thoracic drgs (figure a). because plpcre-ert mediates labeling solely at the time of tamoxifen administration at e . , x-gal positive staining of neurofibroma cells demonstrates unambiguously that the labeled neurofibromas were derived from e . plp+ precursors in the embryonic nerve roots. histopathological analysis of these tumors indicated that the tumors exhibited cardinal features of plexiform neurofi- bromas (figure b). strikingly, we also observed plexiform neurofibroma developed along the intercostal nerve whose associated drg appears histologically normal (figure c). in addition, we identified the earliest form of neurofibroma exhib- iting lacz positive staining: classic pathological characteristics of neurofibroma and expressing schwann cell marker s b and gap at the dorsal nerve roots near the drg (figure d). together, these findings point to the plp+;gap + scps in the embryonic nerve roots as the cells of origin for plexiform neurofibroma. ovember , ª elsevier inc. figure . therapeutic effect of mapk signaling inhibitor on dnsc-derived plexiform neurofibroma (a) diagram of experimental design for testing therapeutic effect of pd on plexiform neurofibroma. (b) immunostaining of erk / (total) and p-erk / (phosphorylated erk) in e . nf �/� dnscs derived sciatic plexiform neurofibroma (a). fold change of luminescence count measured during pd or vehicle treatment (b). after weeks of treatment, both pd and vehicle treatment group were divided into two subgroups: discontinued pd or continued pd and discontinued vehicle treatment or continued vehicle treatment subgroups for an additional weeks. tumors were then harvested for x-gal staining (c) and immunostaining for erk / and p-erk / (d). statistics were represented as the mean ± sem (*p < . ). blue scale bars, mm. all other scale bars, mm. see also figure s . cancer cell cells of origin for plexiform neurofibroma a robust plexiform neurofibroma model for preclinical drug screening the nf gene encodes for neurofibromin, a ras gtpase acti- vating protein (gap), and thus negatively regulates the ras signaling pathway (rubin and gutmann, ). this has promp- ted the use of specific map kinase pathway inhibitors to coun- teract nf loss-mediated tumor development (chang et al., ; jessen et al., ; staser et al., ) or to treat nf mutant animals in the effort to restore abnormal brain develop- ment and cognitive function (li et al., ; lush et al., ; wang et al., ). to determine if our non-germline plexiform neurofibroma model could be used as a rapid preclinical thera- peutic drug screening tool to identify effective therapies, we used a highly selective pharmacological inhibitor of mek, pd , which blocks activation and phosphorylation of erk / (chang et al., ), to test whether inhibition of the ras/raf/mek/erk signaling pathway can prevent neurofibroma progression in our plexiform neurofibroma model. in order to monitor the proliferation of tumor cells, we labeled these neurofibroma cells with luciferase by crossing the nf flox/flox;r r-lacz (le et al., ) mice with flox-stop-flox cancer cell , – , november , ª elsevier inc r r-luciferase mice to generate nf flox/flox;r r-lacz- luciferase mice. we then harvested e . dnscs and infected with ad-cmv-cre to generate nf �/�;r r-lacz-luciferase dnscs. we transplanted these nf �/�;r r-lacz-luciferase dnscs to sciatic nerves of nude mice to generate plexiform neu- rofibromas. mice were randomly assigned to pd treat- ment ( mg/kg/day, day/week) or vehicle as a control group (figure a). we also tested if the mapk pathway is activated in our neurofibromas and found that the erk pathway is highly acti- vated in the tumor tissues as shown by immunohistochemistry analysis (figure ba). we then started the treatment right after the transplantation. a striking reduction in luciferase signal was observed even after only one week of pd treatment (p < . ). continued treatment of pd further inhibited the proliferation of tumor cells. after weeks of pd treatment, tumor cell proliferation was almost completely blunt- ed as demonstrated by the diminishing luciferase signal. on the other hand, the luciferase signal in vehicle treatment group increased more than times after weeks of treatment (figure bb). these data suggested that the pd could effectively inhibit the proliferation of plexiform neurofibroma. . cancer cell cells of origin for plexiform neurofibroma however, it was not clear whether the inhibition effect of pd would be sustained after stopping the pd treatment. to answer this question, we divided the pd treatment group into two subgroups: discontinued pd treatment after weeks or continued pd treatment for an additional weeks in another group of mice. similar to this, we also divided the vehicle treatment group into two subgroups based on continuing or discontinuing vehicle treatment for another weeks. we again used the luciferase signal as a surrogate marker for tumor growth. we observed that continued treatment of pd further blunted the pro- liferation of neurofibroma; however, they regained the prolifera- tive capacity after pd withdrawal. eight weeks after transplantation of dnscs, we sacrificed all mice and performed x-gal staining of the sciatic nerves. vehicle treatment groups ( weeks or weeks) developed very large lacz+ neurofibromas, -week pd treatment dramatically reduced the growth of neurofibromas, while -week pd treatment almost completely prevented the proliferation of neurofibroma (fig- ure bc; figure s ). consistently, erk / phosphorylation was also reduced in both pd treatment groups compared with vehicle treatment groups (figure bd). all of these data showed the requirement of sustained ras/raf/mek/erk signaling for neurofibroma growth and that continuous pd treatment is effective in restraining this growth. thus, our non-germline plexiform neurofibroma model provides a powerful approach for preclinical therapeutic drug screening to identify effective therapies for human clinical trials to prevent neurofibroma formation in nf patients, where none exist today. discussion recent progress in cancer research points to the importance of stem cells and their immediate progenitors in the initiation and maintenance of many tumors, consistent with the notion that these neoplasms originate in a subset of primitive precursor cells and that most cells in an organ do not generate tumors (alcan- tara llaguno et al., ; barker et al., ; bonnet and dick, ; chen et al., a; goldstein et al., ; le et al., ; reya et al., ; tysnes, ). identifying which cell type gives rise to a particular cancer (the cells of origin) will permit greater understanding of their pathogenesis and inform better design approaches for their treating. in this study, we utilized a geneti- cally engineered mouse model as a tool to identify the cells of origin for plexiform neurofibroma. using cell lineage tracing, we demonstrated that the embryonic plp+;nf �/� scps, which originate from spinal nerve roots, give rise to plexiform neurofi- broma not only in para-spinal areas but also in distal peripheral nerve. we also report a non-germline model for plexiform neuro- fibroma that can be used broadly as preclinical models for ther- apeutic testing. a large body of direct and indirect studies has provided evi- dence that nf gene deletion is the requisite initial step that pre- cedes neurofibromagenesis (joseph et al., ; le et al., ; wu et al., ; zheng et al., ; zhu et al., ). cichowski et al. ( ) addressed this issue elegantly when they generated chimeric mice by injecting lacz+ nf �/� es cells into wild-type blastocysts. these mice developed microscopic neurofibromas derived from theinjected es cells,demonstratingthe requirement can of nf homozygosity for tumor formation (cichowski et al., ). however, the extent of chimerism in these mice occurs randomly and cannot be controlled genetically. as a result, it is difficult to establish the cells of origin for these tumors. conditional deletion of nf from embryonicneuralcreststemcells (ncscs) usingwnt- -cre transgenic mice leads to a transient increase in ncsc frequency and self-renewal, but the isolated ncscs fail to form tumors upon transplantation (joseph et al., ), suggesting that early ncsc derivatives may not contain potential cells of origin for plexiform neurofibroma. this observation indicates that later ncsc derivatives give rise to plexiform neurofibromas. consistently, ablation of nf in schwann cells using p a-cre; nf flox/� or dhh-cre;nf flox/flox mice, which deletes nf continu- ously from early scps through mature cells, efficiently induce neurofibromas development (wu et al., ; zheng et al., ). however, the cre recombinase transgenes used in these two studies compromise nf function at the early schwann cell stages of development (at e . ), and the cre recombinase activ- ity persists throughthe mature schwann cell stage. therefore, it is not possible to identify or exclude any particular schwann cell developmental stage as the critical one for nf loss-mediated tu- mor development. the interpretation of the data instead rests on correlations relating to detectable appearance of abnormal cells or structures. an alternative approach that can in theory provide a more precise evaluation of the evolution of nf -associated tumors is the application of inducible cre/loxp technology that al- lows temporal and spatial ablation of nf function in schwann cells.two differentstudies showthatacute lossof nf in bothem- bryo and adult can lead to plexiform neurofibroma formation (le et al., ; mayes et al., ). the fact that nf inactivation in adult mice also gives rise to neurofibroma, albeit at a much lower frequency (le et al., ), indicates that either ( ) mature schwann cells can, in rare cases, give rise to neurofibroma or ( ) that rare populations of progenitor cells persist within the adult peripheral nervous system. the notion that mature schwann cells have the capability to give rise to plexiform neurofibromas is less evident. nf patients rarely present with plexiform tumors for the first time as adults (ferner, ). as aforementioned, schwann cell development and terminal differentiation into myelinating cells mostly occurs postnatally. if mature schwann cells as a whole can give rise to neurofibromas when loss of heterozygosity (loh) occurs in adulthood, then it would be anticipated that plexiform tumors should develop widely in plpcre-ert mice induced postnatally since cre-mediated recombination remains efficient in mature schwann cells. it is not likely that the schwann cell lineage un- dergoes immature to mature transition en masse at tightly defined times from the ncsc stage, to the precursor stage, to the immature stage, and onward to more differentiated stages. instead, gradients of cells transition and migrate over extended periods with considerable overlap between the disappearance of one population and the emergence of another. therefore, re- maining compartments of precursor schwann cells may also persist into adulthood and retain the capacity to form plexiform neurofibromas within the peripheral nerves. indeed, given that embryonic nerve roots associate tightly with drgs and that the harvested drgs almost always contaminate with nerve roots, we carefully separated out the early embryonic dorsal nerve roots from the drgs for neurosphere culture. cer cell , – , november , ª elsevier inc. cancer cell cells of origin for plexiform neurofibroma unexpectedly, we found that only the embryonic dorsal nerve roots could robustly give rise to neurosphere but not the e . drgs. however, in adult mice, we found that the drgs can give rise to neurospheres and neurofibroma when nf was abla- ted and implanted into the sciatic nerves (data not shown). consistently, when we acutely labeled the plp+ precursor cells with lacz only in nerve roots at e . , we also observed plexi- form neurofibroma developed in the peripheral nerve distal to the drg. all of the data suggest that at least some of the cells of origin might migrate out along the nerve roots-drg-peripheral nerve and retain the capacity to form neurofibroma later in life. in the conditional knockout model using cre/loxp technology, the krox -cre;nf flox/flox mice (containing nf �/� schwann cells and nf +/+ microenvironment) do not develop neurofibromas. on the other hand, the krox -cre;nf flox/� mice (containing nf �/� schwann cells and nf +/� microenvironment) develop plexiform neurofibromas (zhu et al., ), demonstrating the essential role for the heterozygous environment in the development of neurofibroma. in another mouse model, a more robust dhh-cre driver causes plexiform neurofibroma formation in an nf -wild- type background (wu et al., ). in the current study, the plp+; nf �/� dnscs could also effectively give rise to plexiform neuro- fibromas when transplanted into the sciatic nerves of nude mice, which also have an nf -wild-type background. it is important to emphasize here that under these conditions, a large group of scps undergoes nf loh simultaneously and can therefore vie with the wild-type environment more efficiently than when only one or a very few isolated scps undergo loh. in nf patients that harbor germline heterozygous nf mutations, given the defined time of gestation and size of neural crest compartment, inactivation of the other normal nf in the schwann cell lineage must be rare and stochastic, such that single cells undergo completely inactivation of nf in a large pool of otherwise hetero- zygous nf mutant cells. in this setting, the increased secretion of scf or other factors from heterozygous cells, including mast cells, in the tumor microenvironment provides a permissive con- dition to foster tumor growth (yang et al., ). therefore, in the experimental setting, one possible advantage of having a large pool of precursors undergoing loh would be a rapid and dra- matic increase in cytokine and growth factor secretion that could be sufficient to elicit wild-type mast cells without the need for the hypersensitive heterozygous state of the latter. as such, in the physiologic scenario, one would envision a rare schwann cell undergoing loh that would normally disappear except for the response of the nf -heterozygous microenvironment that assists it to form a tumor. in another scenario, contribution of a multitude of cells that have undergone loh may override the otherwise requisite contributions from other factors, such as heterozygous mast cells or other cells in the microenvironment, to induce neurofibroma development. although the tumor microenvironment is critical for neurofi- broma formation (le et al., ; yang et al., ), intrinsic pro- liferative signals such as those in the mapk pathways are equally essential. therefore, both the tumor microenvironment and mapk pathways have been targeted in the preclinical setting to define clinically relevant pharmacodynamic variables and evaluating duration of drug effects on individual tumor (jessen et al., ; yang et al., ). the purpose of preclinical drug screening is to select the most effective and safe compound cancer cell , – , november , ª elsevier inc from a large library. our non-germline model for plexiform neuro- fibroma enables high efficiency of tumorigenesis and has a much shorter latency. therefore, it is a reliable and robust model for in vivo drug screening with a quantifiable and reproducible outcome measure (via bioluminescent scan) to select lead com- pounds for clinical assessment. in addition, the ability to isolate embryonic plp+ gap + cells for ex vivo expansion and nf ablation to generate classic sciatic plexiform neurofibromas al- lows flexible and speedy manipulation with multiple genetic tools to delineate additional pathways that are perturbed upon the loss of nf , which are essential for neurofibroma development. in conclusion, the identity of the tumor cells of origin and the facility for isolation and expansion for genetic alterations provide fertile ground for continued analysis to identify additional intrinsic and extrinsic factors within the tumor microenvironment that likely play essential roles in neurofibroma genesis. it is reason- able to speculate that lessons learned from investigating the mo- lecular interactions between the neurofibroma cells of origin and their microenvironment will provide us approaches to develop effective therapies to delay and possibly prevent neurofibroma formation in nf patients. experimental procedures mice animal care and use were approved by the institutional animal care and use committee at university of texas southwestern medical center. the nf flox/� and nf flox/flox mice have been described previously (zhu et al., ). for conditional ablation of nf , we used a tamoxifen-inducible cre line, the plpcre-ert transgenic mice (leone et al., ), and two non-induc- ible cre lines, krox -cre and dhh-cre (limpert et al., ; zhu et al., ). the rosa -yfp reporter mice were described previously (chen et al., ). the rosa -lacz and rosa -luciferase reporter mice were obtained from the jackson laboratories. tamoxifen and -hydroxytamoxifen induction tamoxifen (sigma-aldrich) and -hydroxytamoxifen was dissolved in a sunflower oil/ethanol mixture ( : ) at mg/ml and mg/ml, respectively. for embryonic induction, the pregnant mice were gavaged orally with mg of tamoxifen or . mg of -hydroxytamoxifen at e . or e . , respectively. cell culture and differentiation assays mouse embryos were removed from anesthetized . -day-old pregnant female mice. embryos were sacrificed. the spinal cord of each embryo was removed, and drgs/nerve roots were dissected from the vertebral column with the aid of stereomicroscope. fine scissors was used to cut and separate the nerve roots and drgs. drg and/or nerve root neurosphere culture was performed as previously described (le et al., ; patel et al., ; ratner et al., ). for cell proliferation assay, the single sphere cells were seeded to a -well plate coated with poly-d-lysine/laminin ( . cells per well) for monolayer culture. the cell numbers of wells were counted every hr for days. for differentiation assays, we seeded . cells per well of an -chamber slide coated with poly-d-lysine/laminin and cultured with fresh media containing b + % fetal bovine serum for – days. then we fixed the cells with % paraformaldehyde for min and performed immunostaining for lineage markers. fluorescence-activated cell sorting we harvested yfp+ and yfp� dnscs using facsaria instrument (bd biosci- ences) equipped with a nm solid-state laser. histology, immunostaining, and x-gal staining for hematoxylin and eosin (h&e) histology analysis, tissue specimens were harvested and fixed with % formalin in pbs for day and subsequently . cancer cell cells of origin for plexiform neurofibroma embedded in paraffin. sections ( mm thick) were stained with h&e per man- ufacturer’s protocol (statlab). the dilutions of primary antibodies used in immunohistochemistry and immunofluorescence studies were as follows: b iii-tubulin (rabbit, : , sigma-aldrich), blbp (rabbit, : , millipore), cd (rabbit, : , abcam), brdu (rat, : , abcam), cleaved caspase- (rabbit, : , cell signaling technology), dhh (rabbit, : , santa cruz biotechnology), total erk / (rabbit, : , cell signaling technology), phos- pho-erk / (rabbit, : , cell signaling technology), gap (rabbit, : , abcam), gfap (rabbit, : , dako), gfp (goat, : , rockland), krox (rabbit, : , covance research products), nestin (rabbit, : , abcam), p (rabbit, : , millipore), plp (rabbit, : , abcam), s b (rabbit, : , dako), sox (goat, : , santa cruz biotechnology), and vimentin (mouse, : , santa cruz biotechnology). for x-gal staining, after total body perfusion with % paraformaldehyde, tissues or embryos were harvested, equilibrated in % sucrose in pbs overnight at �c, and stained with x-gal at �c overnight. the tissues were then postfixed with % formalin, paraffin embedded, sectioned, and counter- stained with hematoxylin. transplantation experiments sciatic nerve implantation of dnscs was performed as previously reported (chen et al., b). briefly, mice were anesthetized by intraperitoneal injec- tion of ml of a mixture of ketamine ( mg/ml) and xylazine ( mg/ml) solu- tion. a skin incision was made above the femur. using iris scissors, a pocket was created within the quadriceps muscles to expose the sciatic nerve. the ml of l medium containing viable dnscs was then deposited into this pocket so that dnscs can be in contact with the sn. the quadriceps muscles were then closed with - vicryl suture, and the skin was closed with - prolene suture. mice were allowed to recover from anesthesia, then subject to mek inhibitor treatment and bioluminescent imaging. mek inhibitor treatment mek inhibitor pd were kindly provided by dr. kevin shannon. pd was dissolved in vehicle ( . % hydroxypropyl methylcellulose with . % tween ; sigma-aldrich) at a concentration of mg/ml. the solution was administered orally at the dosage of mg/kg (body weight) per mouse, once per day, for days/week. bioluminescent imaging bioluminescent imaging was performed as described previously (chau et al., ). briefly, mice were injected with ul mg/ml d-luciferin potassium salt (perkin elmer) in . % sterile nacl, and total flux was quantified using ivis lumina ii (caliper life sciences) weekly. statistics all data are displayed as the mean ± sem unless specified otherwise. a two-tailed t test and fisher exact test were applied as appropriate to evaluate statistical significance (p < . was deemed statistically significant). supplemental information supplemental information includes supplemental experimental procedures and four figures and can be found with this article online at http://dx.doi.org/ . /j.ccell. . . . author contributions l.q.l. contributed to conception and experimental designs, data collection and/or assembly, data analysis and interpretation, manuscript writing, and final approval of manuscript. z.c. contributed to experimental designs, data collection and/or assembly, data analysis and interpretation, and manuscript writing. c.l., a.j.p., c.-p.l., and y.w. contributed to data collection. acknowledgments we thank all members of the l.q.l. lab and dr. luis parada, dr. kristjan jessen, dr. rhona mirsky, and dr. wei mo for helpful suggestions and discus- sions. we also thank dr. ueli suter for the plpcre-ert mice. a.j.p. and c.-p.l. can are recipients of the young investigator awards from children’s tumor foun- dation. l.q.l. holds a career award for medical scientists from the burroughs wellcome fund. this work was supported by funding from the elisabeth reed wagner fund for research and clinical care in neurofibromatosis and cardio- thoracic surgery, the disease-oriented clinical scholar program, the national cancer institute of the nih grant number r ca , and u.s. department of defense grant number w xwh- - - to l.q.l. received: may , revised: july , accepted: september , published: october , references alcantara llaguno, s., chen, j., kwon, c.h., jackson, e.l., li, y., burns, d.k., alvarez-buylla, a., and parada, l.f. ( ). malignant astrocytomas originate from neural stem/progenitor cells in a somatic tumor suppressor mouse model. cancer cell , – . ballester, r., marchuk, d., boguski, m., saulino, a., letcher, r., wigler, m., and collins, f. ( ). the nf locus encodes a protein functionally related to mammalian gap and yeast ira proteins. cell , – . barker,n.,ridgway,r.a.,vanes,j.h.,vandewetering,m.,begthel,h.,vanden born, m., danenberg, e., clarke, a.r., sansom, o.j., and clevers, h. ( ). crypt stem cells as the cells-of-origin of intestinal cancer. nature , – . bonnet, d., and dick, j.e. ( ). human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. nat. med. , – . chang, t., krisman, k., theobald, e.h., xu, j., akutagawa, j., lauchle, j.o., kogan, s., braun, b.s., and shannon, k. ( ). sustained mek inhibition abrogates myeloproliferative disease in nf mutant mice. j. clin. invest. , – . chau, v., lim, s.k., mo, w., liu, c., patel, a.j., mckay, r.m., wei, s., posner, b.a., de brabander, j.k., williams, n.s., et al. ( ). preclinical therapeutic efficacy of a novel pharmacologic inducer of apoptosis in malignant peripheral nerve sheath tumors. cancer res. , – . chen, j., kwon, c.h., lin, l., li, y., and parada, l.f. ( ). inducible site- specific recombination in neural stem/progenitor cells. genesis , – . chen, j., li, y., yu, t.s., mckay, r.m., burns, d.k., kernie, s.g., and parada, l.f. ( a). a restricted cell population propagates glioblastoma growth after chemotherapy. nature , – . chen, z., pradhan, s., liu, c., and le, l.q. ( b). skin-derived precursors as a source of progenitors for cutaneous nerve regeneration. stem cells , – . cichowski, k., and jacks, t. ( ). nf tumor suppressor gene function: nar- rowing the gap. cell , – . cichowski, k., shih, t.s., schmitt, e., santiago, s., reilly, k., mclaughlin, m.e., bronson, r.t., and jacks, t. ( ). mouse models of tumor develop- ment in neurofibromatosis type . science , – . coulpier, f., le crom, s., maro, g.s., manent, j., giovannini, m., maciorowski, z., fischer, a., gessler, m., charnay, p., and topilko, p. ( ). novel features of boundary cap cells revealed by the analysis of newly identified molecular markers. glia , – . evans, d.g., baser, m.e., mcgaughran, j., sharif, s., howard, e., and moran, a. ( ). malignant peripheral nerve sheath tumours in neurofibromatosis . j. med. genet. , – . ferner, r.e. ( ). neurofibromatosis . eur. j. hum. genet. , – . goldstein, a.s., huang, j., guo, c., garraway, i.p., and witte, o.n. ( ). identification of a cell of origin for human prostate cancer. science , – . hall, a.k. ( ). rodent sensory neuron culture and analysis. curr. protoc. neurosci. chapter , unit . . hjerling-leffler, j., marmigère, f., heglind, m., cederberg, a., koltzenburg, m., enerbäck, s., and ernfors, p. ( ). the boundary cap: a source of neural cer cell , – , november , ª elsevier inc. http://dx.doi.org/ . /j.ccell. . . http://dx.doi.org/ . /j.ccell. . . cancer cell cells of origin for plexiform neurofibroma crest stem cells that generate multiple sensory neuron subtypes. development , – . jessen, k.r., and mirsky, r. ( ). the origin and development of glial cells in peripheral nerves. nat. rev. neurosci. , – . jessen, w.j., miller, s.j., jousma, e., wu, j., rizvi, t.a., brundage, m.e., eaves, d., widemann, b., kim, m.o., dombi, e., et al. ( ). mek inhibition exhibits efficacy in human and mouse neurofibromatosis tumors. j. clin. invest. , – . jett, k., and friedman, j.m. ( ). clinical and genetic aspects of neurofibro- matosis . genet. med. , – . joseph, n.m., mosher, j.t., buchstaller, j., snider, p., mckeever, p.e., lim, m., conway, s.j., parada, l.f., zhu, y., and morrison, s.j. ( ). the loss of nf transiently promotes self-renewal but not tumorigenesis by neural crest stem cells. cancer cell , – . kalcheim, c., and rohrer, h. ( ). neuroscience. following the same nerve track toward different cell fates. science , – . le, l.q., and parada, l.f. ( ). tumor microenvironment and neurofibroma- tosis type i: connecting the gaps. oncogene , – . le, l.q., shipman, t., burns, d.k., and parada, l.f. ( ). cell of origin and microenvironment contribution for nf -associated dermal neurofibromas. cell stem cell , – . le, l.q., liu, c., shipman, t., chen, z., suter, u., and parada, l.f. ( ). susceptible stages in schwann cells for nf -associated plexiform neurofi- broma development. cancer res. , – . leone, d.p., genoud, s., atanasoski, s., grausenburger, r., berger, p., metzger, d., macklin, w.b., chambon, p., and suter, u. ( ). tamoxifen- inducible glia-specific cre mice for somatic mutagenesis in oligodendrocytes and schwann cells. mol. cell. neurosci. , – . li, y., li, y., mckay, r.m., riethmacher, d., and parada, l.f. ( ). neurofibromin modulates adult hippocampal neurogenesis and behavioral effects of antidepressants. j. neurosci. , – . limpert, a.s., bai, s., narayan, m., wu, j., yoon, s.o., carter, b.d., and lu, q.r. ( ). nf-kappab forms a complex with the chromatin remodeler brg to regulate schwann cell differentiation. j. neurosci. , – . lush, m.e., li, y., kwon, c.h., chen, j., and parada, l.f. ( ). neurofibromin is required for barrel formation in the mouse somatosensory cortex. j. neurosci. , – . mayes, d.a., rizvi, t.a., cancelas, j.a., kolasinski, n.t., ciraolo, g.m., stemmer-rachamimov, a.o., and ratner, n. ( ). perinatal or adult nf inactivation using tamoxifen-inducible plpcre each cause neurofibroma formation. cancer res. , – . parmantier, e., lynn, b., lawson, d., turmaine, m., namini, s.s., chakrabarti, l., mcmahon, a.p., jessen, k.r., and mirsky, r. ( ). schwann cell-derived desert hedgehog controls the development of peripheral nerve sheaths. neuron , – . patel, a.j., liao, c.p., chen, z., liu, c., wang, y., and le, l.q. ( ). bet bromodomain inhibition triggers apoptosis of nf -associated malignant pe- ripheral nerve sheath tumors through bim induction. cell reports , – . ratner, n., williams, j.p., kordich, j.j., and kim, h.a. ( ). schwann cell preparation from single mouse embryos: analyses of neurofibromin function in schwann cells. methods enzymol. , – . reya, t., morrison, s.j., clarke, m.f., and weissman, i.l. ( ). stem cells, cancer, and cancer stem cells. nature , – . robinson, s.p., langan-fahey, s.m., johnson, d.a., and jordan, v.c. ( ). metabolites, pharmacodynamics, and pharmacokinetics of tamoxifen in rats cancer cell , – , november , ª elsevier inc and mice compared to the breast cancer patient. drug metab. dispos. , – . rubin, j.b., and gutmann, d.h. ( ). neurofibromatosis type —a model for nervous system tumour formation? nat. rev. cancer , – . shannon, k.m., o’connell, p., martin, g.a., paderanga, d., olson, k., dinndorf, p., and mccormick, f. ( ). loss of the normal nf allele from the bone marrow of children with type neurofibromatosis and malignant myeloid disorders. n. engl. j. med. , – . staser, k., park, s.j., rhodes, s.d., zeng, y., he, y.z., shew, m.a., gehlhausen, j.r., cerabona, d., menon, k., chen, s., et al. ( ). normal hematopoiesis and neurofibromin-deficient myeloproliferative disease require erk. j. clin. invest. , – . tonsgard, j.h., kwak, s.m., short, m.p., and dachman, a.h. ( ). ct imaging in adults with neurofibromatosis- : frequent asymptomatic plexiform lesions. neurology , – . topilko, p., schneider-maunoury, s., levi, g., baron-van evercooren, a., chennoufi, a.b., seitanidou, t., babinet, c., and charnay, p. ( ). krox- controls myelination in the peripheral nervous system. nature , – . tysnes, b.b. ( ). tumor-initiating and -propagating cells: cells that we would like to identify and control. neoplasia , – . vogel, k.s., klesse, l.j., velasco-miguel, s., meyers, k., rushing, e.j., and parada, l.f. ( ). mouse tumor model for neurofibromatosis type . science , – . wang, y., kim, e., wang, x., novitch, b.g., yoshikawa, k., chang, l.s., and zhu, y. ( ). erk inhibition rescues defects in fate specification of nf -defi- cient neural progenitors and brain abnormalities. cell , – . ward, b.a., and gutmann, d.h. ( ). neurofibromatosis : from lab bench to clinic. pediatr. neurol. , – . williams, j.p., wu, j., johansson, g., rizvi, t.a., miller, s.c., geiger, h., malik, p., li, w., mukouyama, y.s., cancelas, j.a., and ratner, n. ( ). nf muta- tion expands an egfr-dependent peripheral nerve progenitor that confers neurofibroma tumorigenic potential. cell stem cell , – . woodhoo, a., and sommer, l. ( ). development of the schwann cell line- age: from the neural crest to the myelinated nerve. glia , – . wu, j., williams, j.p., rizvi, t.a., kordich, j.j., witte, d., meijer, d., stemmer- rachamimov, a.o., cancelas, j.a., and ratner, n. ( ). plexiform and dermal neurofibromas and pigmentation are caused by nf loss in desert hedgehog-expressing cells. cancer cell , – . xu, g.f., o’connell, p., viskochil, d., cawthon, r., robertson, m., culver, m., dunn, d., stevens, j., gesteland, r., white, r., et al. ( ). the neurofibroma- tosis type gene encodes a protein related to gap. cell , – . yang, f.c., ingram, d.a., chen, s., zhu, y., yuan, j., li, x., yang, x., knowles, s., horn, w., li, y., et al. ( ). nf -dependent tumors require a microenviron- ment containing nf +/– and c-kit-dependent bone marrow. cell , – . zheng, h., chang, l., patel, n., yang, j., lowe, l., burns, d.k., and zhu, y. ( ). induction of abnormal proliferation by nonmyelinating schwann cells triggers neurofibroma formation. cancer cell , – . zhu, y., romero, m.i., ghosh, p., ye, z., charnay, p., rushing, e.j., marth, j.d., and parada, l.f. ( ). ablation of nf function in neurons induces abnormal development of cerebral cortex and reactive gliosis in the brain. genes dev. , – . zhu, y., ghosh, p., charnay, p., burns, d.k., and parada, l.f. ( ). neurofibromas in nf : schwann cell origin and role of tumor environment. science , – . . cells of origin in the embryonic nerve roots for nf -associated plexiform neurofibroma introduction results loss of nf in embryonic drg/nerve root neurosphere cells gives rise to classic plexiform neurofibroma in vivo cells of origin for para-spinal plexiform neurofibromas are inside the embryonic plp+ cells the plp+ cells of origin originate in the embryonic nerve roots phenotypic analysis identifies the plp+ cells of origin as embryonic schwann cell precursors cell lineage tracing confirms the plp+ precursors originate in the embryonic nerve roots as the cells of origin for plexifo ... a robust plexiform neurofibroma model for preclinical drug screening discussion experimental procedures mice tamoxifen and -hydroxytamoxifen induction cell culture and differentiation assays fluorescence-activated cell sorting histology, immunostaining, and x-gal staining transplantation experiments mek inhibitor treatment bioluminescent imaging statistics supplemental information acknowledgments references discovery of , rad-snps and development of a -snp array for monitoring river otters technical note discovery of , rad–snps and development of a -snp array for monitoring river otters jeffrey b. stetz • seth smith • michael a. sawaya • alan b. ramsey • stephen j. amish • michael k. schwartz • gordon luikart , received: july / accepted: june � springer science+business media dordrecht abstract many north american river otter (lontra canadensis) populations are threatened or recovering but are difficult to study because they occur at low densities, it is difficult to visually identify individuals, and they inhabit aquatic environments that accelerate degradation of bio- logical samples. single nucleotide polymorphisms (snps) can improve our ability to monitor demographic and genetic parameters of difficult to study species. we used restriction site associated dna (rad) sequencing to dis- cover , snps present in montana, usa, river otter populations, including , loci that were also variable in at least one other population range-wide. after applying careful filtering criteria meant to minimize ascertainment bias and identify high quality, highly heterozygous (ho = . – . ) snps, we developed and tested inde- pendent snp qpcr genotyping assays, including that performed well with diluted dna. the loci provided high power for population assignment tests with only misassignment ( . %) between closely neighboring pop- ulations. our snps showed high power to differentiate individuals and assign them to population of origin, as well as strong concordance of genotypes from high and diluted concentrations of dna, and between original rad and the snp qpcr array. keywords conservation genomics � rad � next generation sequencing � river otter � snp � population monitoring � noninvasive genetic tagging like other wide-ranging, elusive species, monitoring river otter populations remains a challenge for management agencies (melquist et al. ). individual otters are dif- ficult to distinguish visually and are known to travel con- siderable distances (melquist and hornocker ; newton ). radio-tagging studies, which require surgically implanting transmitters, are expensive and logistically difficult, and typically produce small samples sizes. for these and other reasons, studies aimed at estimating abundance, population growth rates, and connectivity have been difficult. interest in ensuring long-term population persistence in the face of harvest and habitat loss has led to the devel- opment of molecular tools, primarily microsatellite mark- ers, to monitor otter population dynamics (e.g., mowry et al. ). advancements in discovery and genotyping of single nucleotide polymorphisms (snps), with concurrent reduction in costs, present an opportunity to vastly improve our ability to monitor wildlife populations. relative to data available from the dryad digital repository: . /dryad. m r]. electronic supplementary material the online version of this article (doi: . /s - - - ) contains supplementary material, which is available to authorized users. & jeffrey b. stetz jeff.stetz@gmail.com sinopah wildlife research associates, n. higgins, suite , missoula, mt , usa fish and wildlife genomics group, division of biological sciences, university of montana, missoula, mt , usa mpg ranch, missoula, mt , usa national genomics center for wildlife and fish conservation, rocky mountain research station, united states forest service, missoula, mt , usa flathead lake biological station, university of montana, polson, mt , usa conservation genet resour doi . /s - - - http://orcid.org/ - - - http://dx.doi.org/ . /dryad. m r http://dx.doi.org/ . /dryad. m r http://dx.doi.org/ . /s - - - http://crossmark.crossref.org/dialog/?doi= . /s - - - &domain=pdf http://crossmark.crossref.org/dialog/?doi= . /s - - - &domain=pdf microsatellites, snps are less prone to genotyping errors, easier to transfer and analyze consistently among labora- tories, genotyping samples is faster and cheaper, and snps can include neutral markers or those linked to regions under selection (morin et al. ; allendorf et al. ; helyar et al. ; fabbri et al. ). one of the strengths of using genetic methods for monitoring river otter populations is the ease of collecting fecal samples from shared latrine sites along water bodies. latrines are easy to locate and provide an opportunity to collect fecal material from multiple individuals at one site. likely because of degradation of dna due to moisture and ultraviolet light (vynne et al. ; stetz et al. ), these efforts have been largely unsuccessful due to poor genotyping success rates. for example, a study in mon- tana was able to obtain complete multilocus genotypes for just % of otter scat samples using microsatellites (newton ). as snps are considerably shorter than microsatellites, higher genotyping success rates (i.e., lower rates of allelic drop out and false amplifications) are likely, even with poor quality samples such as scat (morin and mccarthy ; fabbri et al. ; fitak et al. ). we therefore set out to develop a snp array for river otters that would improve our ability to assess and monitor otter populations in montana and across the species’ range. although our emphasis was on otter populations in montana, we used muscle tissue samples from a large geographic area to minimize issues of ascertainment bias and to ensure usefulness range-wide (fig. ; allendorf et al. ). sampling two populations that are somewhat close geographically (i.e., nb and qe) strengthened our test of marker power to assign individuals to population of origin. dna was extracted from tissue samples using the qia- gen dneasy protocol then quantified using the quant-it tm picogreen � dsdna assay to ensure dna concentrations [ ng/ll, needed for producing restriction-site-associated (rad) sequencing libraries (etter et al. ). rad libraries were sequenced on the illumina hiseq platform using base pair paired-end reads. following amish et al. ( ), we selected for infor- mative loci while applying strict data quality and assay design filters. samples were excluded from downstream analysis if [ % of their genotyped loci had\ reads or [fivefold read count difference between alleles. to facil- itate snp pcr genotyping assay design snp loci had to be located between – nucleotides from the end, and we allowed only snp per rad locus to avoid rad loci assembled from paralogs and to avoid physically linked snps. we then excluded rad loci where c samples had \ reads or [fivefold read count difference between alleles. we also required that observed heterozygosity (both range-wide and within montana) be . – . , that c sample from outside montana was heterozygous at each rad locus, and that each locus was successfully geno- typed in [ % of montana samples. these criteria produced candidate snps, from which we selected the with the highest expected heterozygosity for kasp-by-design fluidigm assays (lgc genomics � ). we tested these assays on samples from across otter range on a fluidigm microfluidic snp-chip. after excluding loci due to high linkage dis- equilibrium (p \ . ), we identified loci in hardy– weinberg proportions, with expected and observed heterozygosity [ . for montana samples, and with b instance where the initial rad genotype did not match the snp-chip genotype (table s ). within snp-chip geno- types, each sample was run at least three times, and there could be b instance of replicate genotypes not matching. we next required that each of the three possible genotypes from each locus was observed at least once on each of snp-chips. we set a call rate threshold of % for each snp-chip (i.e., % of individuals and replicates yielded quality genotypes), and mean genotype confidence had to be [ % for both chips. we then identified a subset of loci for use with low quantity dna samples by testing loci on samples where we reduced the original dna concentration (c ng/ll) by half (table s ). we excluded loci where c instance of normal and low concentration genotypes did not match, and where b instance of low concentration duplicate genotypes did not match. we used probability of identity statistics and population assignment tests to examine the snp panel’s power to answer questions of sample identity or population of origin. we used genalex . (peakall and smouse ) to cal- culate probability of identity, and geneclass . (piry et al. ; rannala and mountain ) to test how well indi- vidual otters assigned to populations (paetkau et al. ) using our two classes of snps. both sets of loci showed acceptable power to differentiate even closely related individuals within and among populations (fig. ). using loci produced misassignments ( . %) compared to just observed in the reduced set of loci ( . %). all putatively misassigned samples, however, originated in the closest neighboring population. for example, the indi- viduals from new brunswick that assigned to quebec had – % assignment scores to their native region, sug- gesting that these may have been related to recent migra- tion events. the snps we report here represent a new tool for monitoring demographic and genetic status and changes in river otter populations across north america. snps may be particularly well suited to studying otter populations given the observed increase in genotyping success of fecal conservation genet resour samples relative to microsatellite markers in other species (e.g., campbell and narum ; fabbri et al. ; fitak et al. ). further, this snp array may be a powerful tool to explore genetic structure and evolutionary potential of otter populations while taking advantage of noninvasive sampling techniques. such information is particularly valuable for reintroduction efforts and general questions on river otter ecology. necessary next steps include optimiz- ing sampling and preservation methods to maximize snp performance in spraints, and to directly compare perfor- mance of snps to microsatellites. acknowledgments we are grateful to mpg ranch for generously funding this research and to the university of montana for in-kind support, including laboratory facilities, equipment, and protocols. we thank the following for providing river otter tissue samples or source dna: e. bunting (cornell university), c. brown (rhode island division of fish and wildlife), c. bernier (vermont fish & wildlife department), j. cormier and l. elson (new brunswick department of environment), p. canac-marquis (quebec ministry of energy and natural resources), j. gude and n. anderson (montana department of fish, wildlife, and park), c. nelson (british columbia forests, lands and natural resource operations), j. harms (environment yukon), s. talbot (u.s. geological survey), j. hayden and z. lockyer (idaho department of fish and game), and k. pilgrim (u.s. forest service rocky mountain research station). fig. locations of tissue samples collected from north american river otter for snp development; population- specific snp statistics are reported within the figure conservation genet resour references allendorf fw, hohenlohe p, luikart g ( ) genomics and the future of conservation, invited review. nat rev genet : – amish sj, hohenlohe pa, painter s, leary rf, muhlfeld c, allendorf fw, luikart g ( ) rad sequencing yields a high success rate for westslope cutthroat and rainbow trout species-diagnostic snp assays. mol ecol resour : – campbell nr, narum sr ( ) quantitative pcr assessment of microsatellite and snp genotyping with variable quality dna extracts. conserv genet. doi: . /s - - - etter pd, bassham s, hohenlohe pa, johnson ea, cresko wa ( ) snp discovery and genotyping for evolutionary genetics using rad sequencing. in: orgogozo v, rockman mv (eds) molecular methods for evolutionary genetics. humana press, new york, pp – fabbri e, caniglia r, mucci n, thomsen hp, krag k, pertoldi c, loeschcke v, randi e ( ) comparison of single nucleotide polymorphisms and microsatellites in non-invasive genetic monitoring of a wolf population. arch biol sci belgrade : – fitak rr, naidu a, thompson rw, culver m ( ) a new panel of snp markers for the individual identification of north american pumas. j fish wildl manag : – . doi: . / - jfwm- helyar sj, hemmer-hansen j, bekkevold d, taylor mi, ogden r, limborg mt, cariani a, maes ge, diopere e, carvalho gr, nielsen ee ( ) application of snps for population genetics of nonmodel organisms: new opportunities and challenges. mol ecol resour : – melquist w, hornocker m ( ) ecology of river otters in west central idaho. wildl monogr : – melquist we, polechla pj, toweill d ( ) river otter: lontra canadensis. in: feldhamer ga, thompson bc, chapman ja (eds) wild mammals of north america: biology, management, and conservation. johns hopkins university press, baltimore, pp – morin pa, mccarthy m ( ) highly accurate snp genotyping from historical and low-quality samples. mol ecol notes : – morin pa, luikart g, wayne rk ( ) snps in ecology, evolution and conservation. trends ecol evol : – mowry ra, gompper me, beringer j, eggert ls ( ) river otter population size estimation using noninvasive latrine surveys. j wildl manag : – newton de ( ) northern river otter population assessment and connectivity in western montana. thesis, university of montana, missoula, mt paetkau d, calvert w, stirling i, strobeck c ( ) microsatellite analysis of population structure in canadian polar bears. mol ecol : – peakall r, smouse pe ( ) genalex , genetic analysis in excel. population genetic software for teaching and research. mol ecol notes : – piry s, alapetite a, cornuet j-m, paetkau d, baudouin l, estoup a ( ) geneclass : a software for genetic assignment and first-generation migrant detection. j hered : – rannala b, mountain jl ( ) detecting immigration by using multilocus genotypes. proc natl acad sci : – stetz jb, seitz t, sawaya ma ( ) effects of exposure on genotyping success rates of hair samples from grizzly and american black bears. j fish wildl manag : – vynne c, baker mr, breuer zl, wasser sk ( ) factors influencing degradation of dna and hormones in maned wolf scat. anim conserv : conservation genet resour http://dx.doi.org/ . /s - - - http://dx.doi.org/ . / -jfwm- http://dx.doi.org/ . / -jfwm- discovery of , rad--snps and development of a -snp array for monitoring river otters abstract acknowledgments references [pdf] responsibilities of data monitoring committees | semantic scholar skip to search formskip to main content> semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. doi: . / corpus id: responsibilities of data monitoring committees @article{bierer responsibilitiesod, title={responsibilities of data monitoring committees}, author={b. bierer and r. li and j. seltzer and l. sleeper and elizabeth frank and c. knirsch and carmen e. aldinger and r. levine and joe m massaro and a. shah and m. barnes and s. snapinn and j. wittes}, journal={therapeutic innovation & regulatory science}, year={ }, volume={ }, pages={ - } } b. bierer, r. li, + authors j. wittes published medicine therapeutic innovation & regulatory science background: a data monitoring committee (dmc) has special responsibilities for protecting the safety of clinical trial participants. [...] key method all members of the group have formed, served on, advised, or worked with dmcs. results: the group outlined the objectives and mechanics of running a dmc, including operational and practical considerations, membership characteristics, roles, members’ liability, and indemnification. further, it delineated the roles and responsibilities of each dmc member…expand view on sage mrctcenter.org save to library create alert cite launch research feed share this paper citations view all tables and topics from this paper table table table table table table table view all figures & tables clinical trial independent data monitoring committee charter responsibility academia (organization) mechanics advocate (person) citations citation type citation type all types cites results cites methods cites background has pdf publication type author more filters more filters filters sort by relevance sort by most influenced papers sort by citation count sort by recency data monitoring committees: promoting best practices to address emerging challenges t. fleming, d. demets, + authors s. ellenberg business, medicine clinical trials pdf save alert research feed reports to independent data monitoring committees k. buhr, matthew t. downs, janelle rhorer, robin bechhofer, j. wittes computer science, medicine therapeutic innovation & regulatory science save alert research feed how to construct an optimal interim report: what the data monitoring committee does and doesn’t need to know j. neaton, b. grund, d. wentworth psychology, medicine clinical trials save alert research feed issues for masked data monitoring o. d. williams, k. epnere business save alert research feed references showing - of references liability issues for data monitoring committee members d. demets, t. fleming, + authors r. califf business, medicine clinical trials pdf view excerpts, references background and methods save alert research feed on independent data monitoring committees in oncology clinical trials. j. wittes, mark schactman medicine chinese clinical oncology view excerpts, references methods save alert research feed behind closed doors: the data monitoring board in randomized clinical trials. j. wittes medicine statistics in medicine view excerpts, references methods save alert research feed data monitoring in clinical trials d. demets, c. furberg, l. friedman medicine view excerpts, references methods and background save alert research feed data monitoring committees in clinical trials s. ellenberg, t. fleming, d. demets medicine save alert research feed ethical and scientific implications of the globalization of clinical research. charla a andrews medicine the new england journal of medicine save alert research feed and drug administration guidance for clinical trial sponsors: establishment and operation of clinical trial data monitoring committees. silver spring, md: us fda; data monitoring committees in clinical trials: a practical perspective. patricia m. grambsch medicine view excerpts, references methods and background save alert research feed related papers abstract tables and topics citations references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue simvastatin prevents and reverses chronic pulmonary hypertension in newborn rats via pleiotropic inhibition of rhoa signaling simvastatin prevents and reverses chronic pulmonary hypertension in newborn rats via pleiotropic inhibition of rhoa signaling mathew j. wong, , crystal kantores, julijana ivanovska, amish jain, , , and robert p. jankov , , , physiology & experimental medicine program, hospital for sick children research institute, toronto, ontario, canada; heart and stroke richard lewar centre of excellence in cardiovascular research, university of toronto, toronto, ontario, canada; department of paediatrics, faculty of medicine, university of toronto, toronto, ontario, canada; and department of physiology, faculty of medicine, university of toronto, toronto, ontario, canada submitted august ; accepted in final form september wong mj, kantores c, ivanovska j, jain a, jankov rp. simvastatin prevents and reverses chronic pulmonary hypertension in newborn rats via pleiotropic inhibition of rhoa signaling. am j physiol lung cell mol physiol : l –l , . first published september , ; doi: . /ajplung. . .— chronic neonatal pulmonary hypertension (pht) frequently results in early death. systemically administered rho-kinase (rock) inhibitors prevent and reverse chronic pht in neonatal rats, but at the cost of severe adverse effects, including systemic hypotension and growth restriction. simvastatin has pleiotropic inhibitory effects on iso- prenoid intermediates that may limit activity of rhoa, which signals upstream of rock. we therefore hypothesized that statin treatment would safely limit pulmonary vascular rhoa activity and prevent and reverse experimental chronic neonatal pht via downstream inhibitory effects on pathological rock activity. sprague-dawley rats in nor- moxia (room air) or moderate normobaric hypoxia ( % o ) received simvastatin ( mg·kg� ·day� ip) or vehicle from postnatal days – (prevention protocol) or from days – (rescue protocol). chronic hypoxia increased rhoa and rock activity in lung tissue. simva- statin reduced lung content of the isoprenoid intermediate farnesyl pyrophosphate and decreased rhoa/rock signaling in the hypoxia- exposed lung. preventive or rescue treatment of chronic hypoxia- exposed animals with simvastatin decreased pulmonary vascular re- sistance, right ventricular hypertrophy, and pulmonary arterial remod- eling. preventive simvastatin treatment improved weight gain, did not lower systemic blood pressure, and did not cause apparent toxic effects on skeletal muscle, liver or brain. rescue therapy with sim- vastatin improved exercise capacity. we conclude that simvastatin limits rhoa/rock activity in the chronic hypoxia-exposed lung, thus preventing or ameliorating hemodynamic and structural markers of chronic pht and improving long-term outcome, without causing adverse effects. chronic lung injury; rho-kinase; echocardiography; isoprenoid inter- mediates premature birth and associated chronic lung injury, known as bronchopulmonary dysplasia (bpd), is frequently associated with chronic pulmonary arterial hypertension (pht) ( ). chronic pht is characterized by pulmonary arterial remodel- ing, leading to increased pulmonary arterial pressure, increased pulmonary vascular resistance (pvr), and decreased arterial compliance ( , , ). the normal pulmonary circulation is a low-resistance, high-compliance system suited to accommo- date the entire cardiac output. increased thickening of pulmo- nary arteries from smooth muscle proliferation and extracellu- lar matrix deposition contributes to decreased pulmonary arte- rial compliance, increased resistance and increased right ventricle (rv) afterload ( ). the rv adapts by undergoing hypertrophy that may be followed by maladaptive chamber dilatation, which precedes rv failure and eventual death ( , ). newborns with chronic pht associated with severe bpd have a high mortality, with one study reporting a -year survival rate of % ( , ). moreover, survivors are at an increased risk for impaired neurological development ( ) and recurrence of pht later in life ( ). currently, there are no treatments of proven efficacy for chronic pht in neonates. previous work from our laboratory has implicated the ras- homolog gene family member a (rhoa)/rho-kinase (rock) signaling pathway in the pathogenesis of experimental chronic neonatal pht. rhoa/rock upregulation leads to increased pulmonary vascular tone and pulmonary arterial remodeling in chronic pht ( ). treatment with rock-specific inhibitors such as fasudil and y- has been shown to prevent or reverse chronic hypoxic- or bleomycin-induced pht in neo- natal rats ( , , , ). in pulmonary artery smooth muscle cells (smcs), vasoconstriction is regulated by phosphorylation of myosin light chain (mlc) through mlc kinase. dephos- phorylation by mlc phosphatase leads to vasorelaxation ( ). rock acts by phosphorylating the myosin phosphatase target subunit (mypt ), which inhibits mlc phosphatase activity, thus favoring a contractile state ( , ). rock mediates arterial remodeling via regulation of antiapoptotic and propro- liferative signaling in smcs and fibroblasts ( , , ). rhoa/rock signaling also negatively regulates endothelial nitric oxide synthase (enos) function ( , ). statins [ -hydroxy- -methylglutaryl (hmg)-coenzyme a (coa) reductase inhibitors] prevent conversion of hmg-coa to mevalonate, which is the rate-limiting step in cholesterol biosynthesis ( ). inhibition of mevalonate synthesis also de- creases the synthesis of isoprenoid intermediates (illustrated in fig. a): farnesyl-pyrophosphate (fpp) and geranylgeranyl- pyrophosphate (ggpp) ( ). the isoprenoids serve an essen- tial biological role through lipidation of proteins, a process also known as prenylation. of the isoprenoid intermediates, fpp interacts with the ras family of proteins while ggpp binds to the rho family ( ). an inactive reservoir of gdp-rhoa remains in the cytosol bound to rho-specific guanine nucleo- tide dissociation inhibitor (rhogdi) ( ). ggpp-mediated prenylation of rhoa is required for intracellular cytosolic trafficking and subsequent activation at the membrane ( , ). once localized to the membrane, rhoa is activated by guanine nucleotide exchange factors catalyzing the exchange of gdp for gtp. rhoa is inactivated by gtpase-activating proteins address for reprint requests and other correspondence: r. p. jankov, hospital for sick children, . peter gilgan centre for research and learning, bay st., toronto, on m g a , canada (e-mail: robert.jankov@sickkids.ca). am j physiol lung cell mol physiol : l –l , . first published september , ; doi: . /ajplung. . . - / copyright © the american physiological societyhttp://www.ajplung.org l downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . mailto:robert.jankov@sickkids.ca through hydrolysis of the phosphate bond ( ). ggpp- mediated prenylation of rhoa may also prevent membrane dissociation through the action of rhogdi, further enhanc- ing rhoa activation ( ). once active, rhoa binds to the rho-binding domain of rock, inducing an active confor- mational change ( ). previous work from our laboratory has confirmed the im- portance of upregulated rhoa activity and its downstream mediator rock in the pathogenesis of experimental chronic neonatal lung injury and chronic neonatal pht ( , ). work from other investigators has demonstrated pleiotropic inhibi- tion of rhoa activity by statins ( , , ). therefore, by limiting the synthesis of ggpp and prenylation of rhoa, statins may reduce pathological rhoa and rock activation ( ). the objective of this study was to examine the effects of simvastatin in the prevention or rescue of chronic hypoxic pht in neonatal rats. materials and methods materials. simvastatin was from cayman chemical (catalog no. , ann arbor, mi). oxygen-exposure chambers and auto- mated controllers, oxycycler model a xov, were from biospherix (parish, ny). tris-glycine precast gels (catalog no. xp box, well, – %) and pvdf membranes were from thermo scientific (rockford, il). phosphatase and protease inhibitors were from sigma life science (catalog no. p - ml, st. louis, mo) and calbio- chem (catalog no. - vl, san diego, ca), respectively. ac- ids, alcohols, organic solvents, paraformaldehyde, permount, and superfrost/plus microscope slides were from fisher scientific (whitby, ontario, canada). weigert’s resorcin-fuchsin stain was from rowley biochemical (catalog no. f- - , danvers, ma). luxol fast blue stain solutions were from electron microscopy sciences (catalog no. , hatfield, pa). elisa kits for alanine transaminase (alt; catalog no. ab ), creatine kinase (ck; catalog no. ab ), high-density lipoprotein (hdl), and low-density/very- low-density lipoprotein (ldl/vldl) cholesterol (catalog no. ab ) were purchased from abcam (toronto, ontario, canada). a free cholesterol assay kit (catalog no. ) was from cayman chemical. anti-rock i (catalog no. sc- ), anti-cleaved rock i (catalog no. sc- ), anti-glyceraldehyde- -phosphate dehydrogenase (gapdh; catalog no. sc- ) antibodies and protein a/g agarose beads (catalog no. sc- ) were from santa cruz biotechnology (santa cruz, ca). anti-rock ii (catalog no. ), anti-pan- mypt (catalog no. ), and anti-enos (catalog on. ) were from bd biosciences (san jose, ca). anti-phospho-threonine mypt (catalog no. - ) was from millipore (etobicoke, ontario, canada). anti-hif- � (catalog no. ) was from genetex (irvine, ca). anti-gtp-rhoa (catalog no. ) and anti-rhoa (catalog no. ) antibodies were from neweast bio- fig. . illustration of statin inhibition of cholesterol and iso- prenoid synthesis pathways. experimental design for preven- tion and rescue protocols. a: upstream inhibition of hmg-coa reductase enzyme limits bioavailability of diverging meval- onate products. reduction of the isoprenoid intermediate gera- nylgeranyl pyrophosphate (ggpp) limits membrane transloca- tion and activation of rhoa. b: overview of the time course and experimental design for prevention and rescue protocols. l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . sciences (king of prussia, pa). anti-�-smooth muscle actin antibody (catalog no. ma - ) was from thermo scientific. avidin-biotin- peroxidase complex immunohistochemistry kits, -diamino- - phenylindole aqueous mounting medium, and , -diaminobenzidine staining kits were from vector laboratories (burlingame, ca). goat anti-mouse immunoglobulin (igg)-peroxidase antibodies, and biotin- ylated goat anti-mouse igg (catalog no. ) and goat anti-rabbit igg (catalog no. ) were from cell signaling technologies (beverly, ma). in vivo experiments. all procedures involving animals were ap- proved by the animal care committee of the hospital for sick children research institute and conformed to the guidelines of the canadian council on animal care. timed-pregnant sprague-dawley rats were from taconic farms (germantown, ny). commencing on the day after birth [postnatal day (pnd) ], litters of sprague-dawley rat pups (equalized sex distribution) were chronically exposed to normobaric hypoxia ( % o ) or normoxia ( % o ) until pnd (prevention study) or until pnd (rescue study). concurrent with normoxia or hypoxia exposure, rat pups received daily intraperitoneal simvastatin ( mg/kg) or vehicle ( % dmso in pbs), from pnd to pnd (prevention study) or from pnd to pnd (rescue study). injury and treatment protocols are illustrated in fig. b. simvastatin was selected as it was the most frequently studied statin in the clinical and experimental pht literature during the conception of the study design, with a well-defined dose range in neonatal rats ( , , , , ). initial dose-response studies ( . , , , , and mg/kg) were conducted to determine the lowest effective dose in preventing pht, as guided by echocardiographic estimation of pvr. the highest dose ( mg/kg) adversely affected weight gain and the lowest dose ( . mg/kg) had a minimal effect on pvr (data not shown); therefore mg/kg was the dose chosen for all subsequent studies. each litter was maintained at n � pups, to control for nutritional effects. at the end of each - or -day exposure period, pups either were killed by pentobarbital overdose or were exsangui- nated after anesthesia. upon completion of the rescue protocol, a subgroup of animals was housed in room air until wk of age for exercise testing. simvastatin preparation and delivery. simvastatin was provided as a crystallized solid and stored in aliquots as a mg/ml solution in dmso stored at � °c. since simvastatin is not soluble in saline, a . mg/ml solution in % dmso in pbs was heated to °c in a temperature regulated shaker just prior to delivery to ensure solubility. injections were given intraperitoneally ( �l/g body wt) via a - gauge needle, once daily. vehicle controls received an equivalent volume of % dmso in pbs. two-dimensional echocardiography and pulse wave doppler ultrasound. two-dimensional echocardiography and pulsed wave doppler ultrasound was performed as a noninvasive method to assess pulmonary hemodynamics, using a vivid advantage (ge medical systems, milwaukee, wi) cardiovascular ultrasound machine with a small high frequency probe (i l), as previously described ( ). briefly, rat pups were anesthetized with % (vol/vol) isoflurane, and the animal was laid supine while spontaneously breathing – % (vol/vol) isoflurane through a modified face mask. a short axis view at the level of the aortic valve was obtained, and the pulmonary artery was identified using color flow doppler. the pulsed doppler gate was placed proximal to the pulmonary valve leaflets and aligned with an angle of insonation � °, maximizing laminar flow. the rv ejection time (rvet) and pulmonary arterial acceleration time (paat) were measured using the pulmonary doppler profile; rvet as the time from onset of systolic flow to completion of systolic flow, and paat from onset to peak pulmonary outflow velocity. a surrogate measure of pvr was calculated as a ratio of rvet to paat. to determine heart rate, measurements from three intersystolic intervals were av- eraged to account for beat-to-beat variability. analyses were under- taken in a blinded fashion using an offline analysis system (echopac, ge medical systems). right ventricular hypertrophy. measurement of rv hypertrophy using the fulton index (rv/lv�s) is a well-established marker of pht. the heart and lungs were separated, and the atria were removed inferior to the atrioventricular valves. the rv was separated from the left ventricle (lv) and septum. each component was freeze dried overnight and weighed separately, as previously described ( ). measurement of systemic blood pressure. systemic blood pressure was measured noninvasively using a tail cuff doppler device (le , harvard apparatus, holliston, ma), as previously de- scribed ( ). rats were anesthetized with % (vol/vol) isoflurane; the animal was laid supine while spontaneously breathing – % (vol/vol) isoflurane through a modified face mask. due to technical limitations of the device in smaller animals, measurements were carried out between pnd and pnd , as previously described ( ). exercise tolerance studies. adult rats ( wk of age) were trained daily on an exer- / animal treadmill (columbus instruments, co- lumbus, oh) over a -day period. the treadmill speed was initially set to m/min with a % uphill incline, and thereafter increased by increments of m/min every min up to a maximum speed of m/min. distance to fatigue was determined when the rat was unable to maintain pace with the treadmill belt for � s, despite encouragement to do so by tapping on the treadmill enclosure (electrical stimuli were not used). following the -day training period, the final testing regimen was as follows: speed of . m/min for min, followed by m/min for min, m/min for min, and m/min until fatigue. lowering of the hindquarters and a raised snout, resulting in an altered gait, generally precedes fatigue, which was confirmed by placing the animal on its back and observing a delayed (� s) righting reflex. in the case of a normal righting reflex, the test was repeated daily until fatigue was confirmed. distance covered until fatigue was recorded to the nearest tenth of a meter. tissue homogenate preparation. right lower lobes ( animals per group, equal sex distribution) were flash frozen, homogenized, and sonicated ( w for s) in ripa cell lysis buffer [ mm napo , . m nacl, . % (wt/vol) sodium dodecyl sulfate (sds), % (vol/vol) nonidet p- , % (vol/vol) sodium deoxycholate, mm edta, ph . ] containing protease (calbiochem) and phosphatase (sigma life science) inhibitors. left lung lobes ( animals per group, equal sex distribution) were flash frozen, homogenized in lysis buffer ( mm tris·hcl, ph , mm nacl, mm mgcl , mm edta, % triton x- ) containing protease and phosphatase inhib- itors for immunoprecipitation. the lung homogenates were left on ice for min before centrifugation ( , g for min). the supernatant was collected and protein concentration was measured by bradford assay. samples were stored at � °c until analysis. serum collection. following euthanasia of animals for tissue col- lection, the thoracic cavity was exposed and blood was drawn by direct lv cardiac puncture with a -gauge needle. blood was kept at room temperature for min to coagulate in microcentrifuge tubes. the tubes were spun down at , g for min. supernatant was collected by pasteur pipette and stored at � °c until assay. western blot analyses. lung homogenates from six animals per group (equal sex distribution) stored in ripa buffer containing protease and phosphatase inhibitors. tissue containing – �g of protein was boiled for min in sds sample buffer [ mm tris·hcl, % (wt/vol) sds, % (vol/vol) glycerol, mm -mercaptoethanol, ph . ] and separated under reducing conditions by sds polyacryl- amide gel electrophoresis for – h at – v depending on protein of interest. following electrophoresis, proteins were trans- ferred to pvdf membranes. all membranes were blocked with % bsa for h at room temperature, followed by incubation with primary antibody overnight at °c. blots were then washed with tris-buffered saline with tween and placed in secondary antibody for h at room temperature. following blotting, bands were imaged using an enhanced chemiluminescence kit (supersignal west dura chemiluminescent substrate, thermo scientific). dilutions of anti- bodies were as follows: : , for anti-rhoa ( kda), anti-cleaved l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . rock i ( kda), anti-p-thr mypt ( kda), anti-pan mypt ( kda), anti-hif- � ( kda), and anti-enos ( kda); : , for anti-rock i ( kda) and anti-rock ii ( kda); : , for anti-gapdh ( kda); : , for secondary antisera. blots were electronically captured using a microchemi chemilu- minescent camera (dnr bioimaging systems, jerusalem, israel) and quantified by digital densitometry of nonsaturated images with back- ground density removed using imagej software (national institutes of health, bethesda, md). quantitative analyses were conducted as follows: for each protein of interest, three gels were run comparing all samples from a group (normoxia vehicle, normoxia simvastatin, or hypoxia simvastatin) to all samples from the control group (hypoxia vehicle). membranes were stripped and then reblotted for the normal- izer protein (e.g., pan-mypt , rhoa, or gapdh) to account for differences in protein loading, and results expressed after normaliza- tion to the control band, as previously described ( ). representative images show contiguous lanes (the same lanes for the protein of interest and the normalizer) from each group that best represented the quantitative analysis. rhoa activity assay. the concentration of lung tissue homogenates were equalized to mg/ml in ml lysis buffer. anti-active rhoa monoclonal antibody ( �l) was added to the tube followed by �l of resuspended a/g agarose bead slurry. the tubes were incubated at °c for . h with gentle agitation following which beads were pelleted by centrifugation for min at , g at °c. the supernatant was removed and stored for measurement of non-gtp-bound rhoa. the beads were washed three times with . ml lysis buffer, centrifuging, aspirating, and discarding the supernatant each time. after the last wash, all supernatant was removed and discarded. the pellet was resuspended in �l reducing sds-page sample buffer. samples were boiled for min then centrifuged for s at , g. two western blots were run in parallel with samples from the pellet or the supernatant. the membranes were probed with anti-rhoa primary antibody. the proportion of active rhoa was determined by band densities of active rhoa normalized to total rhoa [gtp-rhoa/ (gtp-rhoa�non-gtp-rhoa)]. histological studies. two males and two females were randomly selected from each of the experimental groups and euthanized by pentobarbital sodium overdose. following the opening of the thoracic cavity and trachea cannulation, the pulmonary veins were divided. the pulmonary circulation was flushed with pbs and heparin, to clear the lungs of blood. the lungs were then perfusion fixed with parafor- maldehyde while air inflated at a constant pressure ( cmh o). following dehydration and clearance in xylene, tissues were embed- ded in paraffin, cut into -�m sections, mounted onto superfrost slides, allowed to air dry, and baked overnight at °c. for elastin staining, sections were dewaxed by immersion in xylene, rehydrated in ethanol, rinsed in several washes of distilled water, and then left overnight in weigert’s resorcin-fuchsin stain. for �-smooth muscle actin immunostaining, concentration of primary antibody for �-smooth muscle actin was : , and secondary goat anti-mouse antibody was : then counterstained with carazzi hematoxylin. slides were washed in tap water, dehydrated, and mounted with a coverslip using a % permount/ % xylene solution, as previously described ( , ). preparation of cardiac tissue. paraffin-embedded hearts, cut below the atrioventricular valves and oriented in the short axis, were cut into -�m sections and mounted onto superfrost slides, allowed to air dry, and baked overnight at °c. slides were dewaxed and rehydrated. sections were stained with hematoxylin, washed in distilled water, and partially dehydrated before counterstaining with eosin. slides were dehydrated and mounted with a coverslip using a % per- mount/ % xylene solution. whole sections were scanned by the imaging facility at the hospital for sick children research institute, using a dhistech pannoramic flash ii slide scanner and pannoramic viewer . . ( dhistech, budapest, hungary) soft- ware. preparation of brain tissue. paraffin-embedded left brain hemi- sphere oriented sagitally was cut into -�m sections just lateral to the ventricle and mounted onto superfrost slides, allowed to air dry, and baked overnight at °c. slides were dewaxed and rehydrated. sec- tions were stained with luxol fast blue solution (to identify myelin) overnight for h at °c, washed in distilled water, placed in lithium carbonate solution for s, and partially dehydrated before counter- staining with cresyl violet blue solution. slides were dehydrated and mounted with a coverslip using a % permount/ % xylene solution. whole sections were scanned as described above. measurement of percent medial wall area. percent medial wall area (% mwa) was used as a marker of pulmonary vascular remodeling. pulmonary arteries ( – �m external diameter) were identified on elastin-stained sections by the presence of an inner and outer elastic lamina and proximity to respiratory bronchioles. a minimum of arteries per animal from four unique sections were digitally captured (pixera penguin cl, san jose, ca) and analysis was performed in a blinded fashion. obliquely sectioned vessels where there was a greater than three times difference in perpendicular dimensions, were excluded. using the “quick selection” tool (adobe photo- shop cs , adobe systems, san jose, ca), the area of the inner lumen and the whole vessel were outlined and pixel count deter- mined. the following formula was used to determine the % mwa: [(whole vessel area � inner luminal area)/whole vessel area] , as previously described ( ). evaluation of arterial muscularization. degree of vessel muscular- ization was evaluated on sections stained for �-smooth muscle actin. pulmonary arteries ( – �m external diameter and proximity to respiratory bronchioles) were identified on �-smooth muscle actin- immunostained sections. a minimum of arteries per animal from four unique sections were digitally captured and evaluated in a blinded fashion. degree of muscularization was divided in to three categories: nonmuscular, partially muscular, or fully muscular based on the amount of brown stain surrounding each vessel (none, partially, or completely). category of muscularity was expressed as a fraction of the total number of vessels examined. lc-ms/ms. tissue samples weighing � mg were homogenized ( mg/ ml) in : -propanol- mm ammonium bicarbonate. the equivalent of mg ( �l of homogenate) was added to a . -ml plastic tube containing internal standards (sigma-aldrich, oakville, ontario, canada) and briefly vortexed. a standard curve was generated ( . – ng) for each analyte (mevalonic acid, fpp, and ggpp), treated in the same way as the tissue samples, but with �l of : -propanol- mm ammonium bicarbonate added instead of sample. each tube was processed as follows: �l of acetonitrile added, vortexed, chilled on ice, and then centrifuged for min at °c at , g. the supernatant was transferred to a clean tube and the pellet was reextracted with ml acetonitrile, vortexed, chilled on ice, and centrifuged for min at °c at , g. the supernatants were combined and taken to dryness under a gentle flow of nitrogen gas. the residues were reconstituted in �l of : methanol-ammonium hydroxide, transferred to . ml plastic tubes, and centrifuged for min at °c at , g. the supernatant was transferred to a -�l insert in a -ml autosampler vial and injected for lc-ms/ms analysis. samples were analyzed by lc-ms/ms using an agilent hplc with qtrap mass spectrometer (ab sciex, concord, ontario, canada) in negative ion mode. one microliter of sample extract was injected into a kinetex xb-c column ( . mm, . �m, phenomenex) at a flow rate of �l/min. mevalonic acid, farnesyl pyrophosphate, and geranylgeranyl pyrophosphate were separated using a gradient of mm ammonium bicarbonate and . % triethylamine in water (mpa) and mm ammonium bicarbonate and . % triethyl- amine in % acetonitrile as follows: starting with % mpa, moving to % mpa from . to . min, then to % mpa from . to . min, % mpa was held from . to . min, after . min the system was returned to % mpa and allowed to equilibrate resulting in a total run time of min. the following mass transitions (precursor ion l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . to the product ion) were monitored for quantification in multiple reaction monitoring mode: mevalonic acid to , farnesyl pyro- phosphate to , and geranylgeranyl pyrophosphate to . data were analyzed and quantified using analyst software (ab sciex). elisa. serum alt, ck, ldl/vldl cholesterol and total free cholesterol were measured according to the manufacturer’s protocols. data presentation and statistical analysis. values are expressed as means � se. table values are expressed as means � sd. analyses were performed using sigma plot . (systat software, san jose, ca). statistical significance was determined by one-way anova or kruskal-wallis anova on ranks for data sets failing a normality test, followed by student-newman-keuls post hoc test where significant (p � . ) intergroup differences were found. fig. . simvastatin decreased farnesyl pyro- phosphate and rhoa/rock activity in the hypoxia-exposed lung. pups were exposed to chronic hypoxia ( % o ) or to normoxia ( % o ) from postnatal day until day (prevention) or day (rescue). pups were treated by daily intraperitoneal injections of simvastatin ( mg/kg) or % dmso in pbs (vehicle control) from birth to day (a, b, and d), or from postnatal days – (c and e). a: fpp lung isoprenoid interme- diates analyzed by lc-ms/ms. western blot analyses of gtp-rhoa normalized to total rhoa (b and c) and pthr -mypt nor- malized to pan-mypt (d and e). repre- sentative immunoblots are shown below each graph with noncontiguous gel lanes demarcated by black lines. values repre- sent means � se for n � – samples per group. *p � . , by -way anova on ranks (a) or -way anova (b–d), com- pared with all other groups. #p � . , by -way anova, compared with all other groups. l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . results lung fpp content and rhoa/rock activity were attenuated by simvastatin. statins inhibit mevalonate synthesis, which reduces isoprenoid intermediate content ( , ). as shown in fig. a, chronic exposure to hypoxia had no effect on lung fpp content, compared with normoxia-exposed controls. preven- tive treatment with simvastatin significantly reduced lung fpp content compared with hypoxia-exposed vehicle-treated pups (fig. a). rhoa activity was measured by lung gtp-rhoa content, as a ratio of total (gtp�non-gtp bound) rhoa. hypoxia-exposed, vehicle-treated pups had significantly ele- vated rhoa activity in the lung relative to normoxia controls at both pnds and (fig. , b and c). lungs of chronic hypoxia-exposed pups treated with simvastatin had signifi- cantly reduced gtp-rhoa content when given as either pre- ventive or as rescue therapy (figs. , b and c). lung rock activity was determined by pthr -mypt content, as a ratio of the pan-mypt protein. lungs of hypoxia-exposed, vehi- cle-treated pups had significantly increased rock activity compared with normoxia controls at both pnds and fig. . simvastatin prevented chronic hypoxia-induced pulmonary hypertension. pups were exposed to chronic hypoxia ( % o ) to normoxia ( % o ) from postnatal day until day . pups were treated by daily intraperitoneal injections of simvastatin ( mg/kg) or % dmso in pbs (vehicle control). a: pulmonary vascular resistance (pvr) index, as measured by the right ventricular ejection time (rvet)-to-pulmonary arterial acceleration time (paat) ratio (values represent means � se for n � – animals/group). b: right ventricle (rv)-to-left ventricle � septum (lv�s) dry weight ratios (fulton index) as a marker of right ventricular hypertrophy (values represent means � se; n � – animals/group). c: tiled low-power photomicrographs of hematoxylin and eosin-stained cardiac sections, oriented in the short axis below the atrioventricular valves (rv, right ventricular cavity; scale bar � , �m), are shown to demonstrate differences in rv free wall thickness between groups. *p � . , by -way anova on ranks, compared with all other groups. l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . (fig. , d and e). simvastatin significantly attenuated in- creased lung rock activity secondary to hypoxia, relative to the vehicle-treated animals, when given as either preventive or rescue therapy (fig. , d and e). simvastatin prevented chronic pht. similar to previous findings ( , ), exposure to hypoxia significantly increased pvr index (fig. a) and fulton index (fig. b) in vehicle- treated animals, compared with normoxia controls. animals exposed to hypoxia and treated with simvastatin had signifi- cantly reduced pvr index (fig. a) and fulton index (fig. b) compared with hypoxia-exposed vehicle-treated animals and had values comparable to normoxia controls. % mwa and degree of muscularization were used as measures of pulmonary arterial remodeling. as shown previously ( , , ), and in fig. a, pulmonary arteries of animals chronically exposed to hypoxia had greatly increased % mwa, which was accompa- nied by an increased proportion of fully muscularized arteries (fig. c). treatment with simvastatin reduced both % mwa (fig. a) and proportion of fully muscularized arteries (fig. c) relative to vehicle-treated controls. chronic hypoxia-induced pht was reversed and exercise capacity increased by rescue treatment with simvastatin. pre- vious studies have demonstrated that systemic or inhaled treat- ment with a rock inhibitor reversed pht induced by chronic fig. . simvastatin prevented chronic hypoxia-induced pulmonary arterial remodeling. pups were exposed to chronic hypoxia ( % o ) or to normoxia ( % o ) from postnatal day until day . pups were treated by daily intraperitoneal injections of simvastatin ( mg/kg) or % dmso in pbs (vehicle control). a: percentage arterial medial wall area (values represent means � se for n � animals/group) as a marker of pulmonary arterial remodeling. b: representative photomicrographs of elastin staining (dark brown inner and outer elastic laminae delineating the medial vascular wall; scale bar � �m) demonstrate differences between groups in medial wall thickening. c: degree of muscularization (values represent means � se for n � animals/group) as a marker of pulmonary arterial smooth muscle content. d: representative photomicrographs of �-smooth muscle actin staining (dark brown staining surrounding artery; scale bar � �m) demonstrate proliferation of pulmonary arterial smooth muscle. *p � . , by -way anova on ranks compared with all other groups. #p � . , by -way anova compared with normoxia vehicle group for proportion of partially muscularized arteries. †p � . , by -way anova, compared with all other groups for proportions of nonmuscularized and ‡p � . for fully muscularized arteries. l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . hypoxia in newborn rats ( , ). similarly, relative to vehicle- treated animals, sustained rescue treatment with simvastatin significantly decreased pvr (fig. a), rv hypertrophy (fig. b), % mwa (fig. c), and proportion of fully muscularized arteries (fig. d) compared with chronic hypoxia-exposed vehicle-treated animals. exercise capacity in chronic hypoxia, vehicle-treated rats was significantly reduced compared with air-exposed vehicle- or simvastatin-treated controls. female rats ran a significantly greater distance compared with male rats across all groups and therefore data were stratified by sex. l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . rescue treatment with simvastatin significantly increased dis- tance run in females and males compared with hypoxia-ex- posed, vehicle-treated controls (fig. e). preventive treatment with simvastatin improved hypoxia- induced growth restriction and acute treatment with simvasta- tin did not affect systemic blood pressure. we have previously reported significant adverse effects of systemic rock inhibi- tion, including worsened hypoxia-induced growth restriction and greatly decreased systemic blood pressure ( , ). as previously documented ( ), chronic exposure to hypoxia from birth lead to a significant growth restriction (fig. a). preventive (fig. a) treatment with simvastatin increased body weight at pnd compared with the hypoxia-ex- posed, vehicle-treated animals (fig. a). relative to nor- moxia-exposed controls, chronic hypoxia-exposed animals had significantly increased systolic blood pressure (fig. b). acute treatment with simvastatin had no effect on systolic blood pressure (fig. b). effects of hypoxia and preventive treatment with simvastatin on brain weight and periventricular myelin content. relative to normoxia-exposed vehicle-treated animals, chronic exposure to hypoxia significantly decreased brain weight (fig. c) and decreased periventricular myelin density (fig. d). treatment with simvastatin had no effects on brain weight in either normoxia- or hypoxia-exposed animals (fig. c). preventive treatment with simvastatin had no effect on periventricular myelin density in normoxia-exposed animals, while causing a significant increase in hypoxia-exposed animals (fig. d). preventive treatment with simvastatin did not increase se- rum markers of muscle or liver toxicity. statin therapy has been reported in adult humans to cause myopathy (increased ck) and liver injury (increased alt) ( ). as shown in table , neither chronic exposure to hypoxia nor treatment with simva- statin altered serum alt or ck. in addition, no changes in these parameters were observed at mg·kg� ·day� , the highest dose employed in preliminary studies (data not shown). preventive treatment with simvastatin had no effect on serum cholesterol. as shown in table , neither chronic exposure to hypoxia nor treatment with simvastatin had any effect on total serum cholesterol. to control for the possible effects of dmso vehicle on cholesterol levels ( ), serum cholesterol was also measured in normoxia- and hypoxia- exposed animals not injected with vehicle. there was no difference in serum cholesterol between noninjected and vehicle-treated groups (data not shown). as shown in table , chronic hypoxia significantly increased serum ldl cho- lesterol, which was unaffected by treatment with simvasta- tin. effects of hypoxia and preventive treatment with simvastatin on lung cleaved rock i, rock i, rock ii, hif- �, and enos contents. chronic exposure to hypoxia greatly decreased cleaved rock i (constitutively active form of rock) content in the lung compared with normoxia-exposed controls (fig. a). normoxia-exposed animals treated with simvastatin had decreased cleaved rock i content compared with vehicle- treated animals (fig. a). rock i content was significantly decreased by exposure to hypoxia, which was unaffected by treatment with simvastatin (fig. a). there were no differences in rock ii content between groups (fig. c). hif- � is known to be upregulated by hypoxia. accordingly, neonatal rat pups chronically exposed to hypoxia had significantly in- creased hif- � protein content in the lung compared with normoxia controls (fig. d). treatment with simvastatin had significantly reduced hif- � content in lungs exposed to chronic hypoxia (fig. d). enos expression has been de- scribed to be attenuated by increased rock activity ( ). as shown in fig. e, preventive treatment with simvastatin in- creased enos content in both normoxia- and hypoxia-exposed animals. discussion we have previously established a critical role for the rock signaling in the pathogenesis of chronic hypoxic pht in neonatal rats ( , , ). in the present study, we observed that simvastatin both prevented and reversed chronic pht, at least in part via modulation of rhoa and downstream rock activity. the novel aspect of this study was the examination of effects of simvastatin on chronic neonatal pht. despite favor- able results in adult experimental chronic pht ( , , , ), trials employing statins in human adults with chronic pht have thus far shown an apparent lack of efficacy ( ). the implications of these findings for translation of statins to the neonate remain open, given the potential for maturational differences in response to pharmacological agents that may affect the pulmonary vasculature. for example, selective sero- tonin reuptake inhibitors (ssris) impose a higher risk of pht in newborns when given to mothers in late pregnancy ( ), whereas studies in adults with chronic pht suggest that ssris may improve outcome ( ). a small observational study in children with chronic pht showed improvement in hemody- namic parameters with simvastatin therapy ( ). importantly, the potential utility of statins as a means of targeting rhoa/ rock activity in the newborn likely extends beyond pht. we have recently reported a contributory role for upregulated pulmonary rock signaling in experimental bpd-like lung fig. . simvastatin reversed chronic pht in juveniles and improved exercise tolerance in young adults. pups were exposed to chronic hypoxia ( % o ) or to normoxia ( % o ) from postnatal day until day . pups were treated by daily intraperitoneal injections of simvastatin ( mg/kg) or % dmso in pbs (vehicle control) from postnatal days to . a: pulmonary vascular resistance index (pvri), as measured by the right ventricular ejection time (rvet)-to-pulmonary arterial acceleration time (paat) ratio (values represent means � se for n � animals/group). b: right ventricle (rv)-to-left ventricle � septum (lv�s) dry weight ratios (fulton index) as a marker of right ventricular hypertrophy (values represent means � se n � – animals/group). c: percentage arterial medial wall area (values represent means � se for n � animals/group) as a marker of pulmonary arterial remodeling. d: degree of muscularization (values represent means � se for n � animals/group) as a marker of pulmonary arterial smooth muscle content. e: maximum exercise capacity measured in meters run (values represent means � se for n � – animals/group). *p � . , by -way anova on ranks, compared with all other groups. #p � . , by -way anova on ranks, compared with normoxia-exposed groups. †p � . , by -way anova, compared with all other groups, ‡p � . , by -way anova, compared with normoxia-exposed groups. §p � . (nonmuscularized arteries), �p � . (fully muscularized and partially muscularized arteries), by -way anova, compared with hypoxia vehicle group. **p � . , by -way anova, compared with hypoxia vehicle group of the same sex. ††p � . , by -way anova, compared with hypoxia vehicle group of the same sex. l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . injury ( ), a developmental lung disorder of prematurity characterized by inhibited pulmonary angiogenesis and alve- ologenesis. similarly, pulmonary hypoplasia and vascular re- modeling in fetal rats with nitrofen-induced congenital dia- phragmatic hernia (cdh), in which rhoa may play a patho- logical role ( ), was ameliorated by maternally administered simvastatin ( ). as there are currently no effective preventive therapies for developmental lung disorders such and bpd and l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . cdh, or to prevent or rescue chronic pht in neonates ( ), these findings point toward statins as a potentially useful therapy. we evaluated dose-response effects of simvastatin, establishing a dose that balanced efficacy and safety. this aspect is critical for potential translation since therapies de- signed to ameliorate injury to the lung and pulmonary vascu- lature could have unanticipated adverse effects on other sys- tems, particularly the developing brain. collectively, our find- ings provide compelling initial evidence for the translational potential of statin therapy for neonatal pulmonary disease. we observed that preventively administered simvastatin attenuated the activity of rhoa, normalized pvr, and reduced both rv and pulmonary arterial structural remodeling. in our rescue protocol, the reduction of rhoa/rock activity also reduced pvr and led to significant but incomplete reversal of cardiac and vascular remodeling. severity of pulmonary vas- cular changes secondary to chronic hypoxia peaks by days of exposure and is stable from days to ; therefore, effects of rescue therapies (given from days to ) reflect reversal rather than slowed progression of injury. rats exposed to chronic hypoxia receiving rescue treatment with simvastatin also had improved exercise capacity as young adults in keeping with an important and relevant functional improvement. the isoprenoid ggpp contributes to the pathogenesis of pht by prenylation-mediated intracellular trafficking and membrane localization, and subsequent activation of rhoa ( , , , ). in the present study, we observed an increase in fpp and in hif- � content in the lungs of chronic hypoxia- exposed rats. we also observed that simvastatin reduced lung content of fpp in hypoxia-exposed animals, with a trend toward reduction in normoxia controls. presumably, a reduc- tion of fpp also led to decreased ggpp as indicated by reduced rhoa activity; however, we were unable to reliably measure ggpp content in lung. it is known that hif- � activity is elevated in hypoxia, which in turn increases tran- scription of rhoa and/or rock ( ). treatment with simva- statin decreased pulmonary hif- � levels in chronic hypoxia- exposed animals but did not affect lung content of rhoa or of either rock isoform ( , ). therefore, the effect of simva- statin could be largely attributed to downregulation of rhoa activity via inhibition of isoprenoid intermediates, rather than by changes in protein content mediated by hif- �. in support of this observation, girgis and colleagues ( ) demonstrated that concurrent supplementation of mevalonate with simvasta- tin treatment negated any beneficial effects in experimental pht. the pathology of chronic hypoxic pht is characterized in neonatal animals by severe pulmonary vascular remodeling ( ). in previous studies, inhibition of rock signaling pre- vented vascular remodeling by inhibiting smc proliferation ( ). rescue therapy with rock inhibitor opposed the anti- apoptotic effect of rock (specifically by rock ii), therefore stimulating smc apoptosis and leading to reversal of remod- eling ( ). inhibited no-cgmp signaling plays a major role in the pathogenesis of chronic pht ( , ). rock inhibits enos activity and disrupts the stability of enos mrna, thus reducing no bioavailability ( , ). in the present study, we observed that simvastatin increased enos content, which fur- ther supports suppression of rock activity as a major mech- anism for simvastatin effects on chronic neonatal pht ( ). neonates are particularly susceptible to adverse and off- target effects of pharmacological agents ( ). documented ad- verse effects of statins in adult humans include hepatic injury and muscle pain. in rabbits, high-dose simvastatin ( mg·kg� ·day� ) increased serum lactate dehydrogenase, ck, and alt ( ). in the present study, we did not observe any significant increase in serum levels of alt or ck, even at doses of simvastatin as high as mg/kg. systemically admin- istered rock inhibitors restrict somatic growth, thus limiting translational potential to the neonate ( ). in the present study, simvastatin did not adversely affect somatic growth in nor- moxia-exposed animals and actually restored normal growth in chronic hypoxia-exposed animals. in addition, simvastatin did not affect systolic blood pressure, unlike systemic rock inhibitors ( ). we did not examine effects of exposure to hypoxia or of simvastatin therapy on rhoa/rock activity in systemic vessels, but we speculate that a lack of effect of simvastatin on systemic vascular tone reflects a greater hypox- ia-induced upregulation of rhoa/rock activity in the pulmo- nary, compared with the systemic, vasculature. the usual target of statin therapy is a reduction in serum cholesterol, which in the neonate may represent an adverse fig. . effects of chronic hypoxia from birth and preventive simvastatin treatment on somatic and brain growth, brain myelination, and systemic blood pressure. pups were exposed to chronic hypoxia ( % o ) or to normoxia ( % o ) from postnatal day until day . pups were treated by daily intraperitoneal injections of simvastatin ( mg/kg) or % dmso in pbs (vehicle control). a: body weight. values represent means � se for n � – animals per group. b: systemic blood pressure following therapy with simvastatin. values represent means � se for n � animals per group. c: brain weight. values represent means � se for n � samples per group. d: myelin pixel density. values represent means � se for n � samples per group. e: tiled low-power representative photomicrographs of luxol fast blue staining on sagittal brain sections (myelin � dark blue stain; scale bar � , �m). *p � . , by -way anova, compared with all other groups. #p � . , by -way anova, compared with normoxia controls. †p � . , by -way anova, compared with normoxia vehicle. ‡p � . , by -way anova, compared with normoxia controls. §p � . , by -way anova, compared with hypoxia vehicle group. table . effects of preventative treatment with simvastatin ( mg·kg� ·day� ) on serum markers of toxicity serum analyte normoxia vehicle normoxia simvastatin hypoxia vehicle hypoxia simvastatin alt, �mol/ml . � . . � . . � . . � . ck, �mol/ml . � . . � . . � . . � . total cholesterol, mg/dl . � . . � . . � . . � . ldl cholesterol, mg/dl . � . . � . . � . * . � . # values represent means � sd for n � animals per group. *p � . , by -way anova, compared to both normoxia groups. #p � . , by -way anova, compared to normoxia simvastatin group. l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . fig. . effects of preventive simvastatin on lung cleaved rock i, rock i, rock ii, hif- �, and enos content. pups were exposed to chronic hypoxia ( % o ) or to normoxia ( % o ) from postnatal day until day . pups were treated by daily intraperitoneal injections of simvastatin ( mg/kg) or % dmso in pbs (vehicle control). western blot analyses for cleaved rock i (a), rock i (b), rock ii (c), hif- � (d), and enos (e), all normalized to gapdh. representative immunoblots are shown with noncontiguous gel lanes demarcated by black lines. values represent means � se for n � – samples per group. *p � . , by -way anova on ranks, compared with all other groups. #p � . , by -way anova on ranks, compared with hypoxia simvastatin group. †p � . , by -way anova, compared with normoxia simvastatin group. ‡p � . , by -way anova, compared with all other groups. §p � . , by -way anova, compared with hypoxia vehicle group. l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . effect, given the reliance of the developing brain on cholesterol for normal development ( ). interestingly, neither simvastatin nor the dmso vehicle altered total serum cholesterol levels or ldl cholesterol in the newborn rat. this finding is likely explained by the fact that breastfeeding neonates rely less on endogenous synthesis of cholesterol to maintain serum levels, due to the presence of high levels of cholesterol in breast milk ( ). indeed, high doses of statins have not been found to alter brain cholesterol levels, which is required for myelin formation ( , , , ). lipid soluble statins such as simvastatin can cross the blood-brain barrier by lactonization. however, statins do not accumulate in the brain, being rapidly eliminated by the p-glycoprotein transporter ( ). furthermore, cyp a , the enzyme responsible for simvastatin metabolism and activation, is absent from the rodent brain ( , ) and has only been detected in the human brain at one-tenth the level of liver cyp a ( ). prematurely born humans have an increased risk for long-term neurodevelopmental disability. in models of newborn neurological injury and abnormal development, st- atins prevented injury through modulation of inflammation, leading to normalized morphology, white matter content, and brain weight ( , , ). while there were no reported adverse effects from simvastatin in a small observational study in children with pht, further study is needed to assess safety and efficacy in the newborn population despite our present reas- suring findings ( ). there are a number of limitations to this study. first, our chronic hypoxia model of pht does not mimic chronic pht secondary to developmental lung disorders, such as bpd, which is among the most common causes of chronic pht in neonates and infants ( ). therefore, effects of statin therapy should be studied in models mimicking inhibited pulmonary angiogenesis and arrested lung development, as observed in bpd ( ). second, use of simvastatin as a rescue therapy showed incomplete effects compared with prevention, which may have been overcome by prolongation of therapy. third, we did not conduct functional neurological examination to substantiate our morphological findings suggesting an im- provement in hypoxia-mediated disruption of myelination with simvastatin treatment. fourth, our focus was restricted to the activity of rhoa. many other gtpase proteins could be similarly affected by statin therapy, based on their dependence for prenylation-mediated activation. of note, the ras family of g proteins and other members of the rho family such as rac and cdc may warrant further investigation since they are known to be involved in cardiac hypertrophy, actin cytoskel- eton remodeling, and smc proliferation ( , ). lastly, eval- uation of sex differences in response to therapy is a relevant biological variable that should be evaluated in future studies. in summary, simvastatin-mediated inhibition of isoprenoid intermediates downregulates rhoa activity, leading to preven- tion and reversal of chronic pht. our findings suggest that simvastatin was well tolerated, lacked apparent adverse sys- temic or neurological effects, and therefore holds promise as a potentially translatable means of limiting pathological rock activity in the neonate. acknowledgments the authors thank denis reynaud and ashley st. pierre of the analytical facility for bioactive molecules, the hospital for sick children, toronto, canada, for assistance with lc- ms/ms analysis of lung tissue isoprenoid intermediates. grants this work was supported by operating funding from the canadian institutes of health research (cihr; mop- to r. p. jankov) and by infrastructure funding from the canada foundation for innovation (to r. p. jankov). a. jain was supported by a clinician-scientist training program award from the hospital for sick children research training centre and by a queen elizabeth ii/heart and stroke foundation of ontario graduate scholarship in science and technology. m. j. wong was supported by a graduate scholarship from the department of physiology, university of toronto and by a lorne phenix graduate award from the cardiovascular sciences collaborative program, faculty of medicine, university of toronto. disclosures no conflicts of interest, financial or otherwise, are declared by the author(s). author contributions m.j.w. and r.p.j. conceived and designed research; m.j.w., c.k., j.i., a.j., and r.p.j. performed experiments; m.j.w., a.j., and r.p.j. analyzed data; m.j.w. and r.p.j. interpreted results of experiments; m.j.w. and r.p.j. prepared figures; m.j.w. and r.p.j. drafted manuscript; m.j.w., c.k., j.i., a.j., and r.p.j. edited and revised manuscript; m.j.w., c.k., j.i., a.j., and r.p.j. approved final version of manuscript. references . adibhatla rm, hatcher jf. altered lipid metabolism in brain injury and disorders. subcell biochem : – , . . allegaert k, van den anker j. neonatal drug therapy: the first frontier of therapeutics for children. clin pharmacol ther : – , . . ambalavanan n, mourani p. pulmonary hypertension in bronchopul- monary dysplasia. birth defects res a clin mol teratol : – , . . bhat r, salas aa, foster c, carlo wa, ambalavanan n. prospective analysis of pulmonary hypertension in extremely low birth weight infants. pediatrics : e –e , . . bogaard hj, abe k, vonk noordegraaf a, voelkel nf. the right ventricle under pressure: cellular and molecular mechanisms of right-heart failure in pulmonary hypertension. chest : – , . . bronicki ra, baden hp. pathophysiology of right ventricular failure in pulmonary hypertension. pediatr crit care med , suppl : s –s , . . bulhak a, roy j, hedin u, sjoquist po, pernow j. cardioprotective effect of rosuvastatin in vivo is dependent on inhibition of geranylgeranyl pyrophosphate and altered rhoa membrane translocation. am j physiol heart circ physiol : h –h , . . chaipichit n, krska j, pratipanawatr t, jarernsiripornkul n. statin adverse effects: patients’ experiences and laboratory monitoring of muscle and liver injuries. int j clin pharm : – , . . chambers cd, hernandez-diaz s, van marter lj, werler mm, louik c, jones kl, mitchell aa. selective serotonin-reuptake inhibitors and risk of persistent pulmonary hypertension of the newborn. n engl j med : – , . . dietschy jm. central nervous system: cholesterol turnover, brain devel- opment and neurodegeneration. biol chem : – , . . donti a, formigari r, ragni l, manes a, galie n, picchio fm. pulmonary arterial hypertension in the pediatric age. j cardiovasc med : – , . . dransart e, olofsson b, cherfils j. rhogdis revisited: novel roles in rho regulation. traffic : – , . . dunlop k, gosal k, kantores c, ivanovska j, dhaliwal r, desjardins jf, connelly ka, jain a, mcnamara pj, jankov rp. therapeutic hypercapnia prevents inhaled nitric oxide-induced right-ventricular sys- tolic dysfunction in juvenile rats. free radic biol med c: – , . . duong-quy s, bei y, liu z, dinh-xuan at. role of rho-kinase and its inhibitors in pulmonary hypertension. pharmacol ther : – , . . endo a. a historical perspective on the discovery of statins. proc jpn acad ser b phys biol sci : – , . l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . . fani k, debons af, jimenez fa, hoover el. cholesterol-induced atherosclerosis in the rabbit: effect of dimethyl sulfoxide on existing lesions. j pharmacol exp ther : – , . . farrow kn, lakshminrusimha s, reda wj, wedgwood s, czech l, gugino sf, davis jm, russell ja, steinhorn rh. superoxide dismutase restores enos expression and function in resistance pulmonary arteries from neonatal lambs with persistent pulmonary hypertension. am j physiol lung cell mol physiol : l –l , . . garcia-mata r, boulter e, burridge k. the ‘invisible hand’: regulation of rho gtpases by rhogdis. nat rev mol cell biol : – , . . garcia c, duan rd, brevaut-malaty v, gire c, millet v, simeoni u, bernard m, armand m. bioactive compounds in human milk and intestinal health and maturity in preterm newborn: an overview. cell mol biol : – , . . gilkes dm, xiang l, lee sj, chaturvedi p, hubbi me, wirtz d, semenza gl. hypoxia-inducible factors mediate coordinated rhoa- rock expression and signaling in breast cancer cells. proc natl acad sci usa : e –e , . . girgis re, mozammel s, champion hc, li d, peng x, shimoda l, tuder rm, johns ra, hassoun pm. regression of chronic hypoxic pulmonary hypertension by simvastatin. am j physiol lung cell mol physiol : l –l , . . gosal k, dunlop k, dhaliwal r, ivanovska j, kantores c, desjardins jf, connelly ka, mcnamara pj, jain a, jankov rp. rho-kinase mediates right ventricular systolic dysfunction in rats with chronic neo- natal pulmonary hypertension. am j respir cell mol biol : – , . . gosal k, dunlop k, dhaliwal r, ivanovska j, kantores c, desjardins jf, connelly ka, mcnamara pj, jain a, jankov rp. rho-kinase mediates right ventricular systolic dysfunction in rats with chronic neo- natal pulmonary hypertension. am j respir cell mol biol : – , . a.(a)guignabert c, tu l, girerd b, ricard n, huertas a, montani d, humbert m. new molecular targets of pulmonary vascular remodeling in pulmonary arterial hypertension: importance of endothelial communica- tion. chest : – , . . jankov rp, kantores c, belcastro r, yi s, ridsdale ra, post m, tanswell ak. a role for platelet-derived growth factor -receptor in a newborn rat model of endothelin-mediated pulmonary vascular remodel- ing. am j physiol lung cell mol physiol : l –l , . . jankov rp, luo x, cabacungan j, belcastro r, frndova h, lye sj, tanswell ak. endothelin- and o -mediated pulmonary hypertension in neonatal rats: a role for products of lipid peroxidation. pediatr res : – , . . jankov rp, tanswell ak. chronic neonatal lung injury and care strat- egies to decrease injury. in: fetal and neonatal lung development: clinical correlates and technologies for the future, edited by jobe a, whitsett ja, abman sh. new york: cambridge university press, , p. – . . jasinska m, owczarek j, orszulak-michalak d. the influence of simvastatin at high dose and diltiazem on myocardium in rabbits, the biochemical study. acta pol pharm : – , . . kato m, blanton r, wang gr, judson tj, abe y, myoishi m, karas rh, mendelsohn me. direct binding and regulation of rhoa protein by cyclic gmp-dependent protein kinase ialpha. j biol chem : – , . . kavalipati n, shah j, ramakrishan a, vasnawala h. pleiotropic effects of statins. indian j endocrinol metab : – , . . kawut sm, horn em, berekashvili kk, lederer dj, widlitz ac, rosenzweig eb, barst rj. selective serotonin reuptake inhibitor use and outcomes in pulmonary arterial hypertension. pulm pharmacol ther : – , . . king wt, day rw. treatment of pediatric pulmonary hypertension with simvastatin: an observational study. pediatr pulmonol : – , . . klinger jr, abman sh, gladwin mt. nitric oxide deficiency and endothelial dysfunction in pulmonary arterial hypertension. am j respir crit care med : – , . . kolavennu v, zeng l, peng h, wang y, danesh fr. targeting of rhoa/rock signaling ameliorates progression of diabetic nephropathy independent of glucose control. diabetes : – , . . konduri gg, vohr b, robertson c, sokol gm, solimano a, singer j, ehrenkranz ra, singhal n, wright ll, van meurs k, stork e, kirpalani h, peliowski a, johnson y. early inhaled nitric oxide therapy for term and near-term newborn infants with hypoxic respiratory failure: neurodevelopmental follow-up. j pediatr : – , . . kosmidou i, moore jp, weber m, searles cd. statin treatment and = polyadenylation of enos mrna. arterioscler thromb vasc biol : – , . . lankhaar jw, westerhof n, faes tj, gan ct, marques km, boon- stra a, van den berg fg, postmus pe, vonk-noordegraaf a. pulmo- nary vascular resistance and compliance stay inversely related during treatment of pulmonary hypertension. eur heart j : – , . . laufs u, liao jk. direct vascular effects of hmg-coa reductase inhibitors. trends cardiovasc med : – , . . laufs u, liao jk. post-transcriptional regulation of endothelial nitric oxide synthase mrna stability by rho gtpase. j biol chem : – , . . lee ah, dhaliwal r, kantores c, ivanovska j, gosal k, mcnamara pj, letarte m, jankov rp. rho-kinase inhibitor prevents bleomycin- induced injury in neonatal rats independent of effects on lung inflamma- tion. am j respir cell mol biol : – , . . lee yh, kim kc, cho ms, hong ym. changes of pulmonary pathology and gene expressions after simvastatin treatment in the monocrotaline- induced pulmonary hypertension rat model. korean circ j : – , . . li a, lv s, yu z, zhang y, ma h, zhao h, piao h, li s, zhang n, sun c. simvastatin attenuates hypomyelination induced by hypoxia-ischemia in neonatal rats. neurol res : – , . . li m, li z, sun x. statins suppress mmp secretion via inactivation of rhoa/rock pathway in pulmonary vascular smooth muscles cells. eur j pharmacol : – , . . ling q, tejada-simon mv. statins and the brain: new perspective for old drugs. prog neuropsychopharmacol biol psychiatry : – , . . liu zq, liu b, yu l, wang xq, wang j, liu hm. simvastatin has beneficial effect on pulmonary artery hypertension by inhibiting nf- kappab expression. mol cell biochem : – , . . makanga m, maruyama h, dewachter c, da costa am, hupkens e, de medina g, naeije r, dewachter l. prevention of pulmonary hyp- oplasia and pulmonary vascular remodeling by antenatal simvastatin treatment in nitrofen-induced congenital diaphragmatic hernia. am j physiol lung cell mol physiol : l –l , . . mathews es, mawdsley dj, walker m, hines jh, pozzoli m, appel b. mutation of -hydroxy- -methylglutaryl coa synthase i reveals require- ments for isoprenoid and cholesterol synthesis in oligodendrocyte migra- tion arrest, axon wrapping, and myelin gene expression. j neurosci : – , . . mihos cg, santana o. pleiotropic effects of the hmg-coa reductase inhibitors. int j gen med : – , . . mourani pm, abman sh. pulmonary vascular disease in bronchopul- monary dysplasia: pulmonary hypertension and beyond. curr opin pedi- atr : – , . . nergui s, fukumoto y, do ez, nakajima s, shimizu t, ikeda s, elias-al-mamun m, shimokawa h. role of endothelial nitric oxide synthase and collagen metabolism in right ventricular remodeling due to pulmonary hypertension. circ j : – , . . o’reilly m, thébaud b. animal models of bronchopulmonary dysplasia. the term rat models. am j physiol lung cell mol physiol : l – l , . . ose a, kusuhara h, endo c, tohyama k, miyajima m, kitamura s, sugiyama y. functional characterization of mouse organic anion trans- porting peptide a in the uptake and efflux of drugs across the blood- brain barrier. drug metab dispos : – , . . ou xm, feng yl, wen fq, huang xy, xiao j, wang k, wang t. simvastatin attenuates bleomycin-induced pulmonary fibrosis in mice. chin med j (engl) : – , . . pacary e, tixier e, coulet f, roussel s, petit e, bernaudin m. crosstalk between hif- and rock pathways in neuronal differentiation of mesenchymal stem cells, neurospheres and in pc neurite outgrowth. mol cell neurosci : – , . . pedroni sm, gonzalez jm, wade j, jansen ma, serio a, marshall i, lennen rj, girardi g. complement inhibition and statins prevent fetal brain cortical abnormalities in a mouse model of preterm birth. biochim biophys acta : – , . . porter fd, herman ge. malformation syndromes caused by disorders of cholesterol synthesis. j lipid res : – , . l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . . rikitake y, kim hh, huang z, seto m, yano k, asano t, moskowitz ma, liao jk. inhibition of rho kinase (rock) leads to increased cerebral blood flow and stroke protection. stroke : – , . . rysz-górzynska m, gluba-brzozka a, sahebkar a, serban mc, mikhailidis dp, ursoniu s, toth pp, bittner v, watts gf, lip gy, rysz j, catapano al, banach m. efficacy of statin therapy in pulmo- nary arterial hypertension: a systematic review and meta-analysis. sci rep : , . . sartori c, allemann y, trueb l, delabays a, nicod p, scherrer u. augmented vasoreactivity in adult life associated with perinatal vascular insult. lancet : – , . . satoh k, fukumoto y, shimokawa h. rho-kinase: important new therapeutic target in cardiovascular diseases. am j physiol heart circ physiol : h –h , . . satoh m, takahashi y, tabuchi t, minami y, tamada m, takahashi k, itoh t, morino y, nakamura m. cellular and molecular mechanisms of statins: an update on pleiotropic effects. clin sci : – , . . schachter m. chemical, pharmacokinetic and pharmacodynamic proper- ties of statins: an update. fundam clin pharmacol : – , . . schafer m, myers c, brown rd, frid mg, tan w, hunter k, stenmark kr. pulmonary arterial stiffness: toward a new paradigm in pulmonary arterial hypertension pathophysiology and assessment. curr hypertens rep : , . . schroll s, lange tj, arzt m, sebah d, nowrotek a, lehmann h, wensel r, pfeifer m, blumberg fc. effects of simvastatin on pulmo- nary fibrosis, pulmonary hypertension and exercise capacity in bleomycin- treated rats. acta physiol (oxf) : – , . . shi j, wei l. rho kinases in cardiovascular physiology and pathophys- iology: the effect of fasudil. j cardiovasc pharmacol : – , . . shimokawa h, sunamura s, satoh k. rhoa/rho-kinase in the cardio- vascular system. circ res : – , . . somlyo av. cyclic gmp regulation of myosin phosphatase: a new piece for the puzzle? circ res : – , . . takayasu h, masumoto k, hagiwara k, sasaki t, ono k, jimbo t, uesugi t, gotoh c, urita y, shinkai t, tanaka h. increased pulmo- nary rhoa expression in the nitrofen-induced congenital diaphragmatic hernia rat model. j pediatr surg : – , . . thelen km, laaksonen r, paiva h, lehtimaki t, lutjohann d. high-dose statin treatment does not alter plasma marker for brain choles- terol metabolism in patients with moderately elevated plasma cholesterol levels. j clin pharmacol : – , . . thirunavukkarasu m, selvaraju v, dunna nr, foye jl, joshi m, otani h, maulik n. simvastatin treatment inhibits hypoxia inducible factor -alpha-(hif- alpha)-prolyl- -hydroxylase (phd- ) and in- creases angiogenesis after myocardial infarction in streptozotocin-induced diabetic rat. int j cardiol : – , . . tijsseling d, camm ej, richter hg, herrera ea, kane ad, niu y, cross cm, de vries wb, derks jb, giussani da. statins prevent adverse effects of postnatal glucocorticoid therapy on the developing brain in rats. pediatr res : – , . . van loon rl, roofthooft mt, delhaas t, van osch-gevers m, ten harkel ad, strengers jl, backx a, hillege hl, berger rm. outcome of pediatric patients with pulmonary arterial hypertension in the era of new medical therapies. am j cardiol : – , . . wang cy, liu py, liao jk. pleiotropic effects of statin therapy: molecular mechanisms and clinical results. trends mol med : – , . . woodland c, huang tt, gryz e, bendayan r, fawcett jp. expres- sion, activity and regulation of cyp a in human and rodent brain. drug metab rev : – , . . xu ez, kantores c, ivanovska j, engelberts d, kavanagh bp, mcnamara pj, jankov rp. rescue treatment with a rho-kinase inhib- itor normalizes right ventricular function and reverses remodeling in juvenile rats with chronic pulmonary hypertension. am j physiol heart circ physiol : h –h , . . ziino aj, ivanovska j, belcastro r, kantores c, xu ez, lau m, mcnamara pj, tanswell ak, jankov rp. effects of rho-kinase inhi- bition on pulmonary hypertension, lung growth, and structure in neonatal rats chronically exposed to hypoxia. pediatr res : – , . l simvastatin prevents and reverses chronic neonatal pht ajp-lung cell mol physiol • doi: . /ajplung. . • www.ajplung.org downloaded from journals.physiology.org/journal/ajplung at carnegie mellon univ ( . . . ) on april , . the mobius airo mobile ct for image‐guided proton therapy: characterization & commissioning r a d i a t i o n o n c o l o g y p h y s i c s the mobius airo mobile ct for image-guided proton therapy: characterization & commissioning jasmine a. oliver | omar a. zeidan | sanford l. meeks | amish p. shah | jason pukala | patrick kelly | naren r. ramakrishna | twyla r. willoughby department of radiation oncology, uf health cancer center – orlando health, orlando, fl, usa author to whom correspondence should be addressed. twyla r. willoughby e-mail: twyla.willoughby@orlando health.com; telephone: . abstract purpose: the purpose of this study was to characterize the mobius airo mobile ct system for localization and image-guided proton therapy. this is the first known application of the airo for proton therapy. methods: five ct images of a catphan� phantom were acquired on the airo mobile ct system, varian edge radiosurgery system cone beam ct (cbct), philips bril- liance big bore slice ct simulator, and siemens somatom definition as slice ct simulator. doselab software v. . was utilized for image quality analysis. modulation transfer function, scaling discrepancy, geometric distortion, spatial resolution, overall uni- formity, minimum uniformity, contrast, high cnr, and maximum hu deviation were acquired. low cnr was acquired manually using the ctp module. localization accu- racy and ct dose index were measured and compared to reported values on each imag- ing device. for treatment delivery systems (edge and mevion), the localization accuracy of the d imaging systems were compared to d imaging systems on each system. results: the airo spatial resolution was . lp mm� compared with . lp mm� for the philips ct simulator, . lp mm� for the edge cbct, and . lp mm� for the siemens ct simulator. airo/siemens and airo/philips differ- ences exceeded % for scaling discrepancy ( . % and . %). the airo exhibited higher dose (> mgy) than the philips ct simulator. localization accu- racy (based on the mimi phantom) was . ° and . mm. localization accuracy (based on stereophan) demonstrated maximum airo-kv/kv shift differences of . mm in the x-direction, . mm in the y-direction, and . mm in the z-direction. conclusions: the localization accuracy of airo was determined to be within . ° and . mm despite its slightly lower image quality overall compared to other ct imaging systems at our institution. based on our study, the mobile airo ct system can be utilized accurately and reliably for image-guided proton therapy. p a c s . .bn, . .c-, . .n-, . .q- k e y w o r d s airo, igpt, mobile ct, proton therapy - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - this is an open access article under the terms of the creative commons attribution license, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. © the authors. journal of applied clinical medical physics published by wiley periodicals, inc. on behalf of american association of physicists in medicine. received: november | revised: january | accepted: february doi: . /acm . | wileyonlinelibrary.com/journal/jacmp j appl clin med phys ; : : – | introduction advances in in-room computed tomography (ct) scanners and cone- beam technology have led to the proliferation of ct localization for image guided radiation therapy (igrt). – these imagers provide improved treatment accuracy over conventional orthogonal imaging allowing for increased precision in radiation delivery. patient localiza- tion accuracy is particularly important in proton beam radiation ther- apy due to the sharp dose fall-off compared to conventional x-ray therapy. unfortunately, due to the size and geometry of proton ther- apy units, imaging has largely been limited to orthogonal kv/kv x-ray systems. recently, people have reported on the use of in- room ct scanners for proton beam radiation therapy localization. – some proton vendors are developing technologies for cbct (pro- teus�one, iba, belgium, hitachi, tokyo, japan). to date, stand- alone in-room ct scanners utilized have had large footprints and are either not amenable to or cumbersome to use in the more compact proton therapy centers, such as the s (mevion medical systems, littleton, ma, usa). for these reasons, a small-footprint mobile ct scanner, commonly used for image-guided surgery, could be of great value for d image-guided proton therapy (igpt). the airo mobile ct system (mobius imaging llc, shirley, ma, usa) is a large bore ( cm) helical slice ct scanner historically uti- lized for intra-operative imaging for spinal surgeries. our institution is the first to acquire and clinically implement the airo mobile ct system (airo) for igpt. the airo’s small footprint (w l h: . . . m) occupies . m of treatment floor space (in scan mode). when not in use, the airo is stored in the maze (fig. ) to avoid radiation-induced damage to its sensitive electronics. the airo’s motor-controlled castors provide effortless transport from the storage location (in the maze hallway) to the scanning location. the airo’s image quality characteristics have been reported by weir et al. for surgical applications. our study assessed the perfor- mance characteristics of the airo at our institution compared with igrt systems used for intensity-modulated radiation therapy (imrt) and ct simulators at our institution for radiotherapy applications. our current igpt workflow involves ct simulation using a philips big bore slice ct simulator with routine orthogonal kv/kv image pairs (flat- panel detectors) preceding each treatment fraction. the airo will be utilized for target localization and inter-fraction adaptive treatment assessment. to our knowledge, our facility is the first compact proton therapy system to use a mobile ct scanner for igpt. | materials and methods mevion medical systems has developed software, veritytm d, that uses ct images from any scanner to perform d image f i g . . mevion-airo room setup. (a) treatment room with couch in setup position. (b) treatment room with couch in imaging position. (c) birds-eye-view of the treatment room. the airo is shown in scan mode with cm max scan range and . cm image field-of-view. pa and left lateral kv imaging panels are also shown with associated track. oliver et al. | registrations for proton therapy. due to the ease of motion and small footprint, we have selected the airo ct scanner for igpt. the airo is sold commercially for surgical purposes by brainlab (munich, germany). mevion has developed an infrared camera tracking system to interface with the ct scanner to facilitate use of ct images for igpt. this system references the d image set to the in-room coordinates and planning ct via a reference frame, infrared camera, and ct scan. this reference frame attaches to the treatment couch and includes infrared markers to determine initial room coordinates as well as ceramic markers to reference the ct image to room coordinates. an additional infrared marker is rigidly attached to the gantry so that changes in the reference frame loca- tion in relation to the treatment room can be detected as the robotic couch moves between the initial treatment setup location and the ct imaging location. the airo unit was specifically adapted to use inside the proton vault by removing the integrated stand that supports the weight of surgical gurneys in order to avoid interference with the robotic couch (fig. ). .a | image quality characterization and comparison to simulators and igrt systems five ct images of a catphan� phantom (the phantom labora- tory, salem, ny, usa) were acquired on the airo mobile ct sys- tem, a varian edgetm radiosurgery system (edge) on board imager, a philips brilliance big bore slice ct simulator, and a sie- mens somatom definition as slice ct simulator. medial and lateral lasers were used to align the phantom prior to image acquisition. image acquisition was performed with various protocols. on the airo, images were acquired with soft, standard, and sharp recon- struction kernels with the pre-set clinical head protocol. the airo’s pre-set clinical protocols for head, thorax, abdomen, pelvis, shoulder are listed in table . the sharp, standard, and soft kernels are noise filtering gaussian smoothing kernels with r = . , . , and . , respectively. on the edge, images were acquired using the following pre-set clinical techniques: head, thorax, pelvis, pelvis obese, and image gently (table ). on the philips ct simulator, standard clinical proto- cols were used ( kvp, ma) with . mm, . mm, and . mm slice thickness. on the siemens ct simulator images were acquired with standard brain ( kv, mas), high res brain ( kv, mas), abdomen ( kv, mas), and thorax ( kv, mas) protocols with . mm, . mm, and . mm slice thickness. multimodality comparisons were made using the clinical head protocols on the airo, philips, and siemens ct simulators and the pelvis technique on the edge. the pelvis technique was used on the edge because it uses full ° gantry rotation and provides the high- est image quality. the edge head protocol involves a ° gantry rotation and is configured for low dose rather than image quality. doselab software v. . (mobius medical systems lp, houston, tx, usa) was used for image quality analysis. modules ctp , ctp , and ctp were analyzed. the following image quality measures were assessed: modulation transfer function (mtf), scaling discrepancy, geometric distortion, spatial resolution, overall unifor- mity, minimum uniformity, contrast, cnr, and maximum hu devia- tion (table ). the mean and standard deviation of five or more scans are reported. the low contrast module (ctp ) was assessed on the airo, philips, and siemens scans. low cnr was calculated using the . mm % supra-slice target. a region-of-interest (roi) was dropped onto the supra-slice target and another on a uniform region of the phantom. .b | localization accuracy a stereophan phantom (sun nuclear corporation, melbourne, fl, usa) was used to measure the localization accuracy of the mevion- airo system. the universal spacer insert and ct/mri insert were inserted into the cylinder cavity. the phantom was leveled with the precision leveling stand. treatment isocenter was placed at the bb target corresponding to the laser alignment marks on the outside of the phantom. the robotic couch was re-positioned to acquire the airo images following the mevion localization workflow. once the images were acquired, the robotic couch was moved back to the ini- tial treatment isocenter based on the robotic couch’s coordinates. the software then performed a ct registration correlating the refer- ence frame’s ceramic fiducials to its infrared markers (relative to treatment isocenter). the images were then manually registered to the d planning ct. successively, a kv/kv image pair was acquired and registered to the digitally reconstructed radiograph (drr). local- ization accuracy was defined as the difference between suggested shifts from the kv/kv pair versus the airo ct image set, where the kv/kv image was considered the gold standard. in addition, end-to- end tests were performed to illustrate both time and workflow for patient setup and target localization. additional localization accuracy tests were performed using the degree-of-freedom mimi phantom (standard imaging, inc. middleton, wi, usa). the default q-fix overlay couch top was used. with the proton gantry positioned at ° the reference frame was attached to the couch top and the couch was positioned to ° to capture the reference frame. known shifts were applied to the phantom sepa- rately including all translational directions (lateral, longitudinal, and vertical), all rotations (yaw, shift, and roll), and cumulatively (all t a b l e edge cbct & airo helical ct clinical pre-set protocols/ techniques. edge cbct techniques airo helical ct protocols techniques kvp mas protocols kvp mas head head thorax thorax pelvis pelvis pelvis obese abdomen image gently shoulder | oliver et al. degrees of freedom). a reference kv/kv image set was acquired pre- ceding the airo ct image. the couch was moved to the d imaging position and a d ct image was acquired. the image was sent to the mevion treatment console and verity, and then registered to the d planning ct. an initial manual rigid registration was performed followed by automated registration for fine tuning. suggested shifts were applied. the robotic couch was then re-positioned to standard imaging position and a d orthogonal kv x-ray pair was acquired. suggested shifts (kv/kv) were recorded. localization accuracy was defined as the difference between suggested shifts and known shifts. .c | measured imaging dose ct dose index for helical scans (ctdivol) was calculated using a -cm and -cm cylindrical polymethylmetacrylate phantom (cirs, computerized imaging reference systems, inc., norfolk, va, model & a) with mm pencil ionization chamber and electrome- ter (raysafe xi ct detector, unfors raysafe, inc., cleveland, oh, usa) on the airo and the philips ct simulator. the ion chamber was placed at the o’clock and the o’clock positions. three dose measurements were acquired at each position. measured dose was then compared to the vendor-reported ctdivol. acr requirements specify that dose must be within % of manufacturer-reported specifications. | results .a | image quality characterization and comparison to simulators and igrt systems .a. | airo reconstruction kernel effects on image quality the airo image quality results for various kernels are listed in table . the airo sharp kernel provided the best mtf ( . line pairs/mm). high cnr and spatial resolution ( . % difference) decreased from sharp to soft kernel. low cnr increased from sharp kernel to soft kernel ( . – . ). overall uniformity and mini- mum uniformity were comparable across reconstruction kernels (< . % difference). geometric distortion was equal for sharp and standard reconstruction kernels and < % difference between sharp/soft and standard/soft kernels. figure illustrates that the t a b l e image quality tests and calculation methods. image quality tests definition modulation transfer function (mtf)a the modulation of multiple rois in the phantom with various line bar patterns. as spatial frequency increases, roi’s modulation decreases. the modulation is normalized to its highest value and plotted. modulationa hu �hu hu þhu where hu s the th percentile ct number in the roi and hu m %ð Þ s the th percentile ct number in the roi. scaling discrepancya the maximum possible error in a measurement of distance. mð%Þ � %j j � l where m ð%Þ is the magnification of the image and l is the length of the image’s longest side. geometric distortiona verifies that correct distance measurement occurs in all regions of the ct image. overall uniformitya � max �min max þmin � � � % where max is the maximum th percentile ct number in all uniformity regions and min is the minimum th percentile ct number in all uniformity regions minimum uniformitya the lowest uniformity of all rois. uniformity is calculated as: � hu �hu hu þhu � � � % where hu is the th percentile of the pixel ct number in the roi and hu is the th percentile of the ct number in the roi. maximum hu deviationa the maximum deviation between mean hu value of an roi subtracted from its defined reference hu absolute value of all calculated hu deviation on an image. contrasta hu �hu hu þhu � � � % where hu is the mean ct number in the region with greater signal and hu is the mean ct number in the region with lesser signal. high contrast-to-noise ratioa highcontrast noise ¼ hu �hu hu þhu � % � �, ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ðr Þþðr Þ pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ðhu Þ þðhu Þ p � � � % where r is the standard deviation of the high contrast roi, r is the standard deviation of background, hu is the mean ct number of the high contrast roi and hu is the mean ct number of background. low contrast-to-noise ratio lowcontrast noise ¼ huroi�hubj j rb where rb is the standard deviation of the background roi, huroi is the mean ct number inside the low contrast roi and hub is the mean ct number of the background roi. adefinitions derived from doselab v. . user manual. oliver et al. | mtf for the sharp kernel with small fov exceeded that of the soft kernel. .a. | comparison to simulators and igrt systems figure illustrates that the mtf and spatial resolution of the airo ( . lp/mm) was lower than the philips ct simulator ( . lp/mm), siemens ct simulator ( . lp/mm), and edge cbct ( . lp/mm). conversely, the philips ct simulator exhibited superior mtf and spatial resolution compared to all modalities (table and fig. ). the airo had comparable minimum and overall uniformity when com- pared to the philips ct simulator, siemens ct simulator or the edge (< . % difference, table ). the philips high cnr was superior to the airo with a . difference between the two values ( . % dif- ference). the siemens high cnr was superior to the airo with a . difference between the two values ( . % difference). philips maximum hu deviation was comparable to the airo ( . % differ- ence). siemens maximum hu deviation was larger than the airo’s maximum hu deviation ( . % difference). the edge demonstrated the smallest hu deviation ( . hu, . % difference from airo). airo/philips image quality differences were within % for over- all uniformity, minimum uniformity, and contrast and high cnr. airo/philips geometric distortion difference was . mm ( %). airo/siemens high cnr differences were . % and geometric distortion differences were %. airo/siemens differences exceeded % for scaling discrepancy ( . %). the airo low cnr was . for the standard reconstruction kernel. the philips and siemens ct simulator low cnr were . and . , respec- tively. refer to table for hu constancy values for the airo, phi- lips ct simulator, siemens ct simulator and edge cbct (module ctp ). .b | localization accuracy of mevion-airo system localization accuracy results using the stereophan phantom (based on two trials) demonstrated maximum airo-kv/kv shift differences of . mm in the x-direction, . mm in the y-direction, and . mm in the z-direction. (rotations were not included in the analysis because the target was a single bb inside of the phantom.) the mimi phantom was used to characterize the rotational corrections. the rms values were between . mm and . mm. localization accuracy (based on the mimi phantom) was within . °. registration (kv/kv) was within . ° and . mm from d/ d registrations. these results included robotic couch motion from the ct scanner imaging position to the standard kv imaging isocenter. t a b l e airo image quality results for varying reconstruction kernels. sharp standard soft scaling discrepancy (mm): . . . geometric distortion (mm): . . . spatial resolution ( % mtf, lp/mm): . . . overall uniformity (%): . . . minimum uniformity (%): . . . contrast (%): . . . high cnr: . . . low cnr: . . . maximum hu deviation (hu): . . . f i g . . airo normalized mtf for sharp, standard, and soft reconstruction kernels—calculated with doselab v . . f i g . . normalized mtf for philips ct simulator, airo, and edge cbct—calculated with doselab v . . t a b l e image quality results—airo, philips ct simulator, siemens ct simulator and edge cbct (doselab). philips airo siemens edgea scaling discrepancy (mm): . . . . geometric distortion (mm): . . . . spatial resolution ( % mtf, lp/mm): . . . . overall uniformity (%): . . . . minimum uniformity (%): . . . . contrast (%): . . . . high cnr: . . . . low cnr: . . . – maximum hu deviation (hu): . . . . aedge cbct images were acquired with the pelvis protocol. | oliver et al. the localization accuracy tests also included a workflow and time analysis to determine the optimal location of the ct scanner in the treatment room and to gauge the time required for a ct scan. the resultant workflow required one therapist to bring the ct scanner into the room while an additional therapist performed the initial patient setup. an additional – min were needed to acquire a ct scan. .c | ctdivol measured ctdivol for the airo, and philips ct simulator are illus- trated in table . the airo had the highest dose especially for the head protocol which gave . mgy more dose than the philips ct simulator. the standard helical airo head protocol ( kv, ma, mas (effective), . s rotation time, . mm slice collimation, . mm slice width, . pitch factor, soft kernel) gave . mgy ctdivol. measured ctdivol was . mgy (table ). the helical airo abdomen protocol ( kv, ma, mas (effec- tive), . s rotation time, . mm slice collimation, . mm slice width, . pitch factor, standard kernel) gave . mgy ctdivol. measured ctdivol was . mgy (table ). the philips clinical . mm head protocol ( kv, ma, mas (effective), . s rotation time, . mm slice thickness, . pitch factor) and clinical . mm body protocol ( kv, ma, mas (effective), . s rotation time, . mm slice thickness, . pitch factor) was used. ctdiw was also measured on the edge (pelvis protocol, table ). dose measurements were . mgy for head and . mgy for abdomen. in comparison, amer et al. reported cbdiw (cone beam ct dose index) values of . mgy, mgy and mgy for head, lung, and pelvis cbct protocols, respectively, on an elekta syn- ergy treatment machine. for the airo and the philips simulators, dose was within the acr requirements of % of manufacturer- specifications. | discussion this study describes the characterization and commissioning of the airo mobile ct system for igpt. our characterization of the airo’s image quality demonstrated that the spatial resolution of the airo was lower than our other simulators and igrt systems. weir et al. reported similar findings about the airo indicating its poor spatial resolution when compared to a siemens sensation slice ct scan- ner. weir et al. also reported ring artifacts which could not be elimi- nated. we found similar ring artifacts present when phantoms had widths at or near the width of the detector ( cm). ring artifacts were most noticeable at the phantom/air interface in cylindrical phantoms. these artifacts were not present in anthropomorphic phantoms, thus we conclude that ring artifacts should not appear on patient scans. image quality is protocol and reconstruction kernel dependent. we also found a large scaling discrepancy in comparison to the edge and simulators. we attribute this difference to the airo’s large bore. scaling discrepancy is calculated based on the image’s magnification and the length of the longest side of the image. one last potential disadvantage of the airo for daily igrt is the additional patient dose. we measured airo’s ctdivol in the range of . – . mgy. these doses are slightly higher than the values measured for the edge cbct ( . – . mgy), and may need to be taken into account if multiple ct datasets are acquired on a daily basis. although the airo’s image quality is worse than ct simulators and the edge cbct, the airo’s localization accuracy was within . mm and . ° measured using the mimi phantom. additionally, we demonstrated that the localization accuracy of the mevion- airo system using the stereophan phantom was within . mm when compared with orthogonal kv/kv pairs. this accuracy is com- parable to other commonly used igpt modalities. landry et al. reported . mm localization accuracy for a gantry-mounted cbct system and xu et al. ) reported the accuracy of the edge localization kv/kv pair to be within � . mm and � . °. it is also important to note that the airo’s localization accuracy included the motion of the robotic couch from treatment isocenter to the ct location. we suggest that ct scanner qa include addi- tional robotic couch tests to insure the airo’s localization accuracy is not adversely affected by robotic couch movement. based on this phantom study and initial commissioning, the airo can be used for accurate and reliable igpt. although other facilities have acquired mobile helical ct systems, such as the bodytom (neurologica corporation, danvers, ma, usa) and the aquilion lb (toshiba), our proton therapy facility is the first to acquire the airo mobile ct system for proton treatment local- ization. – we are also the first to use this technology for patient localization in a small-compact proton facility where space limitations exist. based on our study, the airo mobile ct system can be uti- lized for accurate and safe image-guided proton therapy. at the time of writing this manuscript, we have commissioned the system and begun clinical use of the system for treatment localization. our pre- liminary findings are that an additional – min of treatment time t a b l e measured ctdivol for airo helical ct and philips ct simulator for head and abdomen protocols. ctdivol (mgy) airo philips head . . abdomen . . t a b l e hu constancy (ctp ) for various materials in philips, edge, siemens and airo. philips (hu) edge (hu) airo (hu) siemens (hu) true (hu) acrylic . . . . air � . � . � . � . � polystyrene � . � . � . � . � ldpe � . � . � . � . � pmp � . � . � . � . � teflon . . . . ctp . . . . oliver et al. | are required to bring the scanner into the treatment room. future work will involve a time study for patient localization and evaluation scanning as well as characterization of the ct images as they relate to stopping power and ct number constancy for use in adaptive proton therapy. conclusions this work evaluated various image quality, localization accuracy, and dosimetric metrics of the airo and compared them to other com- mon modalities. based on our findings, we recommend that the airo mobile ct system can be applied clinically for safe and accu- rate image-guided proton therapy. conflict of interest there are no conflicts of interest. references . wen n, li h, song k, et al. characteristics of a novel treatment sys- tem for linear accelerator-based stereotactic radiosurgery. j appl clin med phys. ; : . . beltran c, pai panandiker a, krasin m, merchant t. daily image- guided localization for neuroblastoma. j appl clin med phys. ; : . . alvarado r, booth j, bromley r, gustafasson h. an investigation of image guidance dose for breast radiotherapy. j appl clin med phys. ; : . . fu l, perera h, ying x, yu y. importance of cbct setup verification for optical-guided frameless radiosurgery. j appl clin med phys. ; : . . sonier m, chu w, lalani n, erler d, cheung p, korol p. evaluation of kidney motion and target localization in abdominal sbrt patients. j appl clin med phys. ; : . . stanley d, papanikolaou n, gutierrez a. an evaluation of the stabil- ity of image-quality parameters of varian on-board imaging (obi) and epid imaging systems. j appl clin med phys. ; : . . unq n, wee l, hackett s, jones a, lim t, harper c. comparison of low-dose, half-rotation, cone-beam ct with electronic portal imaging device for registration of fiducial markers during prostate radiother- apy. j appl clin med phys. ; : . . yin f-f, wong j, balter j, et al. aapm therapy imaging committee task group , report no. ; . . li h, wu r, poenisch f, et al. clinical implementation of in room mobile ct for image guided proton therapy. med phys. ; : . . pham r, sun b, zhao t, et al. development of dose-based image guided proton therapy workflow. med phys. ; : . . moriya s, tachibana h, hotta k, et al. effectiveness of daily ct- based three-dimensional image guided and adaptive proton therapy. med phys. ; : . . zhao t, sun b, grantham k, et al. commissioning and initial experi- ence with the first clinical gantry-mounted proton therapy system. j appl clin med phys. ; : – . . weir vj, zhang j, bruner ap. dosimetric characterization and image quality evaluation of the airo mobile ct scanner. j xray sci tech- nol. ; : – . . doselab user manual version . : houston, tx: mobius medical sys- tems, lp; . . cody dd, pfeiffer d, mcnitt-gray mf, ruckdeschel tg, strauss kj, wilcox p. computed tomography: quality control manual. american college of radiology; . . amer a, marchant t, sykes j, czajka j, moore c. imaging doses from the elekta synergy x-ray cone beam ct system. br j radiol. ; : – . . lau skm, zhao x, carmona r, et al. frameless single-isocenter mod- ulated sterotactic radiosurgery for simultaneous treatment of multi- ple intracranial metastases. transl cancer res. ; : – . . landry g, nijhuis r, dedes g, et al. investigating ct to cbct image registration for head and neck proton therapy as a tool for daily dose recalculation. med phys. ; : – . . xu h, chetty i, wen n. analysis of systematic errors with d/ d image registration for target localization and treatment delivery in stereotactic radiosurgery. med phys. ; : . | oliver et al. diabetes care, volume , number , january o b s e rvat i o n s diabetes scre e n i n g practices among i n d i v i d u a l s a g e d ye a r s a nd o l d e r i n , the american diabetes associa- tion (ada) adopted new re c o m m e n d a- tions for screening the general popula- tion aged years for diabetes every years with an emphasis on those at high risk for undiagnosed diabetes ( ). few studies have examined the extent to which this screening has been adopted. this re p o rt describes the results of a telephone s u rvey of montana residents aged years to assess the diabetes screening prac- tices in this population. f rom october to december , the montana department of public health and human services conducted a random household telephone survey of montana residents aged years living in counties. respondents indicated whether they ever had been told by a physician that they had diabetes, the number of visits they made to a health care provider during the past year, their family history of dia- betes, whether they had ever been told they had high cholesterol and/or high blood pre s s u re, and their height and weight. respondents were asked the fol- lowing question to identify whether they had ever been screened for diabetes: “glu- cose or sugar is a substance found in your blood. have you ever had your blood glu- cose or sugar checked to see if you have diabetes?” when respondents re s p o n d e d “yes” to this question, they were asked to identify when screening was completed (“when was the last time your blood glu- cose or sugar level was measured by a health care professional?”). the re s p o n s e categories for this question included within the past year, within the past years, years ago, do not know/not sure, and refused to answer. pearson tests were used to assess associations between dia- betes screening and risk factors for dia- betes. logistical re g ression analyses were conducted to identify independent vari- ables associated with screening for diabetes during the past year. odds ratios ( % cis) were calculated. of the , respondents, ( . %) re p o rted that they had diagnosed diabetes. the remaining , respondents re p o rt e d that they did not have diagnosed diabetes and are included in the following analyses. of the respondents, % re p o rted a family h i s t o ry of diabetes, % re p o rted a bmi kg/m , % re p o rted having hyper- tension, and % re p o rted having high c h o l e s t e rol. excluding age, % of re s p o n- dents had one risk factor for diabetes, and % had two or more risk factors. of the , respondents without diagnosed dia- betes, % re p o rted that they had been s c reened for diabetes during the past year, % re p o rted screening from to years ago, and % re p o rted screening years ago or having never been scre e n e d . respondents who re p o rted being s c reened for diabetes during the past year w e re more likely to be age years and to have a family history of diabetes, two or m o re visits to a health care provider dur- ing the past year, hypertension, and high c h o l e s t e rol levels (table ). we found no association between recent screening and sex ( % men vs. % women), ameri- can indian ancestry ( % yes vs. % no), or bmi ( % kg/m vs. % kg/m ). respondents with three or m o re risk factors (e.g., aged years, american indian ancestry, family history of diabetes, hypertension, high choles- t e rol, or bmi kg/m ) were more likely to be screened for diabetes compared with respondents with only one risk factor ( vs. %, respectively). however, % of individuals with two risk factors for dia- betes and % of individuals with more than three risk factors had not been s c reened during the past years. based on logistical re g ression analysis, t h ree factors were associated with scre e n i n g for diabetes during the past year: two or m o re visits to a health care provider during the past year ( . [ % ci . – . ]), high cholesterol level ( . [ . – . ]), and family history of diabetes ( . [ . – . ]). respondents aged – years were less likely to re p o rt re c e n t s c reening than those aged years ( . [ . – . ] ) . a limitation of this assessment is that these data are self-re p o rted. pre v i o u s studies, however, have found that self- re p o rts of conditions such as diabetes and h y p e rtension are reliable ( , ). in addi- tion, the survey was conducted by tele- phone and does not re flect the experience of individuals in montana homes without t e l e p h o n e s . the findings suggest that diabetes s c reening is being adopted by physicians for individuals aged years at risk for diabetes and that the ada re c o m m e n d a- tions are being implemented in the general c o m m u n i t y. however, these data also indi- cate a need to develop strategies to encour- l e t t e r s table —characteristics of respondents aged years reporting screening for diabetes in montana in s c reening for diabetes past year – years years or never n age (years) – ( ) ( ) ( ) – ( ) ( ) ( ) ( )* ( ) ( ) family history of diabetes ye s ( )* ( ) ( ) n o ( ) ( ) ( ) visits to a health care provider during the past year ( )* ( ) ( ) ( ) ( ) ( ) h y p e rt e n s i o n ye s ( )* ( ) ( ) n o ( ) ( ) ( ) high cholestero l ye s ( )* ( ) ( ) n o ( ) ( ) ( ) data are n (%). *p . . diabetes care, volume , number , january letters age screening among all individuals at high risk for diabetes. todd s. harwell, mph jane g. smilie, ba janet m. mcdowall, rn, bsn steven d. helgerson, md, mph dorothy gohdes, md f rom the montana diabetes project, montana d e p a rtment of public health and human serv i c e s , helena, montana. a d d ress correspondence to todd s. harw e l l , mph, montana department of public health and human services, cogswell building, c- , p. o . box , helena, mt - . e-mail: t h a rw e l l @ s t a t e . m t . u s . a c k n o w l e d g m e n t s — this project was sup- p o rted through a cooperative agreement (u- / ccu- - ) with the centers for disease c o n t rol and prevention, division of diabetes translation, atlanta, georg i a . we thank linda priest and the staff mem- bers at northwest resource consultants for their work on the telephone surv e y. the contents of this letter are solely the responsibility of the authors and do not neces- sarily re p resent the official views of the centers for disease control and pre v e n t i o n . r e f e re n c e s . american diabetes association: screening for type diabetes. diabetes care (suppl. ): s –s , . kehoe r, wu sy, leske mc, chylack lt jr: comparing self-re p o rted and physician- re p o rted medical history. am j epidemiol : – , . jackson c, jatulis de, fortmann sp: the behavioral risk factor survey and the stan- f o rd five-city project survey: a comparison of cardiovascular risk behavior estimates. am j public health : – , h b a c is not recommended as a s c reening test for diabetes in cystic fibro s i s i n the june issue of diabetes care, h u n k e rt et al. ( ) recommend the use of h b a c for early detection of cystic fib ro- s i s – related diabetes (cfrd). their re c o m- mendation is based on the finding that mean hba c is slightly higher in cystic fib rosis (cf) patients requiring insulin t h e r a p y, compared with cf patients with i m p a i red or normal glucose tolerance. h o w e v e r, no data on the validity of this a p p roach for the diagnosis of asympto- matic diabetes in patients with cystic fib ro- sis are pre s e n t e d . our group has a long-standing intere s t in the early diagnosis of cfrd, comparing fasting blood glucose levels with oral glu- cose tolerance test results ( ). in our series, we have now cf patients with newly diagnosed diabetes based on a -h venous plasma glucose value mg/dl ( . mmol/l), and simultaneous determ i n a t i o n of hba c ( h i g h - p e rf o rmance liquid chro- matography method [pharmacia, erlan- gen, germany], normal range . – . %). only out of cf patients ( %) diag- nosed as diabetic according to the ameri- can diabetes association and world health o rganization criteria ( ) had an hba c value above the normal range (individual values . , . , . , and . %). in nine diabetic cf patients with normal hba c, values between . and . % were e n c o u n t e red (mean ± sd, . ± . %). the mean -h blood glucose value after inges- tion of oral glucose was not signific a n t l y d i ff e rent between diabetic cf patients with n o rmal hba c ( ± mg/dl, mean ± sd) and diabetic cf patients with elevated h b a c ( ± mg/dl, student’s t t e s t ) . these data clearly demonstrate that the d e t e rmination of hba c is not able to sub- stitute for the oral glucose tolerance test in the early diagnosis of cfrd. our fin d i n g s a re in agreement with several re p o rts in the l i t e r a t u re ( – ) as well as the consen- sus conference on cfrd ( ). in addition to its low sensitivity when used as a diagnos- tic tool for the detection of cfrd, the mea- s u rement of hba c has the disadvantage of considerable interassay variability and lack of standardization. there f o re, we stro n g l y advise against the use of glycosylated hemoglobin as a screening test for the early diagnosis of diabetes in patients with cystic fib ro s i s . reinhard w. holl, md christian buck, md christine babka, md anna wolf, md angelika thon, md f rom the department of pediatrics (r.w.h.), uni- versity of giessen, giessen; the department of pedi- atrics (c.bu., c.ba., a.w.), the university of ulm, ulm; and the medical school hannover (a.t. ) , h a n n o v e r, germ a n y. a d d ress correspondence to pd dr. reinhard w. holl, universitätskinderklinik giessen, feulgenstr. , d- giessen, germ a n y. r e f e re n c e s . h u n k e rt f, lietz t, stach b, kiess w: potential impact of hba c d e t e rm i n a t i o n on clinical decision making in patients with cystic fib ro s i s – related diabetes (let- ter). diabetes care : – , . holl rw, buck c, cario h, wolf a, thon a, heinze e, kohne e, debatin k-m: diag- nosis of diabetes in cystic fib rosis and tha- lassemia major. diabetes care : – , . the expert committee on the diagnosis and classification of diabetes mellitus: r e p o rt of the expert committee on the diagnosis and classification of diabetes mellitus. diabetes care : – , . lanng s, hansen a, thorsteinsson b, n e rup j, koch c: glucose tolerance in patients with cystic fib rosis: five year p rospective study. b m j : – , . deluca f, arrigo t, nibali sc, sferlazzas c, gigante a, dicesare e, cucinotta d: insulin secretion, glycosylated haemoglo- bin and islet cell antibodies in cystic fib ro- sis children and adolescents with diff e re n t d e g rees of glucose tolerance. h o rm metab r e s : – , . moran a, doherty l, wang x, thomas w: a b n o rmal glucose metabolism in cystic fib rosis. j pediatr : – , . moran a: highlights of the febru a ry consensus conference on cfrd. bonn, g e rm a n y, cystic fibrosis foundation, p ro gln p e roxisome p ro l i f e r a t o r- a c t i v a t e d r e c e p t o r- and o b e s i t y r istow et al. ( ) re p o rted an activating mutation in the peroxisome pro l i f- e r a t o r-activated re c e p t o r- g e n e ( p ro gln ppa r - ), which was pre s e n t in % ( of ) of obese and % ( of ) of nonobese german caucasians. these findings may have profound implica- tions, particularly if the presence of this variant and its association with obesity are c o n firmed in other populations. we perf o rmed polymerase chain re a c- t i o n – restriction fragment length polymor- phism analysis for the pro gln ppa r - variant as described ( ) on dna samples f rom several independent populations, including lean and obese caucasians fro m the baltimore, maryland, region; african- diabetes care, volume , number , january letters americans from jackson, mississippi, and forsyth county, north carolina; pima indians from arizona; and old ord e r amish from lancaster county, pennsylva- nia (table ). a pcr fragment corre s p o n d- ing to gastric insulinotropic peptide, which has two known restriction sites for h i n dii, was mixed with each sample as a positive control. among a total of sub- jects ( , alleles), the pro gln variant was not detected in a single subject. these findings were unexpected because there is substantial overlap of gene pools of caucasians from central e u rope and the baltimore and amish caucasians studied ( ). the germ a n caucasians studied by ristow et al. were said to be unrelated and re c ruited fro m the nord rh e i n - westfalen region, but they may be a genetic isolate whose gene pool does not re flect that of other caucasian populations. altern a t i v e l y, if the individ- uals carrying the mutation were re l a t e d , the true frequency of the pro g l n p pa r - variant may have been overe s t i- mated. the absence or very low fre- quency of this variant has also been doc- umented in danish ( ) and german ( ) populations. this study is the first, to our knowledge, to examine american popu- lations for this variant. in summary, the study by ristow et al. demonstrating that the pro g l n p pa r - variant is activating and can influence body weight in people is important. however, this variant appears to be absent or very r a re in the american populations studied. additional studies are re q u i red in other regions of europe and the u.s. to furt h e r d e fine the relevance of this intere s t i n g genetic variant to susceptibility to obesity. alan r. shuldiner, md william nguyen, bs w.h. linda kao, phd brock a. beamer, md ross e. andersen, phd richard pratley, md frederick l. brancati, md, phd f rom the department of medicine (a.r.s., w. n . ) , university of maryland school of medicine; the d e p a rtments of medicine (b.a.b., f.l.b.) and epi- demiology (w.h.l.k.), johns hopkins university school of medicine, baltimore, maryland; and the national institute of diabetes and digestive and kidney diseases (r.p.), national institutes of health, phoenix, arizona. a d d ress correspondence to alan r. shuldiner, md, professor and head, division of endocrinol- o g y, diabetes, and nutrition, department of medi- cine, university of maryland school of medicine, w. lombard st., room s- , baltimore, md . e-mail:ashuldin@medicine.umary l a n d . e d u . a c k n o w l e d g m e n t s — this study was sup- p o rted by nih r dk- , the american diabetes association, glaxowellcome, the b a l t i m o re geriatrics research and education clinical center of the baltimore ve t e r a n s administration medical center. r e f e re n c e s . ristow m, muller- wieland d, pfeiffer a, k rone w, kahn cr: obesity associated with a mutation in a genetic regulator of adipocyte diff e rentiation. n engl j med : – , . c a v a l l i - s f o rza ll, menozzi p, piazza a: t h e h i s t o ry of human genes. princeton univer- sity press, princeton, nj, . elk j, urhammer sa, sorensen ti, ander- sen t, auwerx j, pedersen o: homozygosity of the pro ala variant of the pero x i s o m e p roliferation-activated re c e p t o r- g a m m a ( p par-gamma ): divergent modulating e ffects on body mass index in obese and lean caucasian men. diabetologia : – , . mamann a, munzberg h, buttron p, busing b, hinney a, mayer h, siegfried w, hebe- brand j, greten h: missense variants in the human peroxisome pro l i f e r a t o r- a c t i v a t e d re c e p t o r-gamma gene in lean and obese subjects. eur j endocrinol : – , insulin secre t i o n , insulin sensitivity, and glucose e ffectiveness in nonobese individuals with va ry i n g d e g rees of glucose to l e r a n c e a lthough it is well known that insulin s e c retion, insulin sensitivity, and glu- cose effectiveness are impaired in type diabetic patients ( – ), little is known about the role of each of these fac- tors individually on the evolution of type diabetes. in this context, a major issue is that hyperglycemia per se impairs insulin s e c retion and insulin sensitivity and that obesity observed in type diabetic patients per se causes insulin resistance ( , ). to o v e rcome this problem, we studied u n t reated nonobese subjects classified as having normal glucose tolerance (ngt) (n = ; bmi . ± . kg/m [ r a n g e . – . ], mean ± sem), impaired glu- cose tolerance (igt) (n = ; bmi . ± . kg/m [ . – . ]), and type dia- betes (n = ; fetal bovine serum . ± . mmol/l [range . – . ], bmi . ± . k g / m [ . – . ]), based on the criteria of the world health organization ( ). they were normotensive and had norm a l renal, hepatic, and thyroid function. insulin sensitivity and glucose eff e c t i v e n e s s w e re estimated by the minimal model a p p roach ( – ). insulin secretion was e x p ressed as the area under the insulin c u rve between and min after an intra- venous glucose injection ( ). after the data w e re analyzed by one-way analysis of vari- ance, bonferroni correction was used to evaluate the diff e rences between any two of the three groups we studied ( ). no signifi- cant difference was observed in bmi among the three groups. compared with the subjects with ngt, the subjects with table —characteristics of subjects screened for pro gln ppa r - n ( a l l e l e s age ± sd f e m a l e bmi ± sd p o p u l a t i o n t y p e d ) ( y e a r s ) ( % ) ( k g / m ) c a u c a s i a n s b a l t i m o re longitudinal ( ) . ± . . . ± . study on aging johns hopkins we i g h t ( ) . ± . . . ± . management center amish, lancaster, pa ( ) . ± . . . ± . a f r i c a n - a m e r i c a n s a t h e ro s c l e rosis risk in ( ) . ± . . . ± . communities study pima indians a r i z o n a ( ) . ± . — . ± . all non-amish subjects were unrelated; amish subjects were not fir s t - d e g ree relatives of each other. diabetes care, volume , number , january letters igt had significantly lower insulin secre- tion ( , ± vs. , ± pmol l m i n , p = . ) and glucose eff e c- tiveness ( . ± . vs. . ± . m i n , p . ). insulin sensitivity index was lower in subjects with igt ( . ± . m i n pmol l) than in those with ngt ( . ± . min pmol l ) , but was not statistically significant (p = . ). in con- trast, disposition index calculated by the p roduct of insulin secretion and insulin sensitivity was significantly lower in sub- jects with igt ( , ± ) than in those with ngt ( , ± , p = . ). on the other hand, patients with type dia- betes had significantly lower insulin secre- tion ( ± pmol l m i n , p = . ) compared with subjects with igt. although no significant diff e rence was observed in insulin sensitivity index between subjects with type diabetes and igt ( . ± . vs. . ± . min pmol l, p = . ), disposition index was s i g n i ficantly diminished in type diabetic patients as compared with subjects with igt ( ± vs. , ± , p = . ). glucose effectiveness in type diabetic patients ( . ± . min ) was similar to that in subjects with igt ( . ± . m i n , p = . ) but was signific a n t l y lower than that in the subjects with ngt (p . ). from these results, the fol- lowing may be hypothesized: ) impair- ments in insulin secretion and disposition index and decreased glucose eff e c t i v e n e s s , but not insulin resistance, seem to consti- tute the basic characteristics of patients with igt or type diabetes in nonobese japanese populations. ) risk factors wors- ening to type diabetes in subjects with igt are associated with further impair- ments in insulin secretion and disposition index, but not associated with furt h e r derangement in glucose effectiveness in japanese populations. ataru taniguchi, md mitsuo fukushima, md masahiko sakai, md itaru nagata, md kentaro doi, md shoichiro nagasaka, md kumpei tokuyama, md yoshikatsu nakai, md f rom the first department of internal medicine ( a . t., m.s., i.n.), kansai-denryoku hospital, and the department of internal medicine, hoshida- minami hospital (m.f.), osaka; the second depart- ment of internal medicine (k.d.) and the college of medical technology (y.n.), kyoto university, kyoto; the department of internal medicine (s.n.), jichi medical college, tochigi; and the laboratory of biochemistry of exercise and nutrition (k.t. ) , tsukuba university, tsukuba, japan. a d d ress correspondence to ataru ta n i g u c h i , md, first department of internal medicine, kansai- d e n ryoku hospital, - - , fukushima-ku, fuku- shima, osaka city, osaka - , japan. e-mail: k @ k e p c o . c o . j p . r e f e re n c e s . b e rgman rn: to w a rd physiological under- standing of glucose tolerance: minimal- model approach. d i a b e t e s : – , . welch s, gebhart ssp, bergman rn, phillips ls: minimal model analysis of intravenous glucose tolerance test-derived insulin sensitivity in diabetic subjects. j c l i n endocrinol metab : – , . taniguchi a, nakai y, fukushima m, kawamura h, imura h, nagata i, tokuyama k: pathogenic factors re s p o n s i- ble for glucose tolerance in patients with niddm. d i a b e t e s : – , . nagasaka s, tokuyama k, kusaka i, hayashi h, rokkaku k, nakamura t, kawakami a, higashiyama m, ishikawa s, saito t: endogenous glucose pro d u c t i o n and glucose effectiveness in type diabetic subjects derived from stable-labeled mini- mal model approach. d i a b e t e s : – , . best jd, kahn se, ader m, watanabe rm, ni t-c, bergman rn: role of glucose eff e c- tiveness in the determination of glucose tol- erance. diabetes care : – , . rossetti l, giaccari a, defronzo ra: glu- cose toxicity. diabetes care : – , . taniguchi a, nakai y, doi k, fukuzawa h, fukushima m, kawamura h, to k u y a m a k, suzuki m, fujitani j, tanaka h, nagata i: insulin sensitivity, insulin secretion, and glucose effectiveness in obese subjects: a minimal model analysis. m e t a b o l i s m : – , . world health organization: diabetes melli - tus: report of a who study gro u p . g e n e v a , world health org., (tech. rep. ser. , no. ) . winer bj: statistical principles in experimen - tal design. nd ed. new york, mcgraw-hill, , p. – late-onset tro g l i t a z o n e - i n d u c e d hepatic dysfunction r e c e n t l y, iwase et al. ( ) re p o rted a case of liver dysfunction occurring after months of troglitazone therapy. because it was thought before this re p o rt that the risk of liver dysfunction with tro g l i- tazone after months was negligible, we wish to re p o rt another patient who took t roglitazone intermittently and developed hepatic dysfunction after months. a -year-old white man with type diabetes, ischemic heart disease (post angioplasty and stent placement), hyper- tension, degenerative joint disease, benign p rostatic hypert ro p h y, dyslipidemia, and g a s t roesophageal re flux disease had tro g l i- tazone mg daily added to his re g i m e n of glimeperide mg daily and metform i n mg b.i.d. because of poor glycemic c o n t rol (hba c . % [normal – %]). the other medicines he used were aspirin and pravastatin. after months of triple oral therapy, his hba c level dropped to . %, and, after months, to . %. after months, the patient’s hba c began to rise: . % at months, . % at year, and . % at months. liver function tests were normal until months, when his aspartate amino- transferase (ast) was found to be (nor- mal – u/l) and alanine aminotrans- ferase (alt) (normal – u/l). the t roglitazone regimen was discontinued, and testing for hepatitis b and c, h e m a c h romatosis, autoimmune liver dis- ease, and gallbladder disease were nega- tive. two months after discontinuing t roglitazone, the patient’s ast and alt had decreased to and u/l, and, after months, had re t u rned to normal at and u/l, re s p e c t i v e l y. his ast and alt have remained normal since then and he has continued to take pravastatin, aspirin, m e t f o rmin, and glimeperide. when the patient was told to discon- tinue troglitazone, he admitted that he had been taking it only interm i t t e n t l y. he esti- mated that he took the drug regularly at first, but after the first months, he took the drug only once or twice weekly on aver- age. he gave the following three reasons for his lack of compliance: a lack of funds, a fear of liver disease, and a tendency to avoid taking drugs whenever possible. this case, like the case described by iwase et al., illustrates that the hepatic dysfunction caused by troglitazone can occur after months and further sup- p o rts the u.s. food and drug administra- t i o n ’s current recommendation that quar- terly liver function tests should be obtained when troglitazone utilization extends beyond year ( ). in this case, could the onset of hepatic dysfunction have been delayed because the diabetes care, volume , number , january letters d rug was being taken only interm i t t e n t l y after the first months, and the estimated total load presented to the liver would be equivalent to the exposure at months in a compliant patient? we doubt this, since t ro g l i t a z o n e ’s hepatic effects are thought to be idiosyncratic and there f o re the total e x p o s u re should be irre l e v a n t . david s.h. bell, mb fernando ovalle, md f rom the division of endocrinology and metabo- lism, department of medicine, school of medicine, university of alabama, birmingham, alabama. a d d ress correspondence to david s.h. bell, mb, th ave. s., birmingham, al . d.s.h.b. and f.o. have served on an advisory panel for sankyo parke-davis and have received con- sulting fees, re s e a rch grant support, and honoraria for speaking engagements from sankyo parke-davis. r e f e re n c e s . iwase m, yamaguchi m, yoshinari m, oka- mura c, hirahashi t, tsuji h, fujishima m: a japanese case of liver dysfunction after months of troglitazone tre a t m e n t . diabetes care : – , . parke-davis, division of wa rn e r- l a m b e rt : rezulin package insert. morris plains, nj, g l y b u r i d e - i n d u c e d hemolysis in m y e l o d y s p l a s t i c s y n d ro m e g lyburide, also known as gliben- clamide, is a widely used sulfonylure a to treat patients with type diabetes. hemolytic anemia is an extremely rare side e ffect of which there have been only a few re p o rts ( – ). we describe a patient with myelodysplastic syndrome who pre s e n t e d with glyburide-induced hemolysis. a -year-old man with a long history of type diabetes presented with left foot cellulitis of week’s duration. this patient was known to have slowly pro g re s s i v e pancytopenia for years, for which no work-ups had been perf o rmed. his med- ications included the following: glyburide, mg per day, which he had taken for m o re than year; buformine, mg per day; and boglibose, . mg per day. he was afebrile, and the physical examination was normal, except for localized cellulitis on his left foot, for which he was start e d on intravenous antibiotics. the laboratory studies revealed a white blood cell count of . / l , hemoglobin . g/dl, platelet count /l, reticulocyte count . %, mean cor- puscle volume fl, moderate anisocyto- sis, fasting plasma glucose mg/dl, h b a c . %, lactate dehydrogenase iu/l, total bilirubin . mg/dl, and hapto- globin mg/dl. red cell glucose- - phosphate dehydrogenase level was ade- quate. cold agglutinin test, ham’s test, and sugar water test were normal. both dire c t and indirect coombs’ tests were negative. red cell resistance to osmolarity was mildly low (parpart ’s method). urinalysis demonstrated no urobilinogen. endo- scopic studies did not reveal gastro i n t e s t i- nal bleeding. ultrasonography of the abdomen showed no splenomegaly. the result of bone marrow aspiration was equivocal. on the basis of pre s u m p t i v e glyburide-induced hemolysis, glyburide was discontinued and the patient was switched to subcutaneous insulin on the seventh day. there a f t e r, his hemoglobin level increased to . g/dl, re t i c u l o c y t e count decreased to . %, and anisocytosis d i s a p p e a red pro m p t l y. he was discharg e d with insulin therapy after month in the hospital, which is when the cellulitis re s o l v e d . t h ree months later, his hemoglobin level was . g/dl and his haptoglobin remained low. repeated bone marro w aspiration confirmed the diagnosis of myelodysplastic syndro m e . we conclude that this patient devel- oped glyburide-induced hemolysis super- imposed on red cell fragility secondary to an underlying bone marrow disord e r. t h e re have been several re p o rts of hemoly- sis caused by sulfonylureas, most of which have been considered immune-mediated ( , , ). our case points to the possibility that glyburide could cause hemolysis by a non–immune-medicated mechanism. it is i m p o rtant to be aware of this potential side e ffect of glyburide in light of this medica- t i o n ’s widespread prescription, even though such a side effect is rare . hiroshi noto, md kazuhisa tsukamoto, md satoshi kimura, md f rom the department of diabetes and metabolism, tokyo university hospital, tokyo, japan. a d d ress correspondence to hiroshi noto, md, d e p a rtment of diabetes and metabolism, tokyo uni- versity hospital, - - hongo, bunkyo-ku, to k y o - , japan. e-mail: noto-tky@umin.ac.jp. r e f e re n c e s . nataas ob, nesthus i: immune haemolytic anaemia induced by glibenclamide in selective iga defic i e n c y. b m j : – , . abbate sl, hoogwerf bj: hemolytic ane- mia associated with sulfonylurea use. d i a - betes care : – , . meloni g, meloni t: glyburide-induced acute haemolysis in a g pd-defic i e n t patient with niddm. br j haematol : – , . kopicky ja, packman ch: the mechanism of sulfonylurea-induced immune hemoly- sis: case re p o rt and review of the literature . am j hematol : – , e ffects of exposure at an altitude of , m on p e rf o rmance of glucose meters s elf-monitoring of blood glucose is m a n d a t o ry for type diabetic p a t i e n t s who participate in sports to adjust insulin dose and carbohydrate ingestion ( ). sports also include activities p e rf o rm e d at moderately high altitudes, such as hiking or skiing. capillary blood glucose monitors (bgms) have been shown to underestimate blood glucose values at an altitude of , m ( ) and at a simulated altitude of , m with t e m p e r a t u re and humidity kept constant ( ). the aim of the present study was to assess the accuracy of two bgms at a moderately high altitude in which changes in temperature, humidity, and p o can result in errors in blood glucose d e t e rmination ( ). two bgms, the lifescan one touch ii (ot) (ortho diagnostics, milpitas, ca) and the glucometer elite ii (ge) (bayer diagnostics, brussels, belgium), were tested during a study on the effects of acute exposure at an altitude of , m and exercise on blood pre s s u re and albu- min excretion rate in six type diabetic p a t i e n t s . all subjects (four men and two women) were free of disease-related com- plications and in good and stable glycemic control (ghb . ± . %). all subjects gave their informed and written consent to participate in the study pro t o- col. all subjects were investigated both at diabetes care, volume , number , january letters sea level and after ascent by car and cable car to the angelo mosso institute at col d’olen ( , m altitude), gressoney la trinité, italy. at sea level and at a moderately high altitude, bgm reliability at diff e rent blood glucose levels was tested, and blood glu- cose was assessed in fasting and re s t i n g conditions at : a.m.; at : a.m. b e f o re an in-field exercise test; and imme- d i a t e l y, min, and min after the exer- cise stopped. capillary glucose was simul- taneously assessed with the ot and the ge. both of these bgms measure capillary blood glucose through the glucose oxi- d a s e - p e roxidase reaction. bgms were cali- brated at the beginning of each test ses- sion. a venous blood sample was simulta- neously drawn from the contralateral antecubital vein in a sodium fluoride tube, centrifuged, and stored at °c. plasma glucose was assayed with the glucose oxi- dase method (go) within days. this last assessment was taken as a re f e re n c e method. statistical analysis compare d bgm capillary glucose values and go plasma glucose values for each blood col- lection time. measurement linearity was tested with pearson’s correlation coeff i- cient. the mean of the diff e rences between the bgm and go results re p resents the mean bias between the methods with accuracy expressed as percent error (pe): pe (%) = bmg – go % g o the level of statistical significance was c o n s i d e red to be p . . the ge and ot measurements had a good correlation with plasma glucose both at moderately high altitude and at sea level. p e a r s o n ’s correlation coefficients were . and . for the ge and . and . for the ot at sea level and at moderately high altitude, re s p e c t i v e l y. biases between plasma glucose and bgm measure m e n t s w e re as follows: for the ge, . ± . at sea level and . ± . at moderately high altitude; for the ot, . ± . at sea level and . ± . at moderately high alti- tude. at sea level, both the ge and the ot tended to underestimate glucose values (ns); at moderately high altitude, the ge tended to overestimate and the ot tended to underestimate glucose values (ns). mean pes between plasma glucose and bgm m e a s u rements were . (ot) and . (ge) at sea level and . (ot) and . (ge) at moderately high altitude. pe tended to be higher for both bgms at moderately high altitude (ns). figures and show the bias between the single measurements with both devices at sea level and at moderately high altitude, re s p e c t i v e l y. at moderately high altitude (fig. ), the tendency of the ge to o v e restimate was more evident for low ( mg/dl) and intermediate ( – mg/dl) blood glucose values, whereas the ot tended to underestimate mainly high blood glucose values (ns). in our study, bgm perf o rmance was similar and good at sea level. at a moder- ately high altitude, a tendency to overe s t i- mate blood glucose for the ge and to u n d e restimate for the ot was observ e d . the overestimation for the ge involved mainly low ( mg/dl) and interm e d i- ate ( – mg/dl) blood glucose val- ues. this could present a problem in the p resence of symptoms suggesting hypo- figure —relationship between plasma and capillary glucose at sea level. figure —relationship between plasma and capillary glucose at moderately high altitude. lifescan one touch ii glucometer elite ii lifescan one touch ii glucometer elite ii diabetes care, volume , number , january letters glycemia and normal blood glucose val- ues. the ot tended to undere s t i m a t e mainly high blood glucose values, although its perf o rmance with low to i n t e rmediate values was good. the pre s- ent study assessed the accuracy of two bgms at a moderately high altitude in which changes in temperature, humidity, and po can result in errors in blood glu- cose determination ( ). our results are consistent with previous studies ( , ). the decrease in po could alter the sec- ond phase of the chromogen reaction and u n d e restimate blood glucose values ( ); on the other hand, an increase in atmos- pheric pre s s u re could overestimate blood glucose values ( ). in our study, minimal o v e restimation by the ge at low interm e- diate blood glucose values at moderately high altitude cannot be explained by the a l t e red po . an increase in hematocrit, which is known to alter blood glucose m e a s u rements with bgms ( ), may also occur after prolonged exposure to high altitude or as a consequence of dehydra- tion. although our study did not deter- mine hematocrit, the exercise test was s h o rt, and the patients were instructed to drink according to their thirst during the , -m exposure; there f o re, dehydration was not likely to have occurred. in con- clusion, bgm perf o rmance is similar and good at sea level. at a moderately high altitude similar to that experienced during winter skiing or summer hiking, a ten- dency to overestimate low to norm a l blood glucose values for the ge and to u n d e restimate high blood glucose values for the ot was observed. the bias is not clinically meaningful for either bgm, both of which can be safely used by dia- betic patients during exposure to moder- ately high altitudes. some care in the eval- uation of low and intermediate blood glu- cose values measured with the ge is n e v e rtheless re c o m m e n d e d . oriana pecchio, md simona maule, md marco migliardi, md marina trento, bsc massimo veglio, md f rom the italian alpine club medical commission ( o . p.); the department of internal medicine (m.t. ) , university of turin; the s. giovanni battista hospital (s.m.); and the department of endocrinology (m.m., m . v.), mauriziano umberto i hospital, turin, italy. a d d ress correspondence to dr. m. veglio, via mancini , torino, italy. e-mail: veglio@ o n w. n e t . r e f e re n c e s . h o rton es: role and management of exer- cise in diabetes mellitus. diabetes care : – , . g i o rdano bp, trash w, hollenbaugh l, dube wp: perf o rmance of seven blood glucose testing systems at high altitude. diabetes educ : – , . gautier jf, bigard ax, douce p, duvallet a, cathelinau g: influence of simulated alti- tude on the perf o rmance of five blood glu- cose meters. diabetes care : – , . b a rnett c, ryan f, ballonoff l: effect of altitude on the self monitoring of blood glucose (smbg) (abstract). diabetes (suppl.): a, . piepmeier eh, hammett-stabler c, price me, kemper gb, davis mg: atmospheric p re s s u re effects on glucose monitoring devices (letter). diabetes care : – , . b a rreau pb, buttery je: effect of hematocrit concentration on blood glucose value d e t e rmined on glucometer ii. diabetes care : – , c o m m e n t s a n d r e s p o n s e s deterioration of glycemic contro l after long-te rm treatment wi t h troglitazone in nonobese type diabetic patients t roglitazone is an oral antidiabetic d rug used to treat type diabetic patients with insulin re s i s t a n c e . troglitazone improves overall insulin sen- sitivity in the liver and skeletal muscles, which are the largest consumers and metabolizers of glucose in the body ( – ). recent re p o rts showed that troglitazone is also effective in nonobese type diabetic patients whose hyperglycemia could not be controlled with sulfonylurea therapy ( , ). however, we aware that in some patients in whom adequate glycemic con- t rol is obtained during the first several months of troglitazone treatment, their glycemic control deteriorates several months later. we assume that two distinct g roups of type diabetic patients exist who respond diff e rently to long-term administration of troglitazone, one gro u p that maintains a steady response and another group that has a decre a s i n g response after certain periods. in this s t u d y, we re t rospectively examined patients with type diabetes who were t reated with troglitazone for months and whose hba c levels had improved by % with troglitazone by month . in of the patients ( %), hba c levels increased by . % after – months despite continuous tro g l i t a z o n e t reatment (group p). in contrast, the rest of the patients experienced steady glycemic c o n t rol with . % of hba c flu c t u a t i o n ( g roup g). during the first months, h b a c levels decreased from means ± sem . ± . to . ± . % in group p and fro m . ± . to . ± . % in group g, re s p e c- t i v e l y. no significant diff e rences were evi- dent between the two groups re g a rding the d e c rease in hba c during the first months (fig. ). from month onward, hba c l e v- els in group p climbed gradually by . % a month up to the baseline level at month , but hba c levels were stable in group g t h roughout the treatment period. a signifi- cant diff e rence in hba c levels was evident during months – (p . ) . among clinical characteristics, gro u p p had a significantly lower bmi ( . ± . vs. . ± . kg/m , p . ) and s i g n i ficantly lower fasting insulin levels ( . ± . vs. . ± . µu/ml, p . ). of the patients with a bmi of kg/m ( %), exhibited deteriora- tion of glycemic contro l . in this study, we re p o rt a group of patients who showed a renewed decline in glycemic control after long-term tre a t m e n t with troglitazone. these results seemed to suggest a secondary failure of tro g l i t a z o n e . our study demonstrates that this drug is indeed useful for a long-standing obese i n s u l i n - resistant diabetes but not for a nonobese type diabetes. yuko murase, md takanobu wakasugi, md kunimasa yagi, md hiroshi mabuchi, md f rom the department of internal medicine (y. m . , t. w.), fukui perfectural hospital; and the second d e p a rtment of internal medicine (k.y., h.m.), kanazawa university, ishikawa, japan. a d d ress correspondence to yuko murase, md, the second department of internal medicine, kanazawa university, - takara-machi, kanazawa, ishikawa - , japan. e-mail: diabe@med. k a n a z a w a - u . a c . j p . diabetes care, volume , number , january letters r e f e re n c e s . suter sl, nolan jj, wallace p, gumbiner b, olefsky jm: metabolic effects of new oral hypoglycemic agent cs- in niddm subjects. diabetes care : – , . o’rourke cm, davis ja, saltiel ar, corn i- celli ja: metabolic effects of troglitazone in the goto-kakizaki rat, a non-obese and n o rmolipidemic rodent model of nonin- sulin-dependent diabetes mellitus. m e t a b - o l i s m : – , . troglitazone study group: the metabolic e ffects of troglitazone in non-insulin dependent diabetes (abstract). d i a b e t e s (suppl. ): a, . mori k: the effect of troglitazone in combi- nation with sulfonylurea in non-insulin dependent diabetes mellitus (abstract). j japan diabetes soc (suppl. ): , . h o rton es, venable tc, whitehouse f, the troglitazone study group, ghazzi mn, whitcomb rw: troglitazone in combina- tion with sulfonylurea re s t o res glycemic c o n t rol in patients with type diabetes. diabetes care : – , figure —change from baseline in hba c. values are means ± sem. wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ doi: . / am. j. hum. genet. : – , behavioral genetics ’ understanding the genetic basis of mood disorders: where do we stand? victor i. reus and nelson b. freimer center for neurobiology and psychiatry, department of psychiatry, university of california, san francisco, san francisco introduction as the predominant feature of the syndrome. in most current diagnostic systems, mood is viewed as carrying in this issue of the journal, sherman et al. ( ) de- greater heuristic and practical value than other signs and scribe the promise of genetic approaches for understand- symptoms that might also be present, such as anxiety, ing human behavior and point out a number of obstacles cognitive impairment, or alteration in vegetative func- to realization of this promise; these include the method- tions (american psychiatric association ). epidemi- ological challenge of identifying genes for complex traits ological studies have provided strong support for a ge- and the societal challenge of appropriately using the netic component in the etiology of these disorders information that will be gained if such genetic-mapping (tsuang and faraone ), particularly in comparison efforts are successful. genetic-mapping studies in hu- with other classes of mental illness. however, as noted mans rest on the premise that traits of interest can be above, our current categorical classification of psychiat- reduced to one or more discrete phenotypes and that ric disorders, although reliable, lacks demonstrated etio- these phenotypes result, at least in part, from particular logic validity. it is thus by no means certain that distur- alleles at susceptibility loci of reasonably large effect. as bance of mood represents the best indicator of common discussed in this review, abundant evidence suggests that genetic etiology for this class of conditions. for example, severe bipolar mood disorder (bp) fulfills this premise major depressive disorder (mdd), the most common better than other human behavioral traits (tsuang and mood disorder, is conceptualized as distinct from panic faraone ; escamilla et al. ). the diagnosis of disorder (pd), a common anxiety syndrome, although bp is highly reliable, and its delineation as a distinct two-thirds of patients with pd also will have a lifetime syndrome has proved to be clinically useful in predicting diagnosis of mdd (breier et al. ), and comorbidity course and response to treatment (goodwin and jami- between the two syndromes is common (kendler et al. son ). however, one must keep in mind that this ; coryell et al. ). psychiatric disorders are, diagnostic category, like all psychiatric classifications, is of course, not unique in this regard, and similar issues based on operational criteria (derived from a combina- regarding the etiologic validity of diagnostic constructs tion of epidemiological and clinical observations), rather also complicate genetic mapping of many medical disor- than on any anatomical or physiological evidence. this ders. fact differentiates psychiatric disorders from other etio- the list of mood disorders most commonly includes logically complex categories of disease, such as hyper- mdd, dysthymic disorder (a more chronic but generally tension or diabetes mellitus. in this review we discuss less severe depressive disorder), bp (in which episodes our current understanding of the genetic basis of bp and of major depression alternate with mania), cyclothymic other mood disorders and indicate how our body of disorder (characterized by many episodes of brief and/ knowledge has been influenced by different approaches or less severe depressions alternating with symptoms of to the definition of disease phenotypes. mild mania (hypomania)), and mood disorders due to a the term ‘‘mood disorders’’ encompasses a group of general medical condition or induced by substance conditions in which a disturbance of mood is recognized abuse. bp is divided further into bp-i (mdd and severe mania) and bp-ii (mdd and hypomania), and both of these categories also often are referred to as ‘‘manic- received april , ; accepted for publication april , . depressive illness.’’ the degree to which these diagnosesaddress for correspondence and reprints: dr. victor i. reus, center are related genetically or are distinct entities is currentlyfor neurobiology and psychiatry, department of psychiatry, univer- sity of california, san francisco, parnassus avenue, san fran- unknown (tsuang and faraone ; pauls et al. ; cisco, ca - . e-mail: vir@itsa.ucsf.edu spence et al. ). this uncertainty has impeded efforts this article represents the opinion of the authors and has not been to construct realistic models for linkage analysis of bp. peer reviewed. furthermore, although most (but not all) genetic-map-� by the american society of human genetics. all rights reserved. - / / - $ . ping studies treat mood disorders and thought disorders / a a$$ju - - : : ajhga uc-ajhg am. j. hum. genet. : – , (notably schizophrenia) as independent entities, a sub- were conducted § decades ago, using (a) phenotype- assignment methods that currently would not be widelystantial number of individuals are afflicted with schizo- affective disorder, in which disturbances in thought pro- accepted and (b) diagnostic categorizations that differ from those employed in almost all recent genetic-map-cesses are as prominent as the mood alteration (escamilla et al. ). ping studies. an example is the study by bertelsen et al. ( ), discussed above, which has had a substantial influence on current views regarding the genetic basis ofgenetic epidemiology of mood disorders mood disorders. the determination of phenotype in that investigation derived from an unstructured psychiatricuncertainty regarding the etiologic relationship be- tween bp and other psychiatric disorders has not been interview conducted by a single individual; in contrast, most current investigators would accept diagnostic-in-resolved by a large number of family, twin, and adoption studies aimed at evaluating the degree of familial aggre- terview data only if these were collected by standardized interviews. additionally, the findings of bertelsen et al.gation and heritability of various mood disorders. nev- ertheless, although family studies of bp, conducted over ( ) were based on diagnostic criteria different than those currently in use — for example, combining individ-a period of several decades, have utilized several differ- ent designs, including varying definitions of what consti- uals with hypomania and individuals with mania into the same category. reexamination of epidemiologicaltutes bp, they consistently have demonstrated familial aggregation of both severe and mild mood disorders. studies such as that by bertelsen et al. ( ) further emphasizes the special difficulty of psychiatric genetics;one of the most striking findings of these studies has been that bp shows far greater familial aggregation than there is inherent subjectivity in recording even individual behavioral features, let alone in determining categoricalother mood disorders. for example, weissman et al. ( ) observed a relative risk for bp of almost , diagnoses that change over time. this fact makes the delineation of affected status in current studies as prob-compared with a relative risk of Ç . for mdd. simi- larly, twin studies have indicated a higher heritability lematic as the proper interpretation of past data. it is not likely that we will attain a more refined ap-for bp, compared with that for other forms of mood disorder. for example, the classic twin study by bertel- proach for diagnostic classification of mood disorders until we begin to identify the genes that underlie riskson et al. ( ), utilizing the danish twin registry, indicated a concordance rate, for narrowly defined bp, for these disorders. from that point we may learn to make distinctions finer than are now possible betweenof . for mz twins, versus . for dz twins (as op- posed to . and . , respectively, for major depression). different classes of mood disorders and also may dis- cover that particular (and currently unexpected) pheno-although most epidemiological studies suggest that some cases of mdd probably are genetically related to typic features are etiologically related to one another. such use of genetics to redefine phenotypic categoriesbp, only inconclusive results have been obtained from efforts to identify particular mdd subtypes that are has, of course, been one of the most tangible results of positional cloning of genes responsible for relativelymost likely to reflect a shared genetic etiology with bp (goodwin and jamison ). simple disorders. such diagnostic refinement, however, will not be possible for mood disorders unless the cur-it is instructive to compare the evidence showing the high degree of heritability of narrowly defined bp to rently available classification schemes will permit us to first map the responsible genes. genes for several pheno-that for either of the traits used for illustrative purposes by sherman et al. in this issue of the journal — namely, typically complex (nonpsychiatric) disorders have now been mapped. success in mapping such traits usuallyschizophrenia and emotional stability; for example, the mz concordance rate of . for bp (bertelsen et al. has depended on the delineation of narrowly defined phenotypes that are most likely to share common genetic ) compares with an mz concordance rate of . for schizophrenia (results from several studies, pooled causation, as determined by examination of the findings of genetic-epidemiological studies (mcinnes and freimerby sherman et al.). the calculated heritability of bp has been estimated at . (tsuang and faraone ), ; escamilla et al. ). these examples could be used to guide our approach to genetic-mapping investi-compared with . – . for emotional stability (as com- piled by sherman et al.). gations of mood disorders; although the epidemiological studies of these syndromes are imperfect, they clearlysherman et al. point out that twin studies have a num- ber of inherent limitations and that their results there- suggest that severe bp (i.e., bp-i) should be considered such a narrowly defined phenotype.fore should be interpreted cautiously. such caution is particularly warranted for psychiatric disorders, because genetic mapping studies of mood disorderof the special complexities that we already have noted. relatively little attention has been paid to the fact that the effort to map genes for bp may have attracted more scrutiny from the scientific and general media thanthe majority of twin studies of psychiatric syndromes / a a$$ju - - : : ajhga uc-ajhg reus and freimer: behavioral genetics ’ has the search for genes responsible for any other human order amish community suggest possible sml inheri- tance only for bp-i, not for other mood disorders (paulstrait. remarkably, several cycles of misplaced excite- ment and exaggeration of failure were widely reported et al. ). these studies should not be interpreted as supporting sml inheritance of bp (craddock et al.before a single study had even attempted to screen the entire genome for linkage to bp. in fact, the initial series ; spence et al. ), but they clearly indicate that such a model is unlikely for broadly defined mood disor-of studies suggesting localization of bp genes on chro- mosomes (among the old order amish) and x ders. despite these observations, many (but not all) sub- sequent linkage studies have continued to focus on data(among non-ashkenazi israeli jews) were reported at a time when the available genetic markers permitted sets in which a high proportion of the genetic informa- tion derives from individuals with diagnoses other thanevaluation of linkage across only a tiny fraction of the entire genome (baron et al. ; egeland et al. ) bpi. efforts continue to attempt to identify forms of mood disorder that reflect a common genetic etiologyand when linkage had only been demonstrated for a handful of diseases, all with clear-cut mendelian trans- with bp; these remain unsuccessful (blacker et al. ). beginning in the early s, the availability of highlymission. these initial linkage studies were predicated on two broad assumptions: first, that relatively simple polymorphic microsatellite markers had a major impact on genetic-linkage studies for bp. several groups re-mendelian models could account for the transmission of an enormous range of mood-disorder phenotypes and, ported single suggestive localizations for bp genes, loci based on testing multiple markers in several locationssecond, that the power of linkage approaches was suffi- ciently great that bp genes could be identified even if but not, however, on complete screening of the genome. these studies utilized mainly cosmopolitan collectionsthe first assumption was incorrect. with the benefit of hindsight it is obvious that such preconceptions were of pedigrees from north america and europe. examples of these results include possible bp localizations on chro-naive, although it should be noted that the results of the studies, particularly that of the amish study, were mosomes q (straub et al. ), in the pericentro- meric region of (berrettini et al. ), on pwidely accepted until follow-up examination of the same pedigrees failed to support the original findings (mcin- (ewald et al. ), and on p (kelsoe et al. ). the results of berrettini et al. ( ) have attracted particu-nes and freimer ). it became clear that investigators had failed to account for uncertainty in the assignment lar attention, because they have been supported by an independent investigation using a different set of northof phenotypes; for example, the fall in the evidence for linkage on chromosome in the amish was due largely american pedigrees (stine et al. ). the results sup- porting bp linkage in the pericentromeric region of chro-to the development of mood disorder in two previously unaffected individuals whose marker genotypes in this mosome are confined largely to families in which bp appears to be inherited through the paternal lineage.chromosome region differed from those of the originally affected family members (kelsoe et al. ). addition- this intriguing observation has suggested the possibility of a parent-of-origin effect. it is unclear what mechanismally, the majority of the linkage information in both the amish and israeli studies derived from individuals with would account for such a finding; however, it may be noteworthy that this region contains one of the mostdiagnoses other than classic bp — for example, unipolar mdd (baron et al. , ; egeland et al. ; dramatic instances, in the genome, of suppression of male recombination relative to female recombinationkelsoe et al. ). as indicated above, it already had been known, from family studies, that the relative risk (silverman et al. ). several recently reported linkage studies of bp differfor bp was substantially greater than that for mdd (weissman et al. ) and, from twin studies, that the from previous ones in three important respects: ( ) link- age analysis is focused primarily on individuals withheritability of bp was substantially greater than that for mdd (bertelsen et al. ). severe mood disorder (bp-i only in ginns et al. ; mcinnes et al. ; and bp-i and bp-ii in blackwoodsubsequent to these initial ‘‘follow-up’’ linkage stud- ies, additional efforts have been made to evaluate the et al. ) ( ) the bulk of information for linkage is derived from affected, rather than from apparentlydegree to which the inheritance patterns of various forms of mood disorder are consistent with the models unaffected, individuals (blackwood et al. ; ginns et al. ; mcinnes et al. ). ( ) results can beused in most linkage studies — that is, the assumption that the action of a single major locus (sml) is involved. interpreted in the light of complete screening of the ge- nome in the relevant study populations (blackwood etspence et al. ( ), in the largest such study, have shown in a british columbian sample that, although al. ; ginns et al. ; mcinnes et al. ). what do these studies tell us? in the study by black-there is good evidence for sml inheritance of bp (in particular, of bp-i), the evidence argues against sml wood et al. ( ), an argument could be advanced for statistically significant linkage to chromosome p. thisinheritance for mdd and other psychiatric disorders. even more strikingly, segregation analyses of the old result was limited to a single extended scottish pedigree / a a$$ju - - : : ajhga uc-ajhg am. j. hum. genet. : – , and was not found in other pedigrees from the same prove spurious. in this respect the results of genome- screening studies of bp are roughly comparable to thosepopulation. additionally, the evidence for linkage de- pended on the inclusion of bp-ii individuals. ginns et recently observed for other complex traits, such as insu- lin-dependent diabetes mellitus and multiple sclerosisal. ( ), in a new analysis of the old order amish, identified regions on chromosomes , , and in (davies et al. ; hashimoto et al. ; ebers et al. ; haines et al. ; kuokkanen et al. ;which excessive allele sharing among affected individu- als suggest the possible location of loci for bp-i suscepti- sawcer et al. ). some commentators have suggested that the difficulties and uneven rate of progress inherentbility. none of these possible localizations, however, attain statistical significance. mcinnes et al. ( ), in in mapping genes for complex traits are somehow partic- ular to bp, perhaps because of the glib references thata study of two extended pedigrees from the genetically homogenous population of costa rica, identified possi- can be made to the euphoria of apparent success and the dysphoria of apparent failure (morell ; rischble localizations for bp-i in several chromosomal re- gions, notably p, p, and q. the q localization and botstein ). such publicity may have the unfor- tunate result of generating undue pessimism, among thewas supported by identification of extremely long haplo- types shared by most of the affected individuals in both scientific community and the general public, regarding the possibility of ultimately elucidating the genetic basisfamilies, including several alleles that are very rare in the general costa rican population (freimer et al. ). in of bp and other mood disorders. the costa rican study the linkage evidence also did not attain statistical significance. each of these reports, how- societal implications ever, identifies regions of the genome that require more intensive study. in two cases (blackwood et al. ; even if, in the near future, one or more susceptibility genes for bipolar disorder are identified, it will be diffi-freimer et al. ), the suggested linkage findings are accompanied by extended marker haplotypes in the ma- cult, as sherman et al. point out, to know how to utilize such information clinically. the societal stigma of bipo-jority of affected individuals within the relevant pedi- grees. these haplotypes indicate that the designated re- lar disorder and other psychiatric conditions, as well as their variable course, make it likely that the problemsgions are identical by descent (ibd) among affected individuals; since each of these studies draws on subjects already identified in the genetic testing of other common complex diseases, such as breast cancer and colon can-from genetically homogeneous populations, there is the possibility of testing whether these regions are shared cer, will be multiplied when genetic testing in psychiatric disorders becomes feasible. the opportunity exists,ibd by other (apparently unrelated) patients from the same populations. this opportunity also offers the hope however, to identify the salient issues and to plan for the day when genetic risk of psychiatric illness can bethat the region of ibd sharing can be narrowly deline- ated on the basis of the expectation that more distantly assessed reliably. for example, our group has surveyed individuals with mood disorder, their friends and rela-related affected individuals will share small regions ibd, as a result of recombination over several generations tives, and health-care providers, to explore the implica- tions of genetic testing in bipolar disorder (smith et al.that separate them from their common ancestor(s). ulti- mately it may be possible, by use of such isolated popu- ). we have observed that reproductive decisions and attitudes toward presymptomatic testing in childrenlations, to define, for bp loci, candidate regions suffi- ciently narrow to permit positional cloning of causative differ markedly between consumer groups and health- care providers and that they depend greatly on presumedgenes. it is unlikely that a single major susceptibility gene severity of illness and the availability of as yet undeter- mined preventive strategies that might ameliorate theexists that is responsible for a high proportion of bp cases in all populations. how, then, should we interpret severity or course of illness. individuals who are likely to pursue genetic testing may find it difficult to acceptthe fact that several genome-screening studies have high- lighted multiple possible chromosomal regions that the inherent uncertainty in the prediction of genetic risk and may misinterpret the information in such a way ascould contain bp-susceptibility genes? genetic-mapping studies of complex traits may be viewed as a highly to adversely affect their own and/or other family mem- ber’s life experiences. in our study, psychiatric physi-iterative process, in which initial genome-screening stud- ies serve to propose hypotheses to be tested through cians were much more likely to endorse termination of a pregnancy than were either patients and support-groupadditional investigation (mcinnes et al. ). ac- cording to this view, one does not expect the explosive members or medical students, if informed of a probable fetal inheritance of bipolar disorder. this difference inprogress toward gene identification that has character- ized the study of simple mendelian traits (jamison and interpretation of data was particularly evident in scenar- ios in which the likelihood of developing bp disordermcinnis ), and we can anticipate that many (if not most) of the currently suggested bp localizations will was high and in which the course of illness was severe. / a a$$ju - - : : ajhga uc-ajhg reus and freimer: behavioral genetics ’ cr, hostetter am, et al ( ) bipolar affective disorderssurprisingly, patients and support-group members ex- linked to dna markers on chromosome . nature :pressed greater interest in genetic testing than did psychi- – atrists, even when it was assumed that no prophylactic escamilla ma, freimer nb, reus vi ( ) the genetics oftreatment existed. the need for further study of attitudes bipolar disorder and schizophrenia. in: rosenberg rn,toward mood disorders is clear. it most likely will be at prusiner sb, dimauro s, barchi rl (eds) the molecular and least a few years before genes for bp are identified. this genetic basis of neurological disease, d ed. butterworth- provides us an opportunity to investigate systematically heinemann, boston, pp – the societal implications of the ability to determine ge- ewald h, mors o, flint t, koed k, eiberg h, kruse ta ( ) netic risk for this disorder — before the reality is thrust a possible locus for manic depressive illness on chromosome upon us. p . psychiatr genet : – freimer nb, reus vi, escamilla ma, mcinnes la, spesny m, leon p, service sk, et al ( ) genetic mapping using haplotype, association and linkage methods suggests a locusreferences for severe bipolar disorder (bpi) at q -q . nat genet : – american psychiatric association ( ) diagnostic and sta- tistical manual of mental disorders, th ed. american psychi- ginns ei, ott j, egeland ja, allen cr, fann cs, pauls dl, weissenbach j, et al ( ) a genome-wide search for chro-atric, washington baron m, freimer n, risch n, lerer b, alexander jr, straub mosomal loci linked to bipolar affective disorder in the old order amish. nat genet : – re, asokan s, et al ( ) diminished support for linkage between manic depressive illness and x-chromosome mark- goodwin fk, jamison kr ( ) manic-depressive illness. oxford university press, new yorkers in three israeli pedigrees. nat genet : – baron m, risch n, hamburger r, mandel b, kushner s, new- haines jl, ter-minassian m, bazyk a, gusella jf, kim dj, terwedow h, pericak-vance ma, et al ( ) a completeman m, drumer d, et al ( ) genetic linkage between x-chromosome markers and bipolar affective illness. nature genomic screen for multiple sclerosis underscores a role for the major histocompatibility complex. nat genet : – : – berrettini wh, ferraro tn, goldin lr, weeks de, detera- hashimoto l, habita c, beressi jp, delepine m, besse c,wadleigh s, nurnberger ji jr, gershon es ( ) chromo- some markers and manic-depressive illness: evidence for cambon-thomsen a, deschamps i, et al ( ) genetic mapping of a susceptibility locus for insulin-dependent dia-a susceptibility gene. proc natl acad sci usa : – betes mellitus on chromosome q. nature : – jamison kr, mcinnis mg ( ) genetic studies of manic-bertelsen a, harvald b, hauge m ( ) a danish twin study of manic-depressive disorders. br j psychiatry : – depressive illness. nat med : – kelsoe jr, ginns ei, egeland ja, gerhard ds, goldstein am,blacker d, faraone sv, rosen ae, guroff jj, adams p, weiss- man mm, gershon es ( ) unipolar relatives in bipolar bale sj, pauls dl, et al ( ) re-evaluation of the linkage relationship between chromosome p loci and the gene forpedigrees: a search for elusive indicators of underlying bipo- larity. am j med genet : – bipolar affective disorder in the old order amish. nature : – blackwood dh, he l, morris sw, mclean a, whitton c, thomson m, walker mt, et al ( ) a locus for bipolar kelsoe jr, sadovnick ad, kristbjarnarson h, bergesch p, mroczkowski-parker z, drennan m, rapaport mh, et alaffective disorder on chromosome p. nat genet : – ( ) possible locus for bipolar disorder near the dopamine transporter on chromosome . am j med genet : –breier a, charney ds, heninger gr ( ) major depression in patients with agoraphobia and panic disorder. arch gen kendler ks, heath ac, martin ng, eaves lj ( ) symp-psychiatry : – coryell w, endicott j, andreasen nc, keller mb, clayton pj, toms of anxiety and symptoms of depression: same genes, different environments? arch gen psychiatry : – hirschfeld rm, scheftner wa, et al ( ) depression and panic attacks: the significance of overlap as reflected in fol- kuokkanen s, sundvall m, terwilliger jd, tienari pj, wiks- trom j, holmdahl r, pettersson u, et al ( ) a putativelow-up and family study data. am j psychiatry : – vulnerability locus to multiple sclerosis maps to p -p in a region syntenic to the murine locus eae . nat genetcraddock n, vaneerdewegh p, reich t ( ) single major locus models for bipolar disorder are implausible. am j med : – mcinnes la, escamilla ma, service sk, reus vi, leon p, silvagenet : davies jl, kawaguchi y, bennett st, copeman jb, cordell s, rojas e, et al ( ) a complete genome screen for genes predisposing to severe bipolar disorder in two costa ricanhj, pritchard le, reed pw, et al ( ) a genome-wide search for human type diabetes susceptibility genes. na- pedigrees. proc natl acad sci usa : – mcinnes la, freimer nb ( ) mapping genes for psychiat-ture : – ebers gc, kukay k, bulman de, sadovnick ad, rice g, ric disorders and behavioral traits. curr opin genet dev : – anderson c, armstrong h, et al ( ) a full genome search in multiple sclerosis. nat genet : – morell v ( ) manic-depression findings spark polarized debate. science : – egeland ja, gerhard ds, pauls dl, sussex jn, kidd kk, allen / a a$$ju - - : : ajhga uc-ajhg am. j. hum. genet. : – , pauls dl, bailey jn, carter as, allen cr, egeland ja ( ) spence ma, flodman pl, sadovnik ad, ameli h, remick ra ( ) single major locus models for bipolar disorder arecomplex segregation analyses of old order amish families ascertained through bipolar i individuals. am j med genet implausible — response. am j med genet : – spence ma, flodman pl, sadovnick ad, bailey-wilson je, : – risch n, botstein d ( ) a manic depressive history. nat ameli h, remick ra ( ) bipolar disorder: evidence for a major locus. am j med genet : – genet : – sawcer s, jones hb, feakes r, gray j, smaldon n, chataway stine oc, xu j, koskela r, mcmahon fj, gschwend m, frid- dle c, clark cd, et al ( ) evidence for linkage of bipolarj, robertson n, et al ( ) a genome screen in multiple sclerosis reveals susceptibility loci on chromosome p and disorder to chromosome with a parent-of-origin effect. am j hum genet : – q . nat genet : – sherman sl, defries jc, gottesman ii, loehlin jc, meyer jm, straub re, lehner t, luo y, loth je, shao w, sharpe l, alexander jr, et al ( ) a possible vulnerability locuspelias mz, rice j, et al ( ) recent developments in human behavioral genetics: past accomplishments and future direc- for bipolar affective disorder on chromosome q . . nat genet : – tions. am j hum genet : – (in this issue) silverman ga, overhauser j, gerken s, aburomia r, o’con- tsuang mt, faraone sv ( ) the genetics of mood disor- ders. johns hopkins university press, baltimorenell p, krauter ks, detera-wadleigh sd, et al ( ) report of the fourth international workshop on human chromo- weissman mm, gershon es, kidd kk, prusoff ba, leck- man jf, dibble e, hamovit j, et al ( ) psychiatricsome mapping: boston, massachusetts, october – , . cytogenet cell genet : – disorders in the relatives of probands with affective dis- orders: the yale university – national institute of mentalsmith lb, sapers b, reus vi, freimer nb ( ) attitudes towards bipolar disorder and predictive genetic testing health collaborative study. arch gen psychiatry : – among patients and providers. j med genet : – / a a$$ju - - : : ajhga uc-ajhg wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ predictors of negative exercise echocardiography in women with positive exercise electrocardiograms jacc march , abstracts - cardiac function and heart failure a pacmg at each pacing site did not improve lv diastolic function. conclusion: lvp and bvp improved lv systolic function in patients with heart failure regardless of the baseline rhythm. in patients with af, only bvp improved lv diastolic function. these results indicate that bvp may be more beneficial than single-site lvp in patients with heart failure and af. groups #of patients exercise duratlon(min) met’s peak hr + spect, . * . . f . f % cl +spect, . * . . a . ’ * < % cl - spect, . f . ll.li . * so% cl -spect, . * . ’ . * . ” * < % cl poster session exercise testing: cardiac rehabilitation monday, march , , noonq:oo p.m. mccormick place, hall a presentation hour: :oo p.m.- :oo p.m. - predictors of negative exercise echocardiography in women with positive exercise electrocardiograms amish j. desai, amogh bhat, dallit bagha, mrudula guthikonda, ezra a. amsterdam university of california, davis medical center, sacramento, ca background: exercise (ex) electrocardiography (ecg) is the most widely used non- invawe test for evaluating symptoms suggestive of coronary artery disease (cad). in women. however, ex ecg has limited reliability due to an increased rate of false positive results. therefore, a stress-imaging study is frequently the initial test for evaluation of chest pal” in women. we have previously reported that certain exercise test variables predict a negative ex echocardlogram (echo). to further enhance this predictive value, we report additional exercise test variables predictive of negative ex echo. methods we analyzed the results of simultaneous ex echo and ex ecg in women with no known cardiac disease es part of the initial evaluation for chest pain suggestive of cad. all patients (pts) had a normal resting ecg and adequate exercise capacity by his- tory. all tests were symptom-limited utilizing a bruce protocol. a positive ex echo was defined es an ex-induced regional wall motion abnormality and a positive ex ecg was defined as ex-induced .o mm st segment depression - msec after the j point. results: the study group comprised consecutive women (mean age years [ - ) evaluated by simultaneous ex echo and ex ecg. ex echo was positive i” % ( / ) and negative in % ( / ). ex ecg was positive in % ( / ) and negative in % ( ). in % ( / ) pts with a positive ex ecg, ex echo was negative, suggesting a false positive ex ecg. in this group of pts, non-echo ex test data associated with a negative ex echo included: mets, double product z. . , st depression cl. mm, no ex-induced chest pain, st segment resolution . , no inducible ischemia occurred more ( % vs. %), with % predicted maximum heart rate more ( % vs. %) often in functionally impaired women (p=o.o ); despite similar disease prevalence. in conclusion, among women referred for coronary angiography for suspected myocar- dial ischemia, marked functional impairment estimated by a simple estimate of functional capacity is associated with an adverse prognosis. use of the dasi prior to exercise stress testing may stratify candidates for exercise testing or pharmacologic stress. ll w . .year event rates % < . . - . . - . > . p value dascestimated mets . exercise mets . l-l - high treadmill workload in patients with exercise- induced st depression predicts a negative result on exercise echocardiography amish j. desai. amogh bhat, daljit bagha. mrudula guthikinda, ezra a. amsterdam, university of california, davis medical center, sacramento, ca background although exercise (ex) electrocardiography (ecg) is the most com- monly employed initial test to assess patients with symptoms suggestive of coronary artery disease (cad), it has limited diagnostic accuracy. therefore, patients (pts) with positive tests for myocardial ischemia are frequently referred for further evaluation by noninvasive stress imaging such as ex echocardiography (echo). a negative ex echo is considered evidence of absence of high risk cad and of low clinical risk. it has recently been shown that functional capacity is a strong predictor of prognosis. thus, in a group of pts with positive ex ecg but high treadmill workload, we investigated the results of sec- ondary evaluation by ex echo.methods we analyzed the results of consecutwe pts ( males, females; mean age yrs [ - ) referred for ex echo after a posi- tive ex ecg and a treadmill workload of mets. all pts had a normal resting ecg. exercise tests utilized a bruce protocol and were symptom-limited. a positwe ex ecg was defined as ex-induced .o mm st segment depression - msec after the j point and a positive ex echo was defined by an ex-induced regional wall motion abnor- mality. results: ex echo was negative in % ( / ) of pts and positive in % ( / ). conclusions: ex ecg performed to a high workload is highly predictive of a negative ex echo and thus low prognostic risk in pts referred because of positive ex ecg. pts with st depression on ex ecg, who achieve at least mets during treadmill ex. may not require additional noninvasive or invasive evaluation. - impact of obesity on inflammation and metabolic syndrome in coronary patients and effects of cardiac rehabilitation carl j. lavie, richard v. milani,ali morshedi, ochsner clinic foundation, new orleans, la background: obesity is epidemic in the us and represents a major risk factor for cad and type ii diabetes. limited data, however, exist on the eflects of obesity on such risk factors es inflammation and components of the metabolic syndrome (ms) es defined by atp ill in cad patients, and the effects of cardiac rehabilitation and exercise training programs &ret) in these patients. a comparison of periodontal disease among rural amish and non-amish adults j clin periodontol ; : - printed in denmark . all rights reserved copyright © murtksgaard clinical pencdontbioiy issn - a comparison of periodontal disease among rural amish and non-amish adults robert a. bagramian\ mahassen m. farghaly\ dennis lopatin\ maryfran sowers^ salam a. syed^ and julie l. pomerville^ ^school of dentistry, university of michigan; ^school of public health, university of michigan, ann arbor, michigan - bagramian ra, farghaly mm, lopatin d, sowers mf, syed sa and pomerville jl: a comparison of perio dont cd disease among rural amish and non-amish adults. j clin periodontol ; : - . © munksgaard, . abstract. periodontal disease can be more efficiently studied within a homogene- ous population where genetic influences and lifestyles are similar enough to negate their effect on the disease process. this study focuses on an amish population in southern michigan who isolate themselves from outside influences and their non-amish neighbors. a total of amish and non-amish were contacted resulting in amish and non-amish who were examined in their homes giving a participation rate of . %. ages ranged from to years. prevalence of periodontal disease tended to be higher among males and increased with age. there were slightly more amish females ( %) than non-amish ( %). means of periodontal conditions for amish were . mm for attachment loss, . mm for pocket depth, . for calculus, . for plaque and . for gingivitis. for non-amish, the means were . mm for attachment loss, . mm for pocket depth, . for calculus, . for plaque and . for gingivitis. it is of interest that the amish do not practice routine oral hygiene. only . % of amish reported brushing at least x a day compared to . % of non-amish. similarly, only . % of amish reported flossing at least x a week compared to . % of non-amish. key words: amish; periodontai disease; prevalence; epidemiology; attachment ioss. accepted for pubiication juiy the amish in this study isolate them- selves from the outside world by living without electricity, telephones, or auto- mobiles and marrying within their society. as reported previously (bagra- mian et al. ), the amish maintain a secluded lifestyle as a result of religious values established in the th century in switzerland. the extent of isolation and self-sufficiency of the amish com- munity is demonstrated by the existence, of amish schools, which children attend to th grade. only a few of the amish, %, in this study completed high school in public schools. households of or more comprising extended family mem- bers are common (mckusick , hos- tetler ). this secluded population provides a unique opportunity to inves- tigate the impact of a variety of factors on prevalence of periodontal disease. low levels of periodontal disease found among the amish in pilot studies (bagramian et al. ) formed the basis for the present intensive study. our pre- vious paper assessed dental examin- ations conducted on an amish farming community during the -year period - . the purpose of this paper is to report periodontal disease data col- lected for amish (â = ) and non- amish controls (â = ) over the entire -year period, - , assessments of behavior, attitudes toward oral hygiene, and knowledge of periodontal disease are examined along with various meas- ures of periodontal disease. iviethods amish farms are interspersed with non- amish farms in the area targeted for this study. a map of the amish community identified amish and non-amish farms. letters were mailed to all area residents informing them of our study and sol- iciting participation. the populations were approached in as similar a fashion as possible. for amish respondents, several steps were involved in gaining entry into individuals' homes to conduct the interview and exam. the st entry point was the religious leaders called bishops. each bishop has responsibility for apprixmately amish families and has ultimate authority over access to amish. after receiving a bishop's ap- proval, the team was able to contact individual families, where the nd entry point was the head of the household. once the household head agreed, the investigators were free to solicit partici- pation of individual family members. since amish participants were re- cruited door-to-door, non-amish were also recruited door-to-door. every non- amish house was approached to ensure the sample was as similar to the amish as possible. unhke the amish, these in- periodontal disease and amish dividuals could be accessed directly. sol- icitations were made during the evening as well as the daytime to avoid biasing the sample. a total of adult amish men and women over years of age were con- tacted and of these, were examined, giving a . % response rate. of the non-amish contacted, responded, a response rate of . %. all subjects were reimbursed for participation and no dental treatment was provided. con- ditions similar to the field were used to calibrate examiners to a reference periodontist, and x-statistics between each of the examiners were calculated for level of agreement on attachment loss and pocket depth. for attachment loss the xs ranged from . to . , and for pocket depth, they ranged from . to . , well within the limits in other studies and national surveys (brown et al. ). electricity was not available in homes, requiring examinations to be performed with a battery operated head light and portable dental chair. meas- urements were taken from standard sites of all existing teeth except rd mo- lars: distal-buccal, mid-buccal, mesio- buccal, disto-lingual, mid-lingual and mesio-lingual. the following indices were included: silness & loe ( ) plaque index, loe & silness ( ) gin- gival index, ramijord ( ) calculus index, and modified ramfjord ( ) pdi for pocket depth and attachment loss measurements. a hu-friedy no. periodontal probe was employed to measure loss of periodontal attachment and pocket depth to the nearest milli- meter. a -h, comprehensive questionnaire was administered by a trained inter- viewer. items regarding demographic characteristics, former health problems, current medications, allergies, tobacco use, frequency of physician visits, and family oral health history provided an overall picture of the respondents' gen- eral health. oral health attitudes and practices were probed through a series of questions on the respondent's oral health history, recent dental care, daily oral hygiene habits and satisfaction with dental services. the -page instrument was pre-tested on adult patients at the university of michigan school of den- tistry over a -week period. internal validity was checked through repetitive questions with altered wording or a re- verse response and modified. a knowledge score was computed based on questions that evaluated the respondent's ability to define peri- odontal disease. an index of oral hy- giene was also created from questions dealing with brushing, flossing, rinsing, and periodontal disease. severity of periodontal disease was examined to identify differences for amish compared to controls by ident- ifying the proportion of people with ^ site at various disease levels (kingman et al. ) and by assessing whole- mouth means. disease was delineated as having ^ tooth with mm of attachment loss or mm of pocket depth or a mean greater than . mm attachment loss or . mm pocket depth. logistic regression was applied to de- termine the relationship between ex- planatory variables: age, gender, amish or non-amish, oral health care; knowl- edge of periodontal disease, whether or not the person had mean plaque or mean gingivitis scores > or mean cal- culus scores > ; and presence or ab- sence of disease. each explanatory vari- able was entered into the model sequen- tially to determine the extent of any additional impact on the model ability to predict the probability of disease. in- teractions between explanatory vari- ables were also entered into the model. variables that did not show a significant dependent relationship with indepen- dent variables, as evidenced by the p- values for the wald / - statistic, were dropped from the model. this iterative process resulted in identification of ex- planatory variables that significantly re- late to periodontal disease. odds ratios were calculated. results amish respondents were younger ( % under ) than non-amish ( % were under ) and less educated; % had a th grade education compared to %) of non-amish. there were slightly more female amish ( %) than males ( %). gender for non-amish was almost evenly spht with %o female and % male. a larger proportion of non-amish had a full dentition at all age levels ex- cept for ages - years (tables , ). while %o of amish age - years had a full dentition, %o of non-amish at this age had all of their teeth. simi- larly, only %o of amish over years had a full dentition while %) of non- amish of this age had all of their teeth. the mean number of teeth present, however, differed little except for the age group - years, where the mean was . for amish and . for non- amish. mean attachment loss for amish was . mm while mean pocket depth was . mm. for non-amish, the means were slightly lower: . mm for attach- ment loss and . for pocket depth. mean calculus scores were low with an overall mean of . for amish and . for non-amish. plaque and gingivitis means showed somewhat higher levels but were still relatively low: . and . for amish and . and . , re- spectively, for non-amish. among amish, females had lower attachment loss levels than males at every age except the youngest. gingi- vitis and plaque showed similar age- and gender-related increases, while the change in pocket depth levels was not as dramatic. for amish, attachment loss rose from . mm at - years to . mm at age years and above (table ). for non-amish, attachment loss levels increased consistently with age from . mm at - years to . at age and above (table ). the distributions for oral hygiene practices and knowledge of periodontal disease showed significant differences between amish and non-amish respon- dents. given their secluded life style, the amish performed as expected, scoring lower than non-amish on the identifi- tabie , % distribution of numbers of teeth and mean number of teeth by age among amish age group (years) - - no. teeth - - + in= ) - - - + mean no. of teeth . . . . . . . . . . . . . . . . . . . . . . . . . bagramian et al. table . % distribution of numbers of teeth and mean number of teeth by age among non-amish no. teeth - - o : ^ , v . : : : • • : ; • . , + mean no teeth - ( v= ) . . . . . - . , , , . - . , , , - (tv= ) . . . . . + (/v= ) , , . . . table . mean periodontal disease measures by age among amish index plaque calculus gingivitis pocket depth attachment loss - ( y v = i i i ) . . . . . - (yv= ) , . , , , age group (years) - (a'= ) , , , , , - (a^= ) , . . , , + ( v= o) , , . , , total (a^= ) , . . , , table . mean periodontal disease measures by age among non-amish index plaque calculus gingivitis pocket depth attachment loss - ( v= ) . . . . . - (yv= ) , , , , , age group (years) - (a'= ) , , , , , - (/v= ) , . , , , + (yv= ) , , , , . total ( v= ) . . . . , table . % distribution for attachment loss of ^ mm by age for amish and non-amish attachment loss amish non-amish age (years) mm mm mm mm "a, n n n - - - + , , , , , , , , , , , , , , , , total , , , , cation and prevention of periodontal disease. % of the non-amish sample provided the correct response to knowledge questions while only % of the amish could. over -/^ of amish indi- cated incorrectly that cavities were in- dicative of periodontal disease and that widening of spaces between teeth was not an indicator. it is important to point out that this lack of knowledge is evi- dent in the reported oral hygiene prac- tices of amish, who show low behav- ioral scores when asked about actual practices. table shows that the proportion of persons with mm or more of attach- ment loss rose with age, as expected. a greater proportion of amish had mm of attachment loss at every age level. the overall difference in the proportion of respondents with ^ tooth at the mm level was % for amish and % for non-amish. logistic regression showed a high risk for attachment loss of mm for respon- dents who were amish, male, older, had calculus, and knew little about the signs of gum disease (/?< . , table ). for pocket depth of mm, the best-fitting model includes amish, older, male, having calculus, and having gingivitis as significant risk factors. the odds ratios presented in table show age as being the highest risk factor of mm of attach- ment loss. for pocket depth, the greatest risk is among those with gingivitis. behavior, plaque, and interactions between the independent variables did not reach statistical significance in the final model for attachment loss or pocket depth. however, when factors related to having gingivitis, calculus, or plaque were examined, interactions and behavior were important. the signifi- cant risk factors for plaque are being amish, older, having little knowledge about the signs of periodontal disease, and the interaction between amish and behavior (table ). significant factors related to having gingivitis are being amish, older, having little knowledge about the signs of periodontal disease, behavior, and the interactions between amish and knowledge of the signs of periodontal disease. no factors were significantly related to having calculus. when whole mouth means were examined, being amish, age, and gender (male) were significantly related to attachment loss. these variables con- stituted the entire set of independent variables for the final model. for mean pocket depth, having gingivitis, being amish, age, and male were significant risk factors. discussion the amish settlements in michigan present an exceptional opportunity to study demographic factors and behav- iors associated with periodontal disease. amish homes are interspersed among non-amish, thus reducing environmen- tal influences not related to genetics or life-style on the disease process. the amish and controls in this study were predominantly farmers. the examination of different meas- ures of periodontal disease in this study indicates that an assessment of severity when measured as the presence of ^ site at a specific disease level, yields more information than an assessment of whole-mouth means (burt ). only amish, gender, and age were significant- ly related to mean levels of attachment periodontal disease and amish table , odds ratios for periodontal disease amish gender age (years)* - - -t- plaque calculus gingivitis behavior disease knowledge attachment odds ratio . j . . . . . . . . loss ̂ mm p . . . . . . . . . . pocket d e p t h s odds ratio . . . . . . . . n / a n / a mm p . . . . . . . . n / a n/a reference group was respondents - years old. tabie , odds ratios for plaque and gingivitis amish gender age (years)* - - -f behavior knowledge score interactions: amish / behavior amish/knowledge plaque odds ratio . . . . . . . . . p . . . . . . . . . gingivitis odds ratio . . . . . . . . . p . . . . . . . . . reference group was respondents - years old. loss and pocket depth, whereas severity measured at ^ site at a specific level showed additional factors as being sig- nificant predictors. amish respondents reported lower education levels, scored lower on knowledge of signs of periodontal dis- ease, and reported less oral health care than non-amish. the difference in dis- ease levels, although statistically signifi- cant, is clinically small. overall, amish respondents had only . mm more attachment loss and . mm rnore pocket depth than non-amish. differ- ences in plaque, gingivitis, and calculus were also small. both measures of periodontal dis- ease, attachment loss of mm or pocket depth of mm, assessed among amish and non-amish respondents, demon- strated the expected relationships with age and gender. the odds of having attachment loss of mm were higher among persons with calculus and those who knew httle about the signs of peri- odontal disease. the highest odds ratio for pocket depth of ^ mm was for persons with gingivitis. this may be due to inflammation that occurs with gingi- vitis. a pocket may be measured deeper by the examiner if the area around the tooth is swollen due to gingivitis. calcu- lus showed the nd highest odds ratio for pocket depth. calculus is formed over a longer period of time than plaque and gingivitis; thus, it is not surprising that calculus was the only measure of the that was a strong predictor of attachment loss and pocket depth. the high odds ratio between having gingivitis or plaque and being amish reflect the low behavior score among the amish (table ). it is interesting to note that behavior was not statistically significant for attachment loss or pocket depth and was significant in the plaque and gingivitis models. levels of plaque and gingivitis in the mouth are affected by brushing or flossing, whereas the connection between oral hygiene and pocket depth or attachment loss is not as straightforward; these results are thus in line with current thought that con- siders plaque and gingivitis separate entities from the more advanced disease of attachment loss (williams ). oral health care and knowledge about the signs of periodonta] disease were significant risk factors for having plaque along with the interaction effect of oral health care and being amish. the gingivitis model was similar with being amish, male, high behavior score, high knowledge score, and the interac- tion between being amish and knowl- edge of periodontal disease as signifi- cant. the modest differetices between am- ish and non-amish oral health were in- teresting given the dramatic differences in oral hygiene practice and knowledge of periodontal disease. a lack of knowl- edge may well lead to a lack of dental care which is expected to lead to peri- odotital disease and missing teeth. this study of oral health indicates amish have slightly more disease than non- amish, which is in line with the reported lack of knowledge of periodontal dis- ease and poor oral hygiene practices among amish. acknowledgement this work was supported by the na- tional institute of dental research grant r deo - . zusammenfassung ein vergleich von parodontalerkrankungen zwischen erwachsenen der landlichen amisch- und nicht-amisch bevolkerung parodontalerkrankungen konnen besser in- nerhalb einer homogenen population unter- sucht werden, in der genetische einflusse und lebensgewohnheiten ahnlich genug sing, um keine auswirkung auf den erkrankungspro- zeb zu haben. diese studie konzentriert sich auf eine amisch-bevolkerung im stiden mi- chigans, die sich selbst auberen einflussen gegeniiber isoliert und ihren nicht-amisch nachbarn. insgesamt wurde mit amisch und nicht-amisch kontakt aufgenom- men. das ergebnis war, dab amisch und nicht-amisch bei sich zuhause unter- sucht wurden, wodurch sich eine teilnahme- rate von . % ergab. das alter lag zwischen und jahren. die pravalenz der par- odontalerkrankung tendierte dazu, bei man- nern hoher zu sein und im alter zuzunehmen. es gab etwas mehr weibliche amisch- ( %) als nicht-amisch ( %) -teilnehmerinnen. die mittelwerte fiir den parodontalen zu- stand ftir die amisch-bevolkerung waren . mm ftir attachmentverlust, . mm fiir taschentiefe, . fur zahnstein, . fiir pla- que und . fiir gingivitis. fiir die nicht- amisch-bevolkerung waren die mittelwerte . mm fiir attachmentverlust, . mm fur taschentiefe, . ftir zahnstein, . fiir pla- que und . fur gingivitis. es ist von inter- esse, dab die amisch keine regelmabige mundhygiene durchfuhren. nur , % der bagramian et al. amisch berichteten, dab sie wenigstens ein- mal pro tag putzen, im vergleich zu . % der nicht-amisch. auch berichteten nur . der amisch, dab sie zahnseide wenigstens einmal pro woche verwenden, im vergleich zu . % der nicht-amisch. r e s u m e , - • . '•;, •' ••• • • . • ; - . " " > ' ^ . comparaison de la maladie parodontale chez des adultes dans des populations rurales amish et non-amish l'etude de la maladie parodontale peut etre plus efficace si elle est faite au sein d'une population homogene ou les styles de vie et les influences genetiques sont suffisamment uniformes pour annuler ieur effet sur le pro- cessus pathologique. la presente etude est centree sur une population amish du sud du michigan qui s'isole des influences exterieu- res et de leurs voisins non-amish. on a pris contact avec au total amish et non- amish, ce qui a permis d'examiner amish et non-amish a ieur domicile, obtenant ainsi un taux de participation de . %. leur age allait de a ans. la prevalence de la maladie parodontale tendait a etre plus elevee chez les sujets du sexe masculin et augmentait avec l'age. ii y avait un peu plus de sujets du sexe feminin amish ( %) que non-amish ( %). les moyennes des parametres paro- dontaux chez les amish etaient , mm pour la perte d'attache. , mm pour la profon- deur des poches, , pour le tartre, , pour la plaque et . pour la gingivite. chez les non-amish. ces moyennes etaient . mm pour la perte d'attache, , mm pour la profondeur des poches, , pour le tartre, , pour la plaque et , pour la gingivite, ii est interessant de noter que les amish ne pratiquent pas de soins reguliers d'hygiene bucco-dentaire, chez les amish, . % seule- ment disaient se brosser les dents au moins une fois par jour, contre . 'mi chez les non- amish. de meme, . '/o des amish seulement disaient utiliser le fil dentaire au moins une fois par semaine. contre , 'm) des non- amish, references bagramian, r. a,, farghaly, m,, lopatin, d, e., sowers, m. f., syed, s. a. & pomervil- le, j, l. ( ) periodontal disease in an amish population. journal of clinical peri- odontology , - . bagramian, r. a., narendran, s. & khavari, a. m. ( ) oral health status, knowl- edge, and practices in an amish popula- tion. journal of public health dentistry , - , beck, j, d , lainson, p a., field, h. m. & hawkins, b. f. ( ) risk factors for vari- ous levels of periodontal disease and treat- ment needs in iowa. community dentistry and oral epidemiology , - . brown, j. l., oliver, r. c. & loe, h. ( ) evaluating periodontal status of us em- ployed adults. journal american dental association , - . brown, l. j., oliver, r. c. & loe, h. ( ) periodontal diseases in the u,s, in : prevalence, severity, extent, and role in tooth mortality. journal of periodontology , - , burt, b. a., ismail, a. i., morrison, e, c, & beltran, e, d ( ) risk factors for tooth loss over a -year period. journal of den- tal research , - . epidemiology and oral disease prevention program n ( ) oral health of united states adults: the national survey of oral health in us employed adults and seniors, - : regional findings. nih publi- cation no, - , epidemiology and oral disease prevention program n ( ) oral health of united states adults: the national survey of oral health in us employed adults and seniors, - : national findings, nih publi- cation no, - . hostetler, j. a. ( ) amish society, rd edi- tion, baltimore, md: john hopkins uni- versity press. ismail, a. i., morrison, e. c , burt. b. a,, caffesse, r, g, & kavanagh, m, t. ( ) natural history of periodontal disease in adults: fmdings from the tecumseh peri- odontal disease study, - . journal of dental research , - . kingman, a., morrison, e., loe, h. & smith, j. ( ) systematic errors in esti- mating prevalence and severity of peri- odontal disease. journal of periodontal re- search , - . loe, h., age, a., hans, b. & martyn, s. ( ) the natural history of periodontal disease in man. the rate of periodontal destruction before years of age. journal of periodontology , - . loe, h., anerud, a., boysen, h. & morrison, e. ( ) natural history of periodontal disease in man: rapid, moderate and no loss of attachment in sri lankan laborers to years of age. journal of clinical periodontology , - , loe, h. & silness, j. ( ) periodontal dis- ease in pregnancy (i). prevalence and se- verity. acta odontologica scandinavica , - , mckusick, v, a, ( ) the amish. endeavor , - . ramijord, s. p ( ) the periodontal dis- ease index (pdi). journal of peri- odontology >^, - , sillness, j. & loe, h. ( ), periodontal dis- ease in pregnancy (ii). correlation be- tween oral hygiene and periodontal con- dition. acta odontologica scandinavica , - , williams, ray c, ( ) periodontal disease. the new england journal of medicine , - . address: r. a. bagramian department of periodontics/prevention and geriatrics school of dentistry, university of michigan ann arbor, michigan - supported by national institue of dental research. roi de - usa news.fm full terms & conditions of access and use can be found at https://www.tandfonline.com/action/journalinformation?journalcode=iern expert review of neurotherapeutics issn: - (print) - (online) journal homepage: https://www.tandfonline.com/loi/iern new autism genetic risk factors identified to cite this article: ( ) new autism genetic risk factors identified, expert review of neurotherapeutics, : , - , doi: . / . . . to link to this article: https://doi.org/ . / . . . published online: jan . submit your article to this journal article views: view related articles https://www.tandfonline.com/action/journalinformation?journalcode=iern https://www.tandfonline.com/loi/iern https://www.tandfonline.com/action/showcitformats?doi= . / . . . https://doi.org/ . / . . . https://www.tandfonline.com/action/authorsubmission?journalcode=iern &show=instructions https://www.tandfonline.com/action/authorsubmission?journalcode=iern &show=instructions https://www.tandfonline.com/doi/mlt/ . / . . . https://www.tandfonline.com/doi/mlt/ . / . . . news in brief – highlights from the latest news and research in neurotherapeutics . / . . . © future drugs ltd issn - www.future-drugs.com new autism genetic risk factors identified us researchers identify a hereditary and nonhereditary risk factor for autism in recent reports, two separate genetic defects have been shown to be associated with autism. one of the defects, caused by spontaneous deletion or duplication of a segment of chromosome , has been shown to be present in approxi- mately % of autistic children. three independent groups have also reported an association between the contactin- associated protein-like (cntnap ) mutation on chromosome and autism. published online in the new england journal of medicine, the autism consor- tium, a multicenter team, reported a -fold increased risk of developing autism in people who had deletions or duplications of a specific segment of chromosome , region p . . the mutations were found in autistic chil- dren but not their parents, suggesting that the mutation is spontaneous. the group used a high-resolution genomic copy-number variant analysis to examine chromosomes from families in which there was at least one autistic member as well as from people without the disorder. deletions or duplications in p . were found in of peo- ple from families with at least one autistic member, compared with only two of , people without the disorder. large instances of noninherited chro- mosomal abnormalities are extremely rare, as mark daly, lead author of the study commented. “finding precisely the same deletion in such a significant proportion of patients suggests that it is a very strong risk factor for autism.” the group is now attempting to iden- tify the specific gene or genes involved in the mutation. in three independent studies, published online in the american journal of human genetics, researchers have confirmed an association between cntnap , a gene previously identified in four amish chil- dren in , and risk of autism, in much larger samples. aravinda chakravarti, of the johns hopkins university school of medi- cine, who led one of the studies, explained their results. “we found a fac- tor that is probably present in every autistic kid. but while it may be neces- sary, it is not sufficient by itself to cause the disease.” “finding precisely the same deletion in such a significant proportion of patients suggests that it is a very strong risk factor for autism.” “cntnap is an excellent candidate gene for autism,” chakravarti com- mented. “it encodes a protein that’s known to mediate interactions between brain cells and that appears to enable a crucial aspect of brain-cell development. a gene variant that altered either of these activities could have significant impact.” in another of the studies, erik puffen- berger and colleagues built on their pre- vious finding in amish children. he commented. “this is a very exciting step for autism research. it also highlights the enormous potential of the ‘small science’ approach. our initial work used only four affected amish children. careful study of these four patients uncovered the association between cntnap and autistic behaviors. from that small beginning, cntnap has now been implicated as a significant risk factor for autism.” finally, matthew state and colleagues identified a rare mutation in the same gene that was associated with autism and appeared to be inherited. “this conver- gence of rare and common variants in autism is unusual, but reinforces the growing consensus among genetics researchers that both types of changes in dna sequence are going to be important contributors,” state commented. dietrich stephen, author of an accom- panying commentary, is extremely posi- tive about the findings and hopes that it may be possible to develop a diagnostic test for the cntnap mutation. “the field of genetics is replete with examples where researchers are unable to repro- duce results. here we have independent confirmation in multiple groups using large samples sizes,” he commented. “now that the results of the initial cntnap gene finding have been rep- licated, it strongly supports the notion that the ‘broken version’ of cntnap is recognized as a cause of autism in the general population,” he added. sources: weiss la, shen y, korn jm et al. association between microdeletion and microduplication at p . and autism. n. engl. j. med. ( ) (epub ahead of print); alarcón m, abrahams bs, stone jl et al. linkage, association, and gene-expression analyses identify cntnap as an autism-susceptibility gene. am. j. hum. genet. ( ), – ( ); arking de, cutler dj, brune cw et al. a common genetic variant in the neurexin superfamily member cntnap increases familial risk of autism. am. j. hum. genet. ( ), – ( ); bakkaloglu b, o’roak bj, louvi a et al. molecular cytogenetic analysis and resequencing of contactin associated protein-like in autism spectrum disorders. am. j. hum. genet. ( ), – ( ); stephan da. unraveling autism. am. j. hum. genet. ( ), – ( ). http://www.future-drugs.com k.rowland text box for reprint orders, please contact:
reprints@future-drugs.com expert rev. neurotherapeutics ( ), ( ) news in brief psychiatric comorbidity shown to be very common a recent study finds that the number of psychiatry outpatients who suffer from more than one psychiatric disorder is extremely high published in the february, , issue of psychological medicine, researchers from rhode island hospital (ri, usa) interviewed psychiatry outpatients to assess a wide range of psychiatric disorders. the majority of the patients tested were found to have two or more disorders, and more than one third of the patients suffered from at least three disor- ders. the average number of current diagnoses per patient was . . patients with a principal diagnosis of post-trau- matic stress disorder or bipolar disorder had the highest mean number of current comorbid disorders. for almost half of the outpatients, major depressive disorder was the reason for seeking treatment. about % of the patients suffered from social phobia; but % of these diagnoses came from initial treatment for another disorder. “…clinicians should assume that in outpatients presenting for the treatment of mood or anxiety problems, the patients have more than one diagnosis.” the lead author of the paper, mark zimmerman, director of outpatient psychiatry at rhode island hospital and associate professor of psychiatry and human behavior at brown medical school (ri, usa) commented, “for dis- orders like social phobia that are infre- quently diagnosed as the principle disor- der in clinical practice, it will be important for the next generation of treatment-efficacy studies to determine if treatment is effective when the disorder is a comorbid condition.” the authors also hope that these results will encourage clinicians to check for comorbidity in psychiatric outpatients, as zimmerman explained, “based on the results of this study, clinicians should assume that in outpatients presenting for the treatment of mood or anxiety prob- lems, the patients have more than one diagnosis.” source: zimmerman m, mcglinchey jb, chelminski i, young d. diagnostic co-morbidity in psychiatric out-patients presenting for treatment evaluated with a semi-structured diagnostic interview. psychol. med. ( ) (epub ahead of print). the us fda has recently granted cell- dex therapeutics, inc. (nj, usa) fast track designation for their cdx- investigational immunotherapy for the treatment of egfrviii-expressing glioblastoma multiforme (gbm). egfrviii, which is only found in cancerous tissue, is present in approxi- mately % of gbm patients. cdx- immunotherapy works by activat- ing a patient’s immune system against egfrviii, therefore selectively attack- ing the tumor cells. recent trials of the immunotherapy have shown highly promising results. fast track designation granted for cdx- for the treatment of glioblastoma multiforme drug: cdx- tradename: na manufacturer: celldex therapeutics, inc. indication: treatment of egfrviii- expressing glioblastoma multiforme in the activate phase ii study, patients with egfrviii-expressing gbm who were treated with cdx- had a median survival of months, compared with only . months in historical controls. the median time to progression was also longer, at months (p = . ) in cdx- - treated patients compared with only . months in historical controls. in addition, in patients whose gbm recurred following treatment, the tumors had lost egfrviii expression. “fast track status acknowledges cdx- ’s potential to fill an unmet need for glioblastoma patients…” in act ii, an extension study, a simi- lar patient population was treated with a combination of cdx- and chemo- therapy. although the study has not yet reached its median time to progression, preliminary progression-free survival and overall survival rates look similar to those found in the activate trial, and as such are highly promising. finally, in september , the first patient was randomized to the act iii phase ii/iii study of cdx- in com- bination with radiation therapy and temzolomide in newly diagnosed gbm. the study was designed to investigate the safety, anticancer activity and impact on survival of adding dcx- to the standard of care for gbm patients versus the standard of care alone. “fast track status acknowledges cdx- ’s potential to fill an unmet need for glioblastoma patients and gives it priority within the fda,” com- mented thomas davis, chief medical officer of celldex therapeutics. “con- firmation of the promising results we’ve already observed is a high priority at celldex, as it is within the brain cancer community in general.” source: www.celldextherapeutics.com news in brief www.future-drugs.com astrazeneca (ny, usa) recently sub- mitted two separate supplemental new drug applications (sndas) for the use of seroquel xr™ in the treatment of manic and depressive episodes associated with bipolar disorder. seroquel xr, which is currently approved in eight countries for the treatment of adults with schizophrenia, was reported at the th international forum on mood and anxiety disorders (budapest, hungary) in december to also be effective in the treat- ment of major depressive disorder and generalized anxiety disorder. the two snda submissions are both based on clinical studies of once daily treatment with seroquel xr compared with placebo. in the bipolar mania study patients receive seroquel xr once daily at doses of – mg/day. the primary end point is a change in baseline young mania rating scale (ymrs) total score at weeks. in the bipolar depression study patients receive mg/day seroquel xr once daily with a primary end point of a change from baseline in the mont- gomery asperg depression rating scale (madrs) total score after weeks. both studies have met their primary end points and further results are expected to be presented later in . sources: astrazeneca press releases www.astrazeneca.com/pressrelease/ .aspx; www.astrazeneca.com/pressrelease/ .aspx. astrazeneca seeks us fda approval for the use of seroquel xr™ for bipolar disorder drug: quetiapine fumarate tradename: seroquel xr™ manufacturer: astrazeneca current indication: treatment of schizophrenia in adults proposed indication: treatment of manic and depressive episodes associated with bipolar disorder positive effect of etanercept on alzheimer’s disease symptoms patient experiences rapid improvement in memory following treatment with the arthritis drug a recent case report, published online on january in the journal of neuroinflam- mation, has documented extremely rapid improvements in cognitive abilities in an alzheimer’s disease (ad) sufferer follow- ing spinal injection of the arthritis drug, etanercept (trade name enbrel®). etanercept is a tnf-α receptor fusion protein that binds to tnf-α and neutral- izes it. elevated levels of tnf-α are hypothesized to be involved in the patho- genesis of ad. therefore, researchers investigated the effect of treatment with etanercept on ad symptoms. the study reports the administration of etanercept into the spine of an -year old man with early stage ad. prior to injection a variety of cognitive tests were carried out on the man, who used to be a doctor. within min following the injection, the man could remember a variety of facts that he had previously been unable to recall, including the year, day of the week and the state in which he lived. he was also much calmer, more attentive and less frustrated following the injection. lead author of the study, edward tobinick, said the drug had “a very rapid effect that’s never been reported in a human being before”. he added, “it makes practical changes that are signifi- cant and perceptible, making a difference to his daily living.” “other experts in the field are also excited about the potential of this novel treatment…” sue griffin, the editor the journal of neuroinflammation who wrote an accom- panying commentary, said “it is unprece- dented to see cognitive and behavioral improvement in a patient with established dementia within minutes of therapeutic intervention. this gives all of us in ad research a tremendous new clue about new avenues of research.” she added, “even though this report predominantly discusses a single patient, it is of signifi- cant scientific interest because of the potential insight it may give into the proc- esses involved in the brain dysfunction of ad.” other experts in the field are also excited about the potential of this novel treat- ment, although they do stress that a great deal more research is required. rebecca wood, of the alzheimer’s research trust (cambridge, uk) commented, “this is promising and innovative research, but in the early stages and further work is needed before we can conclude etanercept could work as a treatment for ad. we need to investigate whether it is safe and works in a larger number of patients as well as moni- tor the long-term effects. scientists also need to check the benefits weren’t just due to the placebo effect and establish whether any benefit is just temporary or whether the disease itself is slowed.” sources: tobinick el, gross h. rapid cognitive improvement in alzheimer’s disease following perispinal etanercept administration. j. neuroinflammation ( ), ( ) (epub ahead of print). griffin ws. perispinal etanercept: potential as an alzheimer therapeutic. j. neuroinflammation ( ), ( ) (epub ahead of print). << /ascii encodepages false /allowtransparency false /autopositionepsfiles true /autorotatepages /none /binding /left /calgrayprofile (dot gain %) /calrgbprofile (srgb iec - . ) /calcmykprofile (u.s. web coated \ swop\ v ) /srgbprofile (srgb iec - . ) /cannotembedfontpolicy /error /compatibilitylevel . /compressobjects /tags /compresspages true /convertimagestoindexed true /passthroughjpegimages true /createjdffile false /createjobticket false /defaultrenderingintent /default /detectblends true /colorconversionstrategy /leavecolorunchanged /dothumbnails false /embedallfonts true /embedjoboptions true /dscreportinglevel /emitdscwarnings false /endpage - /imagememory /lockdistillerparams false /maxsubsetpct /optimize true /opm /parsedsccomments true /parsedsccommentsfordocinfo true /preservecopypage true /preserveepsinfo true /preservehalftoneinfo false /preserveopicomments false /preserveoverprintsettings true /startpage /subsetfonts true /transferfunctioninfo /apply /ucrandbginfo /preserve /useprologue false /colorsettingsfile () /alwaysembed [ true ] /neverembed [ true ] /antialiascolorimages false /downsamplecolorimages true /colorimagedownsampletype /bicubic /colorimageresolution /colorimagedepth - /colorimagedownsamplethreshold . /encodecolorimages true /colorimagefilter /dctencode /autofiltercolorimages true /colorimageautofilterstrategy /jpeg /coloracsimagedict << /qfactor . /hsamples [ ] /vsamples [ ] >> /colorimagedict << /qfactor . /hsamples [ ] /vsamples [ ] >> /jpeg coloracsimagedict << /tilewidth /tileheight /quality >> /jpeg colorimagedict << /tilewidth /tileheight /quality >> /antialiasgrayimages false /downsamplegrayimages true /grayimagedownsampletype /bicubic /grayimageresolution /grayimagedepth - /grayimagedownsamplethreshold . /encodegrayimages true /grayimagefilter /dctencode /autofiltergrayimages true /grayimageautofilterstrategy /jpeg /grayacsimagedict << /qfactor . /hsamples [ ] /vsamples [ ] >> /grayimagedict << /qfactor . /hsamples [ ] /vsamples [ ] >> /jpeg grayacsimagedict << /tilewidth /tileheight /quality >> /jpeg grayimagedict << /tilewidth /tileheight /quality >> /antialiasmonoimages false /downsamplemonoimages true /monoimagedownsampletype /bicubic /monoimageresolution /monoimagedepth - /monoimagedownsamplethreshold . /encodemonoimages true /monoimagefilter /ccittfaxencode /monoimagedict << /k - >> /allowpsxobjects false /pdfx acheck false /pdfx check false /pdfxcompliantpdfonly false /pdfxnotrimboxerror true /pdfxtrimboxtomediaboxoffset [ . . . . ] /pdfxsetbleedboxtomediabox true /pdfxbleedboxtotrimboxoffset [ . . . . ] /pdfxoutputintentprofile () /pdfxoutputcondition () /pdfxregistryname (http://www.color.org) /pdfxtrapped /unknown /description << /enu (use these settings to create pdf documents with higher image resolution for high quality pre-press printing. the pdf documents can be opened with acrobat and reader . and later. these settings require font embedding.) /jpn . ). heritability values for regional fa values in hcp data were taken from our previous work (kochunov et al., ) and were significant in all tracts (table ). age was a non- kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t significant covariate for either regional fa values or processing speed in hcp sample. there was a significant and positive correlation (r= . , p= . ) between heritability estimates for regional fa measurements in the ooa and hcp cohorts (figure ). correlations between fa and processing speed significant phenotypic correlation (ρp) was observed between whole-brain average fa and processing speed (ρp= . , p= . ). significant phenotypic correlations were observed for the genu of cc and the sagittal stratum tracts (ρp= . , p= . for both) (table ). nominally significant ρp values were observed for the body and splenium of the corpus callosum, the corona radiata (cr) and superior longitudinal fasciculus (slf) (figure , table ). genetic correlation analyses in oaa sample demonstrated significant shared genetic variance between average fa and processing speed (ρg= . ± . , p= . ). for regional fa values, although none of the coefficients achieved statistical significance at p< . , all genetic correlation coefficients were positive and nominally significant for the genu, splenium and fornix (figure , table ). all environmental correlation coefficients were non-significant (all p> . ). in hcp sample, a positive and significant phenotypic correlation ρp was observed between average fa and processing speed (ρp= . p= . ). the ρp coefficient was numerically lower than that in ooa but there was no significant difference between them (z= . ,p> . ). regionally, the ρp was significant for the slf, cortico-spinal (cst) and ss tracts and nominally significant for the splenium of the corpus callosum and corona radiata (cr) (table ). the phenotypic correlation coefficients were smaller for hcp than for ooa, likely due to a smaller variance in the cognitive performance data (average processing speed ± std dev = . ± . vs. . ± . for ooa and hcp, respectively) and in fa (whole brain fa: = . ± . vs. . ± . ) (table s, see supplement) the ρp coefficients for regional fa measurements and processing speed in hcp were also not significantly different from these in ooa with exception for the genu of corpus callosum (p= . ). the correlation between regional ρp values for ooa and hcp cohorts was positive and significant (r= . , p= . ) (figure , top). likewise, the genetic correlation analyses showed a significant correlation between whole- brain average fa and processing speed (ρg= . ± . , p= . ). there were no significant differences in the genetic correlation coefficients between ooa and hcp samples (p= . ). significant ρg values were observed for the splenium, internal capsule (ic) and ss tracts (p≤ . ). nominal significance was observed for the cr, external capsule (ec), slf and cst tract ( . >p> . ). nominally significant differences between ooa and hcp cohorts were only observed for the splenium of corpus callosum (p= . ). all environmental correlation coefficients were non-significant (all p> . ). the correlation between regional ρg was positive but not significant (r= . , p= . ) (table , figure , bottom) kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t discussion we demonstrated a significant shared additive genetic contribution between intersubject variability in the processing speed and fractional anisotropy (fa) of cerebral wm. this finding was first observed in the old order amish subjects and then replicated in data collected and distributed by the human connectome project. this suggests that the common genetic effects significantly contribute to the phenotypic association between the two traits. this finding was observed despite the differences in the ooa and hcp family structure, sample size, age range, sociocultural background, and the imaging and processing speed assessment tools. both ooa and hcp are robust familial samples, although they also differ in several important aspects. the ooa cohort consisted of subjects ascertained from a large multigenerational pedigree. farm-dwelling ooa subjects have higher environmental homogeneity compared to the urban/suburban hcp sample. ooa are perhaps best known for their old-fashioned dress and resistance to technological change. ooa share rural upbringing and similar diet, income and work environment. all ooa receive uniform th grade level education. illicit drug use was not present in our sample. in comparison, the hcp sample consisted of twin-pairs and siblings with diverse ethnic and economic backgrounds. other distinct features include the age range. the ooa subjects were recruited across the lifespan (age rage= - ) and heritability analyses identified age as a significant covariate for both processing speed and fa values. the hcp recruitment was focused on a narrow age range from to years that corresponds to the plateau in the fa and processing speed aging trends (kochunov et al., ; van essen et al., ). the lack of aging-related trends in fa values were already reported in hcp (kochunov et al., ). likewise, we found no impact of subjects’ age on the processing speed measurements in hcp sample (p> . ). thus, the ooa and hcp samples differ in environmental and likely population genetic contribution, making the similar findings in heritability and genetic correlation more convincing. despite the difference in imaging methods, the heritability estimates for the whole-brain average fa values were similar (h = . vs. . ) for ooa and hcp cohorts. likewise, the tract-wise average fa values in ooa and hcp subjects showed a good agreement (r= . ). heritability is the proportion of the variance that is attributed to the additive genetic variance after correction for covariates. in ooa sample age was the only significant covariate. the hcp sample show no age effect likely because the recruitment strategy was designed to reduce the effects of age on the brain measurements by limiting age-range to that corresponds to a plateau in fa-aging trend ( - years) (kochunov et al., ; van essen et al., ). another source of variability is the difference in methods used to ascertain processing speed in ooa and hcp samples. the digit-symbol coding test used in the ooa sample is a standard neurocognitive assessment tool to assess processing speed, commonly used in psychiatric research(knowles et al., ). the processing speed in the hcp sample was measured using the pattern comparison processing speed test. both tests are accepted measurements of processing speed and share between - % of the intersubject kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t variance(carlozzi et al., ; carlozzi et al., ). despite differences in processing speed tasks in the ooa and hcp cohorts, we found only sporadic differences in phenotypic and genetic correlations across samples; these differences however, were not statistically significant after correction for multiple compassions. the fact that phenotypic and genetic correlation coefficients were positively correlated between the two samples supports the notion that shared variance between fa values and processing speed are not specific to a behavioral task or a particular population. we believe the difference in processing speed measurement tests rather than the imaging protocol may to a greater extent explain why the correlation coefficients in ooa subjects were numerically higher than these in hcp cohort. while, this difference was not significant for the whole-brain average fa values, it was nominally significant for the genu and splenium of corpus callosum for the phenotypic and genetic correlation, respectively. in ooa, the phenotypic correlation between fa values of the genu and processing speed were statistically significant (r= . , p= . ). in comparison, in hcp sample this correlation was only suggestively significant (r= . , p= . ). in the same time, there was no significant difference for the heritability estimate for the fa for this structure (h = . vs. . , for ooa and hcp, respectively, p= . ). the genu contains the primary fibers connecting the left and right frontal lobes and the genetic contribution to processing speed may in part be through genetic influence on the speed of frontal lobe communication (aboitiz, ; aboitiz et al., ; bartzokis et al., ). normal aging and lesion studies suggest that the decision making process in the digit symbol coding task is sensitive to the structural integrity of the frontal white matter, regardless of variance in reaction time(kochunov et al., ; leavitt et al., ; raji et al., ). instead, the pattern of correlation in the hcp had a more posterior/inferior bias with the highest correlations in the corticospinal (cst) and the sagittal stratum (ss) areas with the pcps processing speed task. the pcps test has a heavy visual loading, which may explain the heavy loading on wm structures that serve visual-spatial subsystems including the splenium of corpus callosum (scc) and ss. notably, the phenotypic correlation for these structures were also nominally significant in ooa sample. genetic correlation coefficients were nominally different for the splenium of corpus callosum, with higher ρg values observed in ooa sample (ρg = . vs . in ooa and hcp respectively). nonetheless, both coefficients were significantly different from zero in ooa and hcp cohorts (p= . and . in ooa and hcp, respectively). therefore, the differences in the loading of the digit symbol vs. pcps processing speed tests on specific cognitive domains is the likely explanation of the numerical differences in the phenotypic and genetic correlation coefficients between ooa and hcp cohorts. a potential limitation of this study is the use of psychiatric drugs by n= ooa subjects, with a lifetime diagnosis of mental illness that may have potentially affected brain structure. the use of psychiatric drug was coded as a binary covariate during all analyses. however, as this covariate was robustly non-significant, we believe it to be a minor limitation. another limitation of this study is that we did not collect peripheral pulse oximetry data during the dti acquisition. advanced dti reconstruction techniques allow for use of peripheral data such as pulse and respiration to improve signal-to-noise ratio in tensor fit, especially in the areas of brainstem and cerebellum (mohammadi et al., ). in the absence of cardiac kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t gating during the acquisition, it is also possible to vet or edit the input data with publicly available software that allows removal of outliers or volumes corrupted by excessive movement from the tensor calculation, although we did not use such an approach in this study. overall, our findings imply that specific genes influencing variance in fa values may also exert influence over the speed of cognitive information processing. this finding is of importance for neuropsychiatric disorders such as schizophrenia where the reduced speed of information processing and reduced cerebral fa values are highly replicable findings and believed to be interlinked (alba-ferrara and de erausquin, ; ellison-wright and bullmore, ; friedman et al., ; glahn et al., ; kubicki et al., ; nazeri et al., ; penke et al., ; perez-iglesias et al., ; phillips et al., ). together, our results support common sets of genes influencing variation in processing speed and white matter fa phenotypes, consistent with the idea of pleiotropic effects in brain structure and cognitive behavior. our findings may pave a way for multivariate genetic localization analyses that combine processing speed and fa-values to directly identify genes that may have impact in multiple psychiatric disorders. supplementary material refer to web version on pubmed central for supplementary material. acknowledgments we are grateful of the amish families who have supported this research. this research was supported by nih grants u mh , r eb , r da and r mh . this work was supported in part by a consortium grant (u eb ) from the nih institutes contributing to the big data to knowledge (bd k) initiative. this work was also supported by nih grants p mh and t mh . reference aboitiz f. brain connections: interhemispheric fiber systems and anatomical brain asymmetries in humans. biol res. ; : – . [pubmed: ] aboitiz f, scheibel ab, fisher rs, zaidel e. fiber composition of the human corpus callosum. brain res. ; : – . [pubmed: ] agarwala r, biesecker lg, tomlin jf, schaffer aa. towards a complete north american anabaptist genealogy: a systematic approach to merging partially overlapping genealogy resources. am j med genet. ; : – . [pubmed: ] alba-ferrara lm, de erausquin ga. what does anisotropy measure? insights from increased and decreased anisotropy in selective fiber tracts in schizophrenia. front integr neurosci. ; : . [pubmed: ] almasy l, blangero j. variance component methods for analysis of complex phenotypes. cold spring harbor protocols . :pdb.top –pdb.top . almasy l, dyer td, blangero j. bivariate quantitative trait linkage analysis: pleiotropy versus co- incident linkages. genet epidemiol. ; : – . [pubmed: ] bartzokis g. age-related myelin breakdown: a developmental model of cognitive decline and alzheimer's disease. neurobiol aging. ; : – . [pubmed: ] bartzokis g, lu ph, tingus k, mendez mf, richard a, peters dg, oluwadara b, barrall ka, finn jp, villablanca p, thompson pm, mintz j. lifespan trajectory of myelin integrity and maximum motor speed. neurobiol aging. kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t bartzokis g, lu ph, tingus k, mendez mf, richard a, peters dg, oluwadara b, barrall ka, finn jp, villablanca p, thompson pm, mintz j. lifespan trajectory of myelin integrity and maximum motor speed. neurobiology of aging. ; : – . [pubmed: ] basser pj. focal magnetic stimulation of an axon. ieee transactions on biomedical engineering. ; : – . [pubmed: ] beaulieu c. the basis of anisotropic water diffusion in the nervous system - a technical review. nmr biomed. ; : – . [pubmed: ] behrens te, woolrich mw, jenkinson m, johansen-berg h, nunes rg, clare s, matthews pm, brady jm, smith sm. characterization and propagation of uncertainty in diffusion-weighted mr imaging. magn reson med. ; : – . [pubmed: ] braskie mn, jahanshad n, stein jl, barysheva m, mcmahon kl, de zubicaray gi, martin ng, wright mj, ringman jm, toga aw, thompson pm. common alzheimer's disease risk variant within the clu gene affects white matter microstructure in young adults. j neurosci. ; : – . [pubmed: ] carlozzi ne, tulsky ds, chiaravalloti nd, beaumont jl, weintraub s, conway k, gershon rc. nih toolbox cognitive battery (nihtb-cb): the nihtb pattern comparison processing speed test. j int neuropsychol soc. ; : – . [pubmed: ] carlozzi ne, tulsky ds, kail rv, beaumont jl. vi. nih toolbox cognition battery (cb): measuring processing speed. monogr soc res child dev. ; : – . [pubmed: ] charlton ra, schiavone f, barrick tr, morris rg, markus hs. diffusion tensor imaging detects age-related white matter change over a two-year follow-up which is associated with working memory decline. journal of neurology, neurosurgery, and psychiatry. chiang mc, barysheva m, mcmahon kl, de zubicaray gi, johnson k, montgomery gw, martin ng, toga aw, wright mj, shapshak p, thompson pm. gene network effects on brain microstructure and intellectual performance identified in twins. j neurosci. ; : – . [pubmed: ] chiang mc, barysheva m, shattuck dw, lee ad, madsen sk, avedissian c, klunder ad, toga aw, mcmahon kl, de zubicaray gi, wright mj, srivastava a, balov n, thompson pm. genetics of brain fiber architecture and intellectual performance. j neurosci. ; : – . [pubmed: ] conturo te, mckinstry rc, akbudak e, robinson bh. encoding of anisotropic diffusion with tetrahedral gradients: a general mathematical diffusion formalism and experimental results. magn reson med. ; : – . [pubmed: ] edens el, glowinski al, pergadia ml, lessov-schlaggar cn, bucholz kk. nicotine addiction in light smoking african american mothers. j addict med. ; : – . [pubmed: ] ellison-wright i, bullmore e. meta-analysis of diffusion tensor imaging studies in schizophrenia. schizophr res. ; : – . [pubmed: ] felts pa, baker ta, smith kj. conduction in segmentally demyelinated mammalian central axons. j neurosci. ; : – . [pubmed: ] flechsig p. developmental (myelogenetic) localisation of the cerebral cortex in the human. lancet. ; : – . friedman ji, tang c, carpenter d, buchsbaum m, schmeidler j, flanagan l, golembo s, kanellopoulou i, ng j, hof pr, harvey pd, tsopelas nd, stewart d, davis kl. diffusion tensor imaging findings in first-episode and chronic schizophrenia patients. am j psychiatry. ; : – . [pubmed: ] glahn dc, curran je, winkler am, carless ma, kent jw jr. charlesworth jc, johnson mp, goring hh, cole sa, dyer td, moses ek, olvera rl, kochunov p, duggirala r, fox pt, almasy l, blangero j. high dimensional endophenotype ranking in the search for major depression risk genes. biol psychiatry. ; : – . [pubmed: ] glahn dc, kent jw jr. sprooten e, diego vp, winkler am, curran je, mckay dr, knowles ee, carless ma, goring hh, dyer td, olvera rl, fox pt, almasy l, charlesworth j, kochunov p, duggirala r, blangero j. genetic basis of neurocognitive decline and reduced white-matter integrity in normal human brain aging. proc natl acad sci u s a. ; : – . [pubmed: ] kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t glasser mf, sotiropoulos sn, wilson ja, coalson ts, fischl b, andersson jl, xu j, jbabdi s, webster m, polimeni jr, van essen dc, jenkinson m. the minimal preprocessing pipelines for the human connectome project. neuroimage. ; : – . [pubmed: ] jahanshad n, kochunov p, sprooten e, mandl rc, nichols te, almassy l, blangero j, brouwer rm, curran je, de zubicaray gi, duggirala r, fox pt, hong le, landman ba, martin ng, mcmahon kl, medland se, mitchell bd, olvera rl, peterson cp, starr jm, sussmann je, toga aw, wardlaw jm, wright mj, hulshoff pol he, bastin me, mcintosh am, deary ij, thompson pm, glahn dc. multi-site genetic analysis of diffusion images and voxelwise heritability analysis: a pilot project of the enigma-dti working group. neuroimage. doi:pii: s - ( ) - . . /j.neuroimage. . . . jahanshad n, kohannim o, hibar dp, stein jl, mcmahon kl, de zubicaray gi, medland se, montgomery gw, whitfield jb, martin ng, wright mj, toga aw, thompson pm. brain structure in healthy adults is related to serum transferrin and the h d polymorphism in the hfe gene. proc natl acad sci u s a. ; :e – . [pubmed: ] jahanshad n, lee ad, barysheva m, mcmahon kl, de zubicaray gi, martin ng, wright mj, toga aw, thompson pm. genetic influences on brain asymmetry: a dti study of twins and siblings. neuroimage. ; : – . [pubmed: ] jones dk, horsfield ma, simmons a. optimal strategies for measuring diffusion in anisotropic systems by magnetic resonance imaging. magn reson med. ; : – . [pubmed: ] jones dk, knosche tr, turner r. white matter integrity, fiber count, and other fallacies: the do's and don'ts of diffusion mri. neuroimage. ; : – . [pubmed: ] karbasforoushan h, duffy b, blackford ju, woodward nd. processing speed impairment in schizophrenia is mediated by white matter integrity. psychol med. ; : – . [pubmed: ] kennedy km, raz n. aging white matter and cognition: differential effects of regional variations in diffusion properties on memory, executive functions, and speed. neuropsychologia. ; : – . [pubmed: ] kessler rc, demler o, frank rg, olfson m, pincus ha, walters ee, wang p, wells kb, zaslavsky am. prevalence and treatment of mental disorders, to . n engl j med. ; : – . [pubmed: ] knowles ee, david as, reichenberg a. processing speed deficits in schizophrenia: reexamining the evidence. the american journal of psychiatry. ; : – . [pubmed: ] kochunov p, coyle t, lancaster j, hardies j, kochunov v, bartzokis g, royall d, stanley j, schlosser a, fox p. processing speed is correlated with cerebral health markers in the frontal lobes as quantified by neuro-imaging. neuroimage. a in press. kochunov p, coyle t, lancaster j, robin da, hardies j, kochunov v, bartzokis g, stanley j, royall d, schlosser ae, null m, fox pt. processing speed is correlated with cerebral health markers in the frontal lobes as quantified by neuroimaging. neuroimage. ; : – . [pubmed: ] kochunov p, glahn dc, lancaster j, thompson pm, kochunov v, rogers b, fox p, blangero j, williamson de. fractional anisotropy of cerebral white matter and thickness of cortical gray matter across the lifespan. neuroimage. ; : – . [pubmed: ] kochunov p, jahanshad n, marcus d, winkler a, sproote e, nichols t, hong l, behrens te, andersson j, yacoub e, ugurbil k, brouwer c, landman ba, braber a, almassy l, fox pt, olvera r, blangero j, dc. g, van essen dc. heritability of fractional anisotropy in human white matter: a comparison of human connectome project and enigma-dti data. neuroimage. in review. kochunov p, jahanshad n, marcus d, winkler a, sprooten e, nichols te, wright sn, hong le, patel b, behrens t, jbabdi s, andersson j, lenglet c, yacoub e, moeller s, auerbach e, ugurbil k, sotiropoulos sn, brouwer rm, landman b, lemaitre h, den braber a, zwiers mp, ritchie s, van hulzen k, almasy l, curran j, dezubicaray gi, duggirala r, fox p, martin ng, mcmahon kl, mitchell b, olvera rl, peterson c, starr j, sussmann j, wardlaw j, wright m, boomsma di, kahn r, de geus ej, williamson de, hariri a, van 't ent d, bastin me, mcintosh a, deary ij, hulshoff pol he, blangero j, thompson pm, glahn dc, van essen dc. heritability of fractional kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t anisotropy in human white matter: a comparison of human connectome project and enigma- dti data. neuroimage. ; : – . [pubmed: ] kochunov p, robin d, royall d, lancaster j, kochunov v, coyle t, schlosser a, fox p. can structural mri cerebral health markers track cognitive trends in executive control function during normal maturation and adulthood? hum brain mapp. b; : – . [pubmed: ] kochunov p, williamson de, lancaster j, fox p, cornell j, blangero j, glahn dc. fractional anisotropy of water diffusion in cerebral white matter across the lifespan. neurobiol aging. ; : – . [pubmed: ] konrad a, vucurevic g, musso f, stoeter p, winterer g. correlation of brain white matter diffusion anisotropy and mean diffusivity with reaction time in an oddball task. neuropsychobiology. ; : – . [pubmed: ] kubicki m, mccarley r, westin cf, park hj, maier s, kikinis r, jolesz fa, shenton me. a review of diffusion tensor imaging studies in schizophrenia. j psychiatr res. ; : – . [pubmed: ] leavitt vm, wylie g, genova hm, chiaravalloti nd, deluca j. altered effective connectivity during performance of an information processing speed task in multiple sclerosis. mult scler. ; : – . [pubmed: ] marcus ds, harms mp, snyder az, jenkinson m, wilson ja, glasser mf, barch dm, archie ka, burgess gc, ramaratnam m, hodge m, horton w, herrick r, olsen t, mckay m, house m, hileman m, reid e, harwell j, coalson t, schindler j, elam js, curtiss sw, van essen dc. human connectome project informatics: quality control, database services, and data visualization. neuroimage. ; : – . [pubmed: ] mohammadi s, hutton c, nagy z, josephs o, weiskopf n. retrospective correction of physiological noise in dti using an extended tensor model and peripheral measurements. magn reson med. ; : – . [pubmed: ] muetzel rl, collins pf, mueller ba, a ms, lim ko, luciana m. the development of corpus callosum microstructure and associations with bimanual task performance in healthy adolescents. neuroimage. ; : – . [pubmed: ] nazeri a, mallar chakravarty m, felsky d, lobaugh nj, rajji tk, mulsant bh, voineskos an. alterations of superficial white matter in schizophrenia and relationship to cognitive performance. neuropsychopharmacology. penke l, munoz maniega s, murray c, gow aj, hernandez mc, clayden jd, starr jm, wardlaw jm, bastin me, deary ij. a general factor of brain white matter integrity predicts information processing speed in healthy older people. j neurosci. ; : – . [pubmed: ] perez-iglesias r, tordesillas-gutierrez d, mcguire pk, barker gj, roiz-santianez r, mata i, de lucas em, rodriguez-sanchez jm, ayesa-arriola r, vazquez-barquero jl, crespo-facorro b. white matter integrity and cognitive impairment in first-episode psychosis. am j psychiatry. ; : – . [pubmed: ] phillips ka, rogers j, barrett ea, glahn dc, kochunov p. genetic contributions to the midsagittal area of the corpus callosum. twin res hum genet. ; : – . [pubmed: ] pierpaoli c, basser pj. toward a quantitative assessment of diffusion anisotropy. magn reson med. ; : – . [pubmed: ] raji ca, lopez ol, kuller lh, carmichael ot, longstreth wt jr. gach hm, boardman j, bernick cb, thompson pm, becker jt. white matter lesions and brain gray matter volume in cognitively normal elders. neurobiol aging. ; : e – . [pubmed: ] salthouse ta. when does age-related cognitive decline begin? neurobiol aging. ; : – . [pubmed: ] sartor ce, mccutcheon vv, pommer ne, nelson ec, grant jd, duncan ae, waldron m, bucholz kk, madden pa, heath ac. common genetic and environmental contributions to post-traumatic stress disorder and alcohol dependence in young women. psychol med. ; : – . [pubmed: ] schiavone f, charlton ra, barrick tr, morris rg, markus hs. imaging age-related cognitive decline: a comparison of diffusion tensor and magnetization transfer mri. j magn reson imaging. ; : – . [pubmed: ] kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t shen kk, rose s, fripp j, mcmahon kl, de zubicaray gi, martin ng, thompson pm, wright mj, salvado o. investigating brain connectivity heritability in a twin study using diffusion imaging data. neuroimage. ; : – . [pubmed: ] smith sm. fast robust automated brain extraction. hum brain mapp. ; : – . [pubmed: ] smith sm, jenkinson m, johansen-berg h, rueckert d, nichols te, mackay ce, watkins ke, ciccarelli o, cader mz, matthews pm, behrens te. tract-based spatial statistics: voxelwise analysis of multi-subject diffusion data. neuroimage. ; : – . [pubmed: ] sotiropoulos sn, jbabdi s, xu j, andersson jl, moeller s, auerbach ej, glasser mf, hernandez m, sapiro g, jenkinson m, feinberg da, yacoub e, lenglet c, van essen dc, ugurbil k, behrens te. advances in diffusion mri acquisition and processing in the human connectome project. neuroimage. ; : – . [pubmed: ] ugurbil k, xu j, auerbach ej, moeller s, vu at, duarte-carvajalino jm, lenglet c, wu x, schmitter s, van de moortele pf, strupp j, sapiro g, de martino f, wang d, harel n, garwood m, chen l, feinberg da, smith sm, miller kl, sotiropoulos sn, jbabdi s, andersson jl, behrens te, glasser mf, van essen dc, yacoub e, consortium wu-mh. pushing spatial and temporal resolution for functional and diffusion mri in the human connectome project. neuroimage. ; : – . [pubmed: ] ulug am, barker pb, van zijl pc. correction of motional artifacts in diffusion-weighted images using a reference phase map. magn reson med. ; : – . [pubmed: ] van essen dc, ugurbil k, auerbach e, barch d, behrens te, bucholz r, chang a, chen l, corbetta m, curtiss sw, della penna s, feinberg d, glasser mf, harel n, heath ac, larson-prior l, marcus d, michalareas g, moeller s, oostenveld r, petersen se, prior f, schlaggar bl, smith sm, snyder az, xu j, yacoub e. the human connectome project: a data acquisition perspective. neuroimage. ; : – . [pubmed: ] vernooij mw, ikram ma, vrooman ha, wielopolski pa, krestin gp, hofman a, niessen wj, van der lugt a, breteler mm. white matter microstructural integrity and cognitive function in a general elderly population. arch gen psychiatry. ; : – . [pubmed: ] waxman sg, bennett mv. relative conduction velocities of small myelinated and non-myelinated fibres in the central nervous system. nat new biol. ; : – . [pubmed: ] wechsler, d. wechsler adult intelligence scale. rd edn.. psychological corporation; san antonio, tx: . williams-blangero s, blangero j. quantitative genetic analysis of skin reflectance: a multivariate approach. hum biol. ; : – . [pubmed: ] wright sn, hong le, winkler am, chiappelli j, nugent k, muellerklein f, du x, rowland lm, wang dj, kochunov p. perfusion shift from white to gray matter may account for processing speed deficits in schizophrenia. hum brain mapp. kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t figure . heritability of fa measurement for ooa sample. kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t figure . heritability estimates for dti-fa measured in ooa are presented as a scatter plot versus heritability estimates calculated in the hcp cohorts. the line represent the result of the linear correlation analysis between two cohorts that reported a positive and significant correlation r= . , p= . . kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t figure . phenotypic (ρp), top row, and genetic (ρg), bottom row, correlation between of fa and processing speed measurement for ooa sample. kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t figure . a scatter plot of ρp (top panel) and ρg (bottom panel) values between dti-fa and processing speed measurements in ooa and hcp cohorts. the lines represent the result of the linear correlation analysis between two cohorts. the positive correlation for ρp coefficients was significant r= . , p= . . the positive correlation ρg for was not significant (r= . , p= . ). kochunov et al. page neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t kochunov et al. page table heritability of processing speed and fa values in amish and hcp populations. global phenotypes ooa hcp processing speed . ± . (p= . ) . ± . (p= × − ) whole-brain average fa . ± . (p= × ) . ± . (p= × − ) regional fa values genu of the corpus callosum . + . (p= . ) . ± . (p= × − ) * body of the corpus callosum . + . (p= . * ) . ± . (p= × − ) * splenium of corpus callosum . + . (p= . ) * . ± . (p= × − ) * fornix (fx) . + . (p= . ) . ± . (p= × − ) * cingulum (cingulate gyrus) - l and r combined (cing) . + . (p= . ) * . ± . (p= × − ) * corona radiata - l and r anterior, superior and posterior sections combined (cr) . + . (p= . ) . ± . (p= × − ) * external capsule - l and r combined (ec) . + . (p= . ) . ± . (p= × − ) * internal capsule - l and r anterior limb, posterior limb, and retrolenticular parts combined (ic) . + . (p= . ) . ± . (p= × − ) * superior longitudinal fasciculus - l and r combined (slf) . + . (p= . ) * . ± . (p= × − ) * sagittal stratum (include inferior longitudinal fasciculus and inferior fronto-occipital fasciculus) - l and r combined (ss) . + . (p= . ) . ± . (p= × − ) * corticospinal tract - l and r combined (cst) . + . (p= . ) . ± . (p= × − ) * analyses in both cohorts were corrected for age, age , age×sex and age ×sex. bolded values are significant at p≤ . . * values that are significant after correction for multiple (n= ) comparisons. neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t kochunov et al. page table phenotypic correlation coefficients (ρp ) between processing speed and fa value (corrected for age, age , age×sex and age ×sex). trait ooa hcp whole-brain average fa . (p= . ) . (p= . ) regional fa values genu of the corpus callosum . (p= . ) * . (p= . ) body of the corpus callosum . (p= . ) . (p= . ) splenium of corpus callosum . (p= . ) . (p= . ) fornix (fx) . (p= . ) . (p= . ) cingulum (cingulate gyrus) - l and r combined (cing) . (p= . ) . (p= . ) corona radiata - l and r anterior, superior and posterior sections combined (cr) . (p= . * ) . (p= . ) external capsule - l and r combined (ec) . (p= . ) . (p= . ) internal capsule - l and r anterior limb, posterior limb, and retrolenticular parts combined (ic) . (p= . ) . (p= . ) superior longitudinal fasciculus - l and r combined (slf) . (p= . ) . (p= . )* sagittal stratum (include inferior longitudinal fasciculus and inferior fronto-occipital fasciculus) - l and r combined (ss) . (p= . ) * . (p= . ) corticospinal tract - l and r combined (cst) . (p= . ) . (p= . ) * bolded values are significant at p≤ . . * values that are significant after correction for multiple (n= ) comparisons. neuroimage. author manuscript; available in pmc january . a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t a u th o r m a n u scrip t kochunov et al. page table genetic correlation coefficients (ρg ) between processing speed and fa value (corrected for age, age , age×sex and age ×sex). trait ooa hcp whole-brain average fa . ± . (p= . ) . ± . (p= . ) regional fa values genu of the corpus callosum . ± . (p= . ) . ± . (p= . ) body of the corpus callosum . ± . (p= . ) . ± . (p= . ) splenium of corpus callosum . ± . (p= . ) . ± . (p= . ) fornix (fx) . ± . (p= . ) . ± . (p= . ) cingulum (cingulate gyrus) - l and r combined (cing) . ± . (p= . ) . ± . (p= . ) corona radiata - l and r anterior, superior and posterior sections combined (cr) . ± . (p= . ) . ± . (p= . ) external capsule - l and r combined (ec) . ± . (p= . ) . ± . (p= . ) internal capsule - l and r anterior limb, posterior limb, and retrolenticular parts combined (ic) . ± . (p= . ) . ± . (p= . ) * superior longitudinal fasciculus - l and r combined (slf) . ± . (p= . ) . ± . (p= . ) sagittal stratum (include inferior longitudinal fasciculus and inferior fronto-occipital fasciculus) - l and r combined (ss) . ± . (p= . ) . ± . (p= . ) * corticospinal tract - l and r combined (cst) . ± . (p= . ) . ± . (p= . ) bolded values are significant at p≤ . . * values that are significant after correction for multiple (n= ) comparisons. neuroimage. author manuscript; available in pmc january . wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ [pdf] fdg pet / ct pitfalls in gynecologic and genitourinary oncologic imaging | semantic scholar skip to search formskip to main content> semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. corpus id: fdg pet / ct pitfalls in gynecologic and genitourinary oncologic imaging @inproceedings{bharwani fdgp, title={fdg pet / ct pitfalls in gynecologic and genitourinary oncologic imaging }, author={n. bharwani and a. rockall}, year={ } } n. bharwani, a. rockall published the role of whole-body positron emission tomography (pet)/ computed tomography (ct) with fluorodeoxyglucose (fdg) is now established in the assessment of many gynecologic and genitourinary malignant tumors. fdg pet/ct has been widely adopted for staging assessments in patients with suspected advanced disease, in cases of suspected disease recurrence, and for determining prognosis in a number of malignancies. a number of pitfalls are commonly encountered when reviewing fdg pet/ct scans in… expand radiology.emory.edu save to library create alert cite launch research feed share this paper figures and tables from this paper table figure table figure figure figure figure figure figure figure figure figure figure figure figure figure figure figure figure figure figure view all figures & tables references showing - of references sort byrelevance most influenced papers recency imaging of pelvic malignancies with in-line fdg pet-ct: case examples and common pitfalls of fdg pet. naveen subhas, p. patel, h. pannu, h. jacene, e. fishman, r. wahl medicine radiographics : a review publication of the radiological society of north america, inc view excerpts, references background save alert research feed fdg-pet/ct for diagnosis of primary ovarian cancer k. kitajima, kayo suzuki, + authors k. sugimura medicine nuclear medicine communications view excerpt, references background save alert research feed detection of histologically proven peritoneal carcinomatosis with fused f-fdg-pet/mdct. a. dirisamer, w. schima, + authors w. langsteger medicine european journal of radiology view excerpts, references methods and background save alert research feed the role of fdg-pet/ct in gynaecological cancers a. rockall, s. cross, s. flanagan, elizabeth moore, n. avril medicine cancer imaging : the official publication of the international cancer imaging society pdf view excerpt, references background save alert research feed focal fdg uptake in mediastinal brown fat mimicking malignancy: a potential pitfall resolved on pet/ct. m. truong, j. erasmus, + authors h. macapinlac medicine ajr. american journal of roentgenology view excerpt, references background save alert research feed fdg pet evaluation of mucinous neoplasms: correlation of fdg uptake with histopathologic features. k. berger, s. a. nicholson, f. dehdashti, b. siegel medicine ajr. american journal of roentgenology view excerpt, references background save alert research feed etiology and significance of incidentally detected focal colonic uptake on fdg pet/ct n. purandare, sachin k gawade, a. puranik, a. agrawal, s. shah, v. rangarajan medicine the indian journal of radiology & imaging view excerpt, references background save alert research feed asymptomatic adnexal masses: correlation of fdg pet and histopathologic findings. s. fenchel, d. grab, + authors s. reske medicine radiology view excerpt, references background save alert research feed diagnostic value of preoperative suvmax on fdg-pet/ct for the detection of ovarian cancer yuko tanizaki, a. kobayashi, + authors k. ino medicine international journal of gynecological cancer : official journal of the international gynecological cancer society view excerpt, references background save alert research feed f-fdg pet/ct delayed images after diuretic for restaging invasive bladder cancer dalton a. anjos, e. etchebehere, c. ramos, allan o. santos, c. albertotti, e. camargo medicine journal of nuclear medicine pdf view excerpt, references background save alert research feed ... ... related papers abstract figures and tables references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ delaware faces immunization challenges head-on jim talbott, mpa and paul hess delaware division of public health abstract this article explores the recent history of under immunized vaccine preventable diseases, along with recent outbreaks and how the delaware division of public health has responded to each. delaware’s vaccination efforts for children have achieved high coverage rates for all of the vaccine preventable diseases, leading to low incidences rates in the state. the main reason for these high rates is the law for mandated immunization for children entering kindergarten. as children age out of primary school, vaccination uptake declines. hpv vaccination rates are a prime example, as even though delaware’s rates as compared to the national average are better, they fail to meet healthy people standards of % vaccinated. to get to the heart of an under immunized population, a study to determine where the lower vaccinated rates are, along with the surveillance rates to cross match the results must be undertaken. it is understood that for communities where vaccination rates are lower, risk for disease is greater, with several recent outbreaks corroborating this. a pertussis outbreak in the delaware amish community was managed by the state with education and outreach in the community, with mixed results. hepatitis a is an epidemic in a number of states, and delaware has taken steps to try to protect our vulnerable population, using outreach, education and vaccination clinics to prevent the outbreak from occurring locally. while work continues, resources will need to be continually applied to ensure that vulnerable populations have the means to access the services needed. dph continuously monitors state vaccine coverage level data and disease outbreaks within and outside delaware’s borders and has implemented the above-mentioned public health initiatives to promote immunization awareness and address community health concerns. introduction vaccination efforts save countless lives and billions of dollars each year in avoidable medical expenses. since , the vaccines for children program has enabled the government to vaccinate uninsured and underinsured children. in its first years, this program saved an estimated $ billion in direct health care costs and over $ trillion in societal costs, such as lives and work hours saved. delaware’s vaccination efforts for children have achieved great results. the state of delaware requires that children in licensed daycare centers and entering kindergarten through grade at public, private, and home schools be immunized against certain communicable diseases before enrolling in school. delaware administrative code , “control of communicable and other disease conditions,” requires immunizations against measles, mumps, and rubella (mmr); tetanus, diphtheria, and pertussis/whooping cough (tdap); polio (ipv or opv); hepatitis b; and chickenpox (varicella). these diseases can be fatal or have serious complications that can result in blindness, deafness, and developmental delays. each year, the centers for disease control and prevention’s (cdc) national center for immunization and respiratory diseases (ncird) sponsors the national immunization survey (nis). the nis is a group of telephone surveys used to monitor vaccination coverage among children - months and teens - years, along with flu vaccinations for children months to years. in , delaware’s rate for the series : : : : : : ( +dtap, +polio, +mmr, +hib, +hepb, +varicella, and + pcv) was . %, higher than the national average of . % and close to the healthy people goal of %. due to the successes of vaccination, fewer health care providers and parents have witnessed the serious and sometimes life-threatening consequences of vaccine-preventable diseases. yet small numbers of cases can lead to the re-emergence of vaccine-preventable diseases, especially if there are increasing numbers of unvaccinated people. disease outbreaks sporadically surface nationally and in delaware, and the state’s challenge is to respond quickly to outbreaks to prevent them from spreading rapidly. we describe challenges and opportunities in vaccination and vaccine-preventable disease in delaware by focusing on three case studies: pertussis, human papillomavirus, and hepatitis a. we conclude with discussion of vaccination availability in delaware through the vaccines for children (vfc) program. pertussis challenge occasional outbreaks of whooping cough (pertussis), a highly contagious respiratory disease, occur in delaware. typically, pertussis outbreaks have occurred among kent county’s amish community, a population that is largely unvaccinated. the amish community practices separation from the world through group solidarity and caring for their own. though their religious doctrine does not prohibit vaccination, coverage levels for routine childhood vaccination remain low for various reasons, including misinformation about the safety and/or content of vaccines and a strong belief in naturally acquired immunity. while delaware has seen an improvement in coverage rates in pertussis, identified cases are still being reported every few years. pertussis in delaware has ebbed and flowed, with reported case spikes in and . in , cases of pertussis — the state’s largest caseload since — were reported to the division of public health (dph); most were due to an outbreak among the amish. in may , dph learned of a new pertussis outbreak among the amish. as of december , , the case count for that outbreak was total cases, with confirmed and considered probable. most reported cases were in individuals years of age and younger. for comparison with other years, there were pertussis cases in delaware in , in and in (delaware health and social services [dhss], ). for all years, the actual number of cases was likely higher due to underreporting and misdiagnosis. response to pertussis outbreaks these re-occurring outbreaks demonstrate the challenges of addressing disease in the amish population. dph has served generations of the amish and over the past years has strived to gain their trust. amish leaders and midwives serving the population have educated dph staff about their homeopathic approach to treating disease. some within this community do not consider immunization necessary to prevent diseases from occurring, or in response to outbreaks. instead they view getting some diseases and getting over them naturally without the intervention of a vaccine, a ‘rite of passage’. similarly, a study sought to determine the knowledge, beliefs and attitudes among amish communities in ohio. through it, some respondents shared fears of having too many recommended immunizations and that immunizations would overwhelm a child’s own natural immune system. in response to the pertussis outbreak, dph initiated a multi-pronged effort to control the spread of the disease. one of the early activities was to set up a meeting between the dph director, key staff and the amish leadership (bishops). during this meeting, dph staff learned that the primary drivers behind low vaccination rates were misinformation about the makeup and safety of the vaccine, perceived pain and distress to the children during vaccination, and a belief that if you let the disease run its course that children could not be re-infected. the bishops were happy that dph expressed concern about the community’s well-being and indicated they would be willing to distribute educational materials within the community. these educational materials included flyers highlighting the symptoms of pertussis, the benefits of seeking and completing antibiotic treatment, and the benefits and safety of vaccination. distribution of materials occurred at amish owned businesses, as well as businesses frequented by members of the community, physician’s offices, and schools. generally, the distribution of the flyers was well received, however, dph did encounter resistance to its distribution of information in the schools from some parents. amish schools in delaware are not part of the public school system and so distribution of materials from outsiders must be approved by the community’s leadership. for this reason, dph was asked to stop using the school system to distribute information. an important aspect of dph’s outbreak response was epidemiological surveillance and direct contact with the community. dph spent weeks conducting door-to-door case finding and a contact investigation campaign to maximize active surveillance and control measures. teams of dph epidemiologists and clinic nurses visited homes of community members where reports of pertussis had been confirmed, and asked questions to determine if there were other close contacts at risk. from a treatment perspective, updated standing orders allowed for the distribution of antibiotics for treatment and prophylaxis in households where dph identified symptomatic persons and their contacts. the delaware immunization program also made field visits to offer vaccine and antibiotics at the public health clinics throughout the state. during visits, information gained through administering survey questions informed dph’s response. some of those who had received immunizations in the past, or had their children vaccinated for various reasons, but who subsequently stopped getting vaccinated said it was because dph no longer conducted immunization clinics in their community. in the past, dph conducted immunization clinics in the community but stopped due to lack of attendance. it is apparent that since this community is hesitant to seek and find vaccinations, dph must offer immunizations where the amish are most receptive to receiving them. another way dph addressed this issue was to work with a midwife who sees pregnant amish women to provide pertussis vaccines in accordance with the advisory committee on immunization practices (acip). the midwife is a trusted source of medical guidance for amish women in the community. dph is providing the midwife with tdap vaccine so she can vaccinate her clients during their well visits, if the women agree. dph also contacted, and provided information, to chiropractors, who are another source of medical advice for this population. dph also reached out to holmes county general health district in ohio for public health approaches that were successful with their amish communities. holmes county provides health clinics in the amish community that offer immunizations, health screenings, and other services. they also help organize an annual amish health and safety day, which provides another opportunity to share information. in addition to ohio, dph reached out to the state of pennsylvania, who has a large amish populations to understand how they faced vaccine- preventable disease outbreaks. dph’s educational outreach was not limited to the amish community, because ultimately pertussis spread to the non-amish population in delaware. in the outbreak, pertussis cases occurred among non-amish individuals. dph issued a press release to the public through media contacts, and on august , informed health providers by issuing a health alert (https://healthalertde.org/) through the delaware health alert network (dhan). in addition, dph created and distributed a flyer to all licensed medical providers in kent county and asked them to share it with their patients. the flyer announced the outbreak to help engage patients in conversations about receiving pertussis vaccinations and other ways they could protect themselves and their families. through these multi-faceted measures, dph has re-established open lines of communication with the amish community, and hopes that it will encourage more of these individuals to reach out to the agency in the event of future outbreaks. human papillomavirus according to the cdc, every year , women and men are diagnosed with a cancer caused by human papillomavirus (hpv) infection. hpv vaccination could prevent more than % of these cancers ( , cases ever year) from ever developing. hpv vaccinations coverage levels remain low across the nation. in , only percent of adolescents were up to date on the hpv vaccine, and percent of teens ages - years received the first dose to start the vaccine series. according to the national immunization survey (nis), percent of delaware adolescents were up to date on the hpv vaccine, and percent received the first dose to start the vaccine series. although delaware’s hpv coverage rates are above the national average, hpv vaccination rates are much lower than for other adolescent-recommended vaccines within delaware, such as tdap ( . %) and meningococcal ( . %), both recommended at the same time as the hpv vaccine (delaware hpv vaccination report, december ). the lower vaccination rates are not due to lack of vaccine or vaccine availability. in the fiscal year beginning july , to june , , medical providers in delaware ordered , doses of hpv. in the current fiscal year that began on july , , medical providers in delaware have ordered , doses as of january . the cdc estimates that delaware will have ordered enough vaccine to vaccinate all of the -year-olds in delaware this year. yet while sufficient doses are ordered, some providers are not reporting administered doses to the state immunization information system (iis) suggesting that the true vaccination rate is higher than what is reported. to address the issue of low hpv rates, the delaware immunization program recently collaborated with the delaware cancer prevention program and the delaware cancer consortium to identify and implement activities designed to promote hpv awareness and increase immunization rates. the cancer prevention program provided funding to support three projects in order to increase lagging hpv rates within the state. these activities included initiating an hpv media campaign, continuing state immunization information system (iis) reports training for vaccines for children (vfc) providers, and continuing hpv-education workshops for local providers. the hpv education for vfc provider’s project involved contracting with a vendor to conduct this training for approximately vfc providers. dph established a contract with a vendor to recruit and train these providers from november , thru june , . the vendor developed a hpv training curriculum using the cdc’s “you are the key to hpv cancer prevention” guide. these training sessions range from small groups to one-on-one encounters with providers. topics include the benefits of vaccinating at an early age, role play activities to appropriately address parental safety concerns with the hpv vaccine, and utilizing reports within the iis (i.e. coverage level, not up-to- date, patient roster, and reminder recall reports), to improve vaccination rates. the dph also entered into a contract with another vendor to offer vfc providers training on the delaware’s iis reports module to assist them through the assessment, feedback, incentive and exchange (afix) process and help providers increase their immunization coverage rates. the providers receive training on the following reports: . afix snapshot – report allows providers to run immunization coverage levels for specific age cohorts within their practice. . patient roster reports – report allows the provider to identify all the patients within their practice who are currently active in the iis. . patient inactivation reports — report allows the provider to inactivate any patients in the patient roster report that are no longer active within their practice. . not-up-to- date reports – report allows the provider to identify patients that require additional immunizations to be compliant with immunization recommendations. . reminder recall reports – report allows the provider to generate a list of all their patients that require additional immunizations and print out post-card reminders to mail to these individuals. the primary objective is to attempt to mirror the immunization coverage data from a provider’s medical record with the immunization program’s iis and the nis to get a true picture of the hpv coverage rate in delaware. since implementation of the iis report training, the iis hpv coverage rate rose to . % for the first dose, an increase of . % from june , . the up-to- date coverage for the series completion reflects a % increase from december , . the dph cancer prevention and control program contracted with a vendor to develop and implement a statewide marketing campaign that encourages parents of children ages or to have their children receive the hpv vaccine in the same visit when they are vaccinated for other serious diseases, like meningitis and whooping cough. this campaign consists of print, radio, social media, and digital ads; direct mail; and social influencers targeting parents of - year olds. there is a social media plan for facebook and instagram that includes live chat events with physicians, school nurses, or parents speaking on the advantages of getting children vaccinated for hpv, and polls that engage parents using facts and statistics about hpv and the hpv vaccine. a private school outreach plan encompasses hpv presentations at parent events; hpv messaging in parent newsletters or emails; parent/child hpv vaccination videos; and posters and other printed resources to promote hpv awareness. the immunization program continues to conduct afix provider site visits to all vfc providers within the state as part of the federal requirements for the vfc program. during the initial site visits, a dph staff member reviews the current immunization coverage levels for the provider’s practice and discusses issues or barriers contributing to any lower rates. the staff also works with the provider to develop quality improvement activities that they can incorporate into their existing workflow to increase their immunization coverage rates. special attention is given to their hpv coverage rates at this visit and the staff offer the provider educational materials on hpv and encourage them to offer this vaccine in the same way and on the same day that they offer other vaccines at the and -year-old well visits. providers are also encouraged to take the iis reports training class. dph provides registration information during the site visit. dph conducts a follow-up visit six months later to discuss changes in their coverage rate and the progress made on the quality improvement activities. the immunization program saw increased coverage levels in providers who had received these visits and completed the iis reports training. hepatitis a since march , several state and local health departments have battled hepatitis a outbreaks that spread through person-to-person contact. the outbreaks are occurring primarily among persons who use injection and non-injection drugs, and/or among persons who are homeless and their close direct contacts. hepatitis a outbreaks have occurred in california, utah, arkansas, missouri michigan, ohio, kentucky, west virginia, tennessee, north carolina and the city of philadelphia. those outbreaks compelled the acip on october , to recommend that “all persons at least year old who are experiencing homelessness should be routinely immunized against hepatitis a” . delaware’s hepatitis a response since the beginning of october , dph has contacted homeless shelters, transitional housing organizations, and outpatient facilities to provide hepatitis a vaccinations to persons experiencing homelessness. a questionnaire distributed to homeless and residential shelters asked for the number of residents, their ages, if they are required to leave each morning, and what would be a good time for dph to hold a hepatitis a vaccination clinic there, if interested. if a facility expressed interest in hosting a vaccination clinic, the delaware immunization program shared that information with dph’s northern and southern health services teams, who would reach out to schedule one that would fit everyone’s needs. since homeless individuals are transient, a continuous presence at these sites should occur with further vaccination clinics scheduled. for other agencies with homeless clients, but without the capability to provide the hepatitis a vaccine, dph created an educational flyer to give to individuals at intake to start the vaccination conversation. dph also provides vaccination at state service centers located throughout delaware. it is dph’s hope that the shelters will include hepatitis a immunizations as part of their intake policy. this will protect not only the residents of these shelters, but the community at large as the residence interact in their communities. brandywine counseling and community services (bccs), a leading outpatient care provider in delaware, has sites throughout the state and caters to the population that dph has focused on to prevent the spread of hepatitis a. dph collaborated with bccs to provide hepatitis a vaccine at their facilities. the agreement calls for bccs to screen their clients when they arrive to determine their immunization status for hepatitis a. if clients are not up to date on their hepatitis a coverage, bccs will vaccinate them and schedule a date and time for the final dose. if this initiative is successful, and with appropriate budgets and staff support, dph can visualize an effort to immunize all homeless individuals with all vaccines recommended for adults. section vaccine section of the public health service act authorizes the federal purchase of vaccines to vaccinate children, adolescents, and adults. over its -year history, section -purchased vaccine was directed to priority populations. most recently, this included underinsured children ineligible for vfc and uninsured adults. section discretionary funding also supports immunization program operations at the local, state, and national levels. in delaware, while vfc vaccine covers most, if not all children, section vaccine is used in two areas: pandemic response exercises, and uninsured and underinsured adults and children. each year, every state health department is required to perform a point of dispensing exercise (pod). the pod allows dph staff to practice immunizing a large population in a timely manner. since , dph has operated its largest flu clinics as pods, a maneuver with several benefits. combining efforts allows the state to purchase more influenza vaccine to vaccinate those in the general population, and it enables dph to practice their required pod duties. also in , dph provided section -purchased vaccines to ten local federally qualified health centers (fqhcs) and one non-profit provider clinic to assist with immunizing their under- and uninsured adult populations. these vaccines include: tetanus, diphtheria and pertussis/tetanus diphtheria (tdap/td); hepatitis a and b; measles, mumps, and rubella (mmr); human papillomavirus (hpv), varicella, meningococcal b (men b), meningococcal acwy (mcv ), pneumococcal conjugate (pcv ), pneumococcal polysaccharide (ppsv ), and influenza. dph continues to provide these above-mentioned clinics with all adult vaccines as recommended by the acip with the exception of the zoster vaccine. in fiscal year , the state of delaware received approximately $ , in section -vaccine funding, an amount equal to fiscal year . in , dph was able to supply all needed vaccine to these clinics and utilized all funding by the end of the fiscal year. just two months into fiscal year , dph processed adult vaccine orders and spent % of the budget. as of december , , doses of influenza vaccine were distributed using vaccine funds which was a % increase from the number of influenza doses distributed by december . theses doses were distributed as follows; , doses were used for pod activities and , doses were delivered to section providers. these partnerships allow more underserved at-risk adults to receive the immunizations they need. vaccination data is reported to the state immunization information system (delvax). conclusion the dph diligently monitors state vaccine coverage level data and disease outbreaks within and outside delaware’s borders. as a result, dph has collaborated with stakeholders throughout the state to: • implement hpv provider trainings and a state-wide media campaign designed to promote hpv awareness and increase coverage levels, • establish hepatitis a vaccination clinics in sites that provide services for at-risk populations (i.e. homeless shelters, drug treatment centers), and • rapidly responded to a pertussis outbreak by conducting field case investigations, educational outreach, and medical management (antibiotics and vaccinations) as appropriate within the amish community. in addition; dph issued a public health alert regarding the outbreak, distributed pertussis flyers to medical providers in kent county to share with their patients in order to increase awareness and promote vaccinations, and reached out to other states to identify public health approaches that were successful within their amish communities. resources for readers for more information on immunizations for children, adults, and health care providers, visit dph’s immunizations website, http://www.dhss.delaware.gov/dhss/dph/dpc/immunize.html, or call the immunizations hotline at - - - weekdays between : a.m. and : p.m. children without medical insurance may receive free vaccines through the vfc program. for details, call the hotline or visit http://www.dhss.delaware.gov/dhss/dph/dpc/immunize.html to learn more. the cdc’s website, http://www.cdc.gov/vaccines/, offers additional information such as the recommended immunization schedule. health care providers can view the immunization schedule on tablets or smart phones by downloading the cdc vaccines schedules app at www.cdc.gov. references . jennewein, m. ( , jan).vaccination: more than just your health. sitn.hms.harvard.edu. http://sitn.hms.harvard.edu/flash/ /vaccination-just-health/ . state of delaware. ( ). control of communicable and other disease conditions. delaware.gov. http://regulations.delaware.gov/admincode/title /department% of% health% and% social% services/division% of% public% health/health% promotion% and% disease% prevention/ .shtml . cdc. ( , jan). about the national immunization surveys (nis). cdc.gov. https://www.cdc.gov/vaccines/imz-managers/nis/about.html . kettunen, c., nemecek, j., & wenger, o. ( , june ). evaluation of low immunization coverage among the amish population in rural ohio. american journal of infection control, ( ), – . https://doi.org/ . /j.ajic. . . pubmed . cdc. ( , mar). why is hpv important? cdc.gov. https://www.cdc.gov/hpv/hcp/hpv- important.html . cdc. ( ). adolescent human papillomavirus (hpv) vaccination coverage dashboard. cdc.gov/teenvaxview. https://www.cdc.gov/vaccines/imz- managers/coverage/teenvaxview/data-reports/hpv/dashboard/ .html . cdc. ( , aug). hpv vaccination coverage data. cdc.gov. https://www.cdc.gov/hpv/hcp/vacc-coverage/index.html . cdc. ( , nov). you are the key to hpv cancer prevention – train the trainer. cdc.gov. https://www.cdc.gov/vaccines/ed/hpv/you-are-key.html . walker, m. ( , oct). acip: routinely vaccinate homeless against hepa. medpagetoday.com. https://www.medpagetoday.com/meetingscoverage/acip/ . cdc. ( , feb). questions answered on vaccines purchased with funds. cdc.gov. https://www.cdc.gov/vaccines/imz-managers/guides-pubs/qa- -funds.html https://doi.org/ . /j.ajic. . . https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&list_uids= &dopt=abstract delaware faces immunization challenges head-on abstract introduction pertussis challenge response to pertussis outbreaks human papillomavirus hepatitis a delaware’s hepatitis a response section vaccine conclusion resources for readers references . jennewein, m. ( , jan).vaccination: more than just your health. sitn.hms.harvard.edu. http://sitn.hms.harvard.edu/flash/ /vaccination-just-health/ . state of delaware. ( ). control of communicable and other disease conditions. delaware.gov. http://regulations.delaware.gov/admincode/title /department% of% health% and% social% services/division% of% public% health/health% promot... . cdc. ( , jan). about the national immunization surveys (nis). cdc.gov. https://www.cdc.gov/vaccines/imz-managers/nis/about.html . kettunen, c., nemecek, j., & wenger, o. ( , june ). evaluation of low immunization coverage among the amish population in rural ohio. american journal of infection control, ( ), – . https://doi.org/ . /j.ajic. . . pubmed . cdc. ( , mar). why is hpv important? cdc.gov. https://www.cdc.gov/hpv/hcp/hpv-important.html . cdc. ( ). adolescent human papillomavirus (hpv) vaccination coverage dashboard. cdc.gov/teenvaxview. https://www.cdc.gov/vaccines/imz-managers/coverage/teenvaxview/data-reports/hpv/dashboard/ .html . cdc. ( , aug). hpv vaccination coverage data. cdc.gov. https://www.cdc.gov/hpv/hcp/vacc-coverage/index.html . cdc. ( , nov). you are the key to hpv cancer prevention – train the trainer. cdc.gov. https://www.cdc.gov/vaccines/ed/hpv/you-are-key.html . walker, m. ( , oct). acip: routinely vaccinate homeless against hepa. medpagetoday.com. https://www.medpagetoday.com/meetingscoverage/acip/ . cdc. ( , feb). questions answered on vaccines purchased with funds. cdc.gov. https://www.cdc.gov/vaccines/imz-managers/guides-pubs/qa- -funds.html pone. .. fam-mdr: a flexible family-based multifactor dimensionality reduction technique to detect epistasis using related individuals tom cattaert , *, vı́ctor urrea , adam c. naj , lizzy de lobel , vanessa de wit , , mao fu , jestinah m. mahachie john , , haiqing shen , m. luz calle , marylyn d. ritchie , todd l. edwards , kristel van steen , montefiore institute, university of liège, liège, belgium, groupe interdisciplinaire de génoprotéomique appliquée - research, university of liège, liège, belgium, department of systems biology, university of vic, vic, spain, miami institute for human genomics, university of miami, miami, florida, united states of america, department of applied mathematics and computer science, ghent university, ghent, belgium, school of medicine, university of maryland, baltimore, maryland, united states of america, center for human genetics research, vanderbilt university, nashville, tennessee, united states of america abstract we propose a novel multifactor dimensionality reduction method for epistasis detection in small or extended pedigrees, fam-mdr. it combines features of the genome-wide rapid association using mixed model and regression approach (grammar) with model-based mdr (mb-mdr). we focus on continuous traits, although the method is general and can be used for outcomes of any type, including binary and censored traits. when comparing fam-mdr with pedigree-based generalized mdr (pgmdr), which is a generalization of multifactor dimensionality reduction (mdr) to continuous traits and related individuals, fam-mdr was found to outperform pgmdr in terms of power, in most of the considered simulated scenarios. additional simulations revealed that pgmdr does not appropriately deal with multiple testing and consequently gives rise to overly optimistic results. fam-mdr adequately deals with multiple testing in epistasis screens and is in contrast rather conservative, by construction. furthermore, simulations show that correcting for lower order (main) effects is of utmost importance when claiming epistasis. as type diabetes mellitus (t dm) is a complex phenotype likely influenced by gene-gene interactions, we applied fam-mdr to examine data on glucose area-under-the-curve (gauc), an endophenotype of t dm for which multiple independent genetic associations have been observed, in the amish family diabetes study (afds). this application reveals that fam-mdr makes more efficient use of the available data than pgmdr and can deal with multi-generational pedigrees more easily. in conclusion, we have validated fam-mdr and compared it to pgmdr, the current state-of-the-art mdr method for family data, using both simulations and a practical dataset. fam-mdr is found to outperform pgmdr in that it handles the multiple testing issue more correctly, has increased power, and efficiently uses all available information. citation: cattaert t, urrea v, naj ac, de lobel l, de wit v, et al. ( ) fam-mdr: a flexible family-based multifactor dimensionality reduction technique to detect epistasis using related individuals. plos one ( ): e . doi: . /journal.pone. editor: zoltán bochdanovits, vu university medical center and center for neurogenomics and cognitive research, vu university, netherlands received january , ; accepted march , ; published april , copyright: � cattaert et al. this is an open-access article distributed under the terms of the creative commons attribution license, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. funding: the first author is a postdoctoral researcher of the fonds de la recherche scientifique - fnrs. this work is also partially supported by grant mtm - -c - from the ministerio de ciencia y tecnologia, spain, by the belgian network biomagnet (iap p / ), funded by the interuniversity attraction poles programme, initiated by the belgian state, science policy office, and by the ist programme of the european community, under the pascal network of excellence, ist- - . the funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. competing interests: the authors have declared that no competing interests exist. * e-mail: tom.cattaert@ulg.ac.be introduction the international hapmap project [ ] was designed to create a genome-wide database of human genetic variation, with the expectation that these data would be useful for genetic association studies of common diseases. this expectation has been fulfilled with just the initial output of genome-wide association analyses, identifying nearly loci for over common diseases and traits [ , ]. despite these successes, it has become clear that usually only a small percentage of total genetic heritability estimates can be explained by the identified loci. for instance, for inflammatory bowel disease (ibd), loci significantly impact disease but they explain only % of disease risk and % of genetic risk [ ]. this may be attributed to the fact that recent findings show many types of genetic associations for various traits, with subtle effects: non- additive genetic effects, non-snp polymorphisms, epigenetic effects, but also gene-environment and gene-gene interactions [ ]. the role of genetic interactions in explaining phenotypic variability has been described in several publications [ , , , , , , , , , ]. interactions may lead to inconsistent results from the masking of associations, they can be suggestive of important pathogenic mechanisms and may elucidate relevant opportunities for intervention [ , ]. epistasis, defined as the deviation from additivity of effects observed at multiple genetic exposures [ , ], may also explain part of the genetic heritability that is left unexplained for most complex disorders [ ]. these reasons have made epistasis an increasingly accepted characteristic of the genetic architecture of common, complex disorders [ , , , ]. one of the potential reasons for the small number of large-scale genetic interaction studies performed in humans so far is that plos one | www.plosone.org april | volume | issue | e although genetic interactions identified from model organisms provide insight into biological processes, these biological processes often lack sufficient overlap with other types of gene/protein associations with traits of interest [ , ]. also, the relatively low success rate of large-scale epistasis searches to date may simply reflect the limited ability to assess the many possible modes of interaction, including pairwise interactions and threshold effects [ ] or inadequate solutions given to a difficult statistical challenge [ ]. in addition, subtle variation in allele frequency can either introduce an interaction effect and likewise remove an interaction effect from a particular dataset; this can make detection of epistasis effects quite challenging [ ]. overviews of methods for epistasis detection were given by cordell [ , ] and by onkamo and toivonen [ ]. one non-parametric approach developed for epistasis analysis is multifactor dimensionality reduction [ , , ] (mdr). since its conception, many methodological and applied papers have emerged that build on or use mdr. to our knowledge, the current state-of- the-art mdr-related method that can accommodate nuclear families of any size and different types of outcome variables is the recently proposed pedigree-based generalized mdr method [ ] (pgmdr) which generalizes the generalized mdr method [ ] (gmdr) to family data. its competitor, the mdr pedigree disequilibrium test [ ] (mdr-pdt), is only suited for case- control data and does not allow for covariate adjustments. similar to mdr, gmdr uses prediction accuracy measures for best model selection. significance assessment is based on random permutations. to easily accommodate continuous traits and variable adjustments, gmdr is based on scores of a (generalized) linear model. in the special case of no covariates and a binary outcome it reduces to the classical mdr. pgmdr first constructs a non-transmitted genotype for every non-founder in the pedigree. when parental genotype information is missing, pgmdr samples one realization of the nontransmitted genotype from the conditional distribution given the minimal sufficient statistic for the null hypothesis through an algorithm that is modified from rabinowitz and laird [ ]. second, the non-founders and the non-transmitted genotypes are analyzed by the gmdr algorithm. significance assessment is again based on permutations. to maintain the correlation structure within the families, families as a whole are used as permuting units and the transmitted and non-transmitted sets in a whole family are randomly shuffled. pgmdr software is available from the url http://www. healthsystem.virginia.edu/internet/addiction-genomics. the need for new statistical methods to overcome some of the remaining statistical hurdles in epistasis detection, has led to the development of fam-mdr. the method combines features of the grammar approach [ ] with features of model-based mdr [ ] (mb-mdr). in the materials and methods section, we introduce the fam- mdr algorithm and describe our extensive simulation study to examine type i error and power of this approach. to examine the application of fam-mdr to determine epistasis in family studies of a complex disease, we examined data on glucose area-under- the-curve (gauc), an endophenotype of type diabetes mellitus (t dm) for which multiple independent genetic associations have been observed, in the extended pedigrees of the amish family diabetes study [ ] (afds). subsequently, we describe the power and type i error performance of fam-mdr in our simulations and application to afds, as well as a comparative study between fam-mdr and pgdmr, in the results section. finally, the discussion elaborates on the significance of our results, and the relevance of its application to finding gene-gene interactions in a complex disease like t dm. materials and methods the fam-mdr algorithm fam-mdr is an acronym for family multifactor dimension- ality reduction and is an adaptation to related individuals of the model-based multifactor dimensionality reduction method [ ] (mb-mdr) for epistasis detection with unrelated individuals. an implementation of the fam-mdr algorithm is available through the url www.statgen.be. the approach consists of two parts. part i: in order to deal with familial correlations between observations, data are first analyzed using a polygenic model yi~mzgizei , ð Þ with i indexing individuals, g distributed mvn( ,ws poly) and e distributed mvn( ,i s env), representing the additive polygenic and environmental effects respectively. the polygenic effect has variance s poly and is correlated within families, with correlation matrix equal to the relationship matrix w. for the calculations we use the polygenic function of r package genabel [ , , , ]. this package can be retrieved from the url http://cran. r-project.org/web/packages/genabel/index.html. the rela- tionship matrix w can be derived either theoretically from the pedigree structure, or can be estimated from the available genomic data, in which case the genomic kinship is computed [ ]. genomic kinship is to be preferred when genome-wide data are available, but of course in a candidate gene study genomic kinship cannot be estimated in a reliable way and one will have to use pedigree kinship [aulchenko, genabel tutorial]. the environ- mental variance s env is assumed to be the same for all individuals. in addition, environmental effects are assumed to be independent between individuals, whether belonging to different families or within the same family, giving rise to an environmental variance- covariance matrix i s env (i : the identiy matrix of rank equal to the number of individuals). the residuals êei~yi{(m̂mzĝgi ), ð Þ that have been derived from ( ), are free from polygenic familial correlation and can serve as new familial correlation-free traits to be used in a genetic association analysis with measured genetic markers. as a remark, m̂m and ĝgi are estimates of mean m and polygenic effect (or breeding value) gi obtained by the expectation-maximisation (em) algorithm using the maximum likelihood (ml) paradigm, hence maximizing the joint likelihood of fixed effects and variance components [ ]. in the grammar approach of aulchenko et al. [ ], such a genetic association analysis targets associations with single markers, one at a time, and is fully parametric in nature. in contrast, in the fam-mdr approach, associations with multiple loci at once are evaluated. part ii: once the data have been prepared in part i, fam- mdr proceeds with investigating the association between the newly defined trait ynew~êei from part i (in particular the aforementioned residuals) and multi-locus measured genotypes, using the potentially fully-parametric mb-mdr method (figure ). it is justified to apply mb-mdr, that was developed for unrelated individuals, to these residuals. indeed, conditional on the observed genotypes all the familial correlation has been accounted for. moreover, mb-mdr flexibly deals with different outcome types, including those measured on a continuous scale. like mdr, mb- mdr reduces a high-dimensional interaction space to a - fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e dimensional space, by assigning genetic effect size labels to multi- locus genotypes, which will be further referred to as risk labels. key steps involved in a fam-mdr part ii analysis are summarized graphically in figure . because some characteristics of mb-mdr have been altered in the fam-mdr algorithm, we summarize the key steps and properties of mb-mdr, and point out changes we made to the initial mb-mdr algorithm. throughout this paper, for ease of exposition, we focus on two-locus models and diallelic markers, although both mb-mdr and fam-mdr are applicable in principle to more general settings as well. in mb-mdr step , for a selection of a pair of snps, each genotype cell is tested against the eight others for association with the trait. the cells that are found to be significantly associated with the outcome, at a liberal threshold of . , are then called high risk (h ) or low risk (l) based on the position of the selected association measure (e.g. t statistic or odds ratio) in the spectrum of all possibilities. those cells that are not significant at the threshold . are labeled as non-evidence cells (o). for a more detailed discussion of the mb-mdr method we refer to calle et al. [ ] and also to their technical report available from the url http:// www.recercat.net/handle/ / . in step , two additional tests are performed for association with the trait: testing h versus fl,og and testing l versus fh ,og. this gives rise to two wald-type statistics of association, wh and wl, that are either derived from a parametric or a non-parametric testing approach. in step , the significance of wh and wl is assessed through permutations. this is different from the classical mb-mdr implementation, but is an elegant way to compensate for the data snooping in mb-mdr steps – and to correct for the otherwise overly optimistic test results. note that in the initial implementa- tion of mb-mdr, depending on the number of combined cells in either the high (low) risk cells pool, a different null distribution for the corresponding wald test statistic wh (wl) was derived. these marginal null distributions were generated by simulating reference data with similar characteristics. the multiple testing issue that arises when considering different snp pair combinations, is tackled by mb-mdr [ ] using bh-fdr (benjamini-hochberg false discovery rate) methodology.[ ] because of the afore- mentioned dependency on number of combined cells, and the complexity of the significance assessment via a simulation-based null distribution derivation in step , we chose to implement a different approach. fam-mdr therefore implements a permuta- tion strategy by simply randomly permuting the familial correlation-free residuals ( ) obtained in fam-mdr part i. this assumes a general null-hypothesis of no association between any of the measured markers and trait (no main effects, no interaction effects). this strategy does not depend on the number of combined cells, nor on reference data.although mb-mdr allows in principle for multiple model selection, we have furthermore restricted the approach to select only the best model, for the purpose of comparison with pgmdr. in particular, we derive the permutation null distribution of the maximum test statistic, i.e. maximized over the two different tests (wh and wl) and all two- snp combinations j: maxh=l,j (wh,j ,wl,j ) and recommend replications for doing so. moreover, we emphasize that corrections for main effects and covariate adjustments are also possible in fam-mdr and we figure . summary of the steps involved in a fam-mdr analysis. the figure shows the three steps of fam-mdr part ii on one of the simulated datasets for model m , p~ : , g ~ : and h ~ : , for the analysis without main effects correction. doi: . /journal.pone. .g fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e choose to carry these out prior to association testing. extending the polygenic model ( ) to a (two-locus) measured genotype (mg) model [ ] with the particular main effect/covariates present in the model, has several advantages over adjusting while identifying risk cells and/or testing for association between new one- dimensional genetic constructs and the trait of interest. first, it leads to more stable parametric estimations when adopting a parametric regression approach in fam-mdr part ii. second, a priori adjustment paves the way for a fully non-parametric epistasis screening and thus faster mb-mdr runs on adjusted residuals. nevertheless, for the purpose of this paper, we will continue to use the parametric linear model paradigm (in fact the one-parameter wald test is equivalent to the student t-test) and not the non-parametric alternative, the wilcoxon rank sum test. third and most importantly, when residuals are free from identified important main effects, the null hypotheses of no association and of no epistasis become equivalent and the permutation procedure is a correct procedure for claiming epistasis, i.e. association above and beyond the main effects corrected for in fam-mdr part i. finally, a note on how fam-mdr handles missing data. for missing genotypes, fam-mdr uses the available cases (ac) paradigm. in other words, if a particular pair is considered, only individuals with complete data for this pair are included in the analysis, while individuals with missing data for one or two snps involved are not considered. individuals with missing trait values are used in fam-mdr part i only when they are useful for deriving the relationship matrix, but never for the polygenic calculations themselves. indeed, if the number of markers is small, the theoretical relationship matrix is used and the complete pedigree is needed for calculating this in a correct way. when the number of markers is large, fam-mdr relies on the genomic kinship matrix and there is no need to keep individuals with missing trait values in the analysis. note that since we are not using the individuals with missing trait values for the polygenic calculations, we essentially are performing a complete case (cc) analysis. also, when correcting for main effects/covariates - since we only use those individuals with complete data on the main effects/covariates that are regressed out in part i, we are again following the cc paradigm. in part ii, fam-mdr obviously does not use missing new trait values, whether these are due to missing trait values or missing main effects/covariates adjusted for. missing new trait values are also not included in the permutation procedure. it is good to recall that both ac and cc are valid under a missing completely at random (mcar) missingness process [ ]. simulation study we simulated data consisting of nuclear families, with the number of children drawn from a multinomial distribution with probabilities / to have one child (hence a trio), / to have two children, and / to have three children. on average, this gave rise to individuals. we assumed that no data were missing. in other words, complete information on genotypes at all loci and complete information on phenotypes were available. to generate genotypes for these individuals, we first generated ten diallelic markers: snpl ,l~ ,:::, , in linkage equilibrium. in addition, we assumed hardy-weinberg equilibrium for every generated marker. in other words, the genotype frequencies can be determined from the allele frequencies as follows: fl ~( {pl ) , fl ~ pl ( {pl ), and fl ~p l . the allele frequencies of a non- functional snp, snpj was fixed at pj ~ : z(j{ ) : , j~ ,:::, , whereas the allele frequencies of the functional snp pair snp ,snp ð Þ were taken to be equal, and varied as (p ,p )~(p,p), p[f : , : , : g. parental genotypes were then drawn according to the population genotype frequencies above. children’s genotypes were assumed to follow mendelian inheritance patterns. assuming the presence of additive polygenes and a residual environmental effect, phenotypes were simulated according to the (two-locus) mg model yi ~mk i ,k i zgizei , ð Þ with the notations of expression ( ) before. note the difference of the fixed effect mean term, m in ( ), which is replaced by mk i ,k i in ( ). here, kli refers to the minor allele count kl[f , , g for individual i and mk k represents the mean trait values according to the functional snp pair. trait values per family were then sampled from a multivariate normal distribution, with as components of the mean vector the trait mean values mk i ,k i corresponding to the two- locus genotypes that the individuals constituting the family belong to, and as variance-covariance matrix the part of ws polyzi s env pertaining to that family. in what follows, we explain in detail the simulation parameter settings of our choice. first, we notice that the population two-locus model variance s loci is computed as a weighted sum of squares, with weights determined by population genotype frequencies (exploiting no ld between the markers) s loci~ x k x k f k f k (mk k {m::) , ð Þ in which the overall mean m:: is computed as m::~ x k x k f k f k mk k : ð Þ in a similar way, the single-locus means and variances are respectively given by mk :~ x k f k mk k , ð Þ m:k ~ x k f k mk k , ð Þ and s ~ x k f k (mk :{m::) , ð Þ s ~ x k f k (m :k {m::) : ð Þ hence, since p ~p , and therefore also s ~s , the epistatic variance s epi , defined as the part of the two-locus model variance that is not explained by the contributing loci separately, is given in our simulation settings by s epi~s loci{ s . different contributions to the two-locus model variance of the epistatic variance s epi or the main effects model variance will be important in interpreting simulation results. fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e the total phenotypic variance, which is given by s tot~s locizs polyzs env, ð Þ was kept fixed at s tot~ for all simulations. the total heritability h of the trait, defined as h ~ s locizs poly s tot , ð Þ was taken to be h [f : , : , : g. the proportion g of the total variance s tot explained by the total two-locus model variance s loci , g ~ s loci s tot , ð Þ varied as g [f , : , : , : , : , : g. because of the afore- mentioned assumptions, and the definitions for h and g , we have s loci~g , s poly~(h {g ), and s env~( {h ). hence, given h and g , the three variance contributions are completely deter- mined. since only snps were considered in all scenarios, the relationship matrix was derived from the nuclear family actual relationships. second, the fixed mean part in ( ) needs to be determined. for this, we consider two two-locus models, m and m , of li and reich [ , ]. the key feature of model m is that phenotypic means increase when for both loci at least one variant allele is present. in contrast, in model m increased phenotypic values occur only when at one (and only one) locus a heterozygous genotype is observed. explicitly, models m and m are respectively determined by mm k i k i ! b@ ca, ð Þ and mm k i k i ! b@ ca: ð Þ it is important to realize that the two-locus variance s loci , can be computed from the genotype-specific means mk k above and the minor allele frequency p. hence, since the total trait variance s tot was set to , and since particular values for the two-locus model heritability g were also pre-specified, the means in ( ) and ( ) are actually proportional to the specifications to the right of the corresponding expression. to enhance the interpretation of future simulation results, it is instructive to more closely look into the decomposition of the two- locus model variances for models m and m into main effects and epistatic variance (table ). we observe that for model m the contribution of main effects becomes increasingly important with increasing p, whereas for model m the reverse is true, leading to a pure epistasis scenario for p~ : . the two different genetic two-locus models (m and m ), three possible minor allele frequencies p of the causal snp pair, different non-zero values for g and three different values for the total heritability h , lead to a total of simulation settings. for each of these settings data sets were simulated. under the general null hypothesis of no association with the trait (no main effects, nor two-way interaction effects), in particular, g (~s loci )~ , the different genetic models m and m are irrelevant. the three possible choices for the minor allele frequency p of the causal snp pair, and the three possible values for h result in nine different general null hypothesis simulation settings. for each of these settings we generated datasets. because we are primarily interested in detecting epistasis effects above and beyond main effects, when these main effects are present, we also generated a different type of null data, under the null hypothesis of no epistasis, but main effects. hence, g w and mmaink k ~mk :zm:k , ð Þ effectively reducing the two-locus variance to s vs loci , while increasing the polygenic variance. for each of the simulation settings, we again generated datasets. to reduce the computational burden of our extensive simulation study, we adopted a sequential approach [ ] during the permutation step of fam-mdr (fam-mdr part ii step ). we carried out the permutation calculations in batches of , and each time evaluated a go or no go to continue or not, setting the maximum number of permutations to . to this end, we determined the binomial ( {c) % confidence interval of the significance level a at the current number of permutations, with a~ : and c~ : . if the current estimate of the permutation p- value fell outside this confidence interval, the permutation procedure terminated and a definite conclusion about significance or non-significance was made. if the current estimate of the permutation p-value fell inside the confidence interval, no decisions were made about significance and an additional batch of permutations were performed. a drawback of this sequential approach is that no accurate estimate of the permutation p-value is output. hence, whereas it serves its purpose for simulation studies, it is less well suited for real data applications. only to enhance an honest comparison of simulations results with pgmdr, we also introduced a liberal version of fam-mdr, referred to as fam-mdr*. in contrast to pgmdr [ ] and gmdr [ ], for which the permutation null distribution is only derived with respect to the actual snp pair identified by the initial epistasis screening, fam-mdr screens all snp pairs in a permuted dataset. by doing so, fam-mdr assesses significance of the best snp-pair, while appropriately correcting for multiple testing. fam-mdr* assesses marginal significance of the best table . relative importance of main effects and epistatic variances for different two-locus models. m m p main epist. main epist. . . . . . . . . . . . . . . . abbreviations: main = ratio s � s loci of each of the main effects variances s to the two-locus variance s loci , epist. = ratio s epi . s loci of the epistatic variance s epi to the two-locus variance s loci . doi: . /journal.pone. .t fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e model by computing the empirical marginal p-value of the pair found. this was done by only maximizing over the two test statistics wh and wl, and by restricting attention to the specific pair jfound identified via the initial epistasis data analysis: maxh=l wh,jfound ,wl,jfound � � . although fam-mdr* is less com- putationally intensive, it leads to overly optimistic results, and increased false positive rates, just like pgmdr. in line with pgmdr [ ], permuations were used to estimate significance, hence no sequential approach is adopted. finally, we analyzed all simulated datasets with both fam- mdr and fam-mdr*. we applied pgmdr to all simulation settings with non-zero epistasis, and to (out of ) generated data sets for each of the simulations settings under the general null hypothesis of no association. every analysis is carried out once with and without main effects correction. the former involves adjusting for snp and snp by assuming a co-dominant mode of inheritance. the analysis with correction for main effects leads to the detection of two-locus effects beyond co-dominant main effects. the analysis without correction for main effects leads to the detection of a two-locus model but without giving a clue about whether this model is genuinely indicative for epistasis or for main effects, or for both. in pgmdr analyses, and when correcting for snp and snp main effects, we created two dummy variables for each of the causal snps and submitted them as covariates to the pgmdr software. amish family diabetes study the amish family diabetes study [ ] (afds) is a study to identify the genetic determinants of type diabetes and related traits in multi-generational extended pedigrees from the old order amish (ooa) community, a genetically-isolated group in lancaster county, pennsylvania. for this analysis, we examined genotype data for snps in five diabetes candidate genes, adipocnectin receptors and (adipor , adipor ), adiponectin (apm , also known as adipoq), calsequestrin (casq ), and hepatocyte nuclear factor a (hnf a), in individuals from a single large multi-generational pedigree subdivided into independent families for analysis and snps. in previous analyses in the afds [ , , , ], rs in hnf a [ ], rs and rs in casq [ ], and rs in adipor [ ] were found to be significantly associated with the continuous trait glucose area under curve (gauc). the latter was estimated using the trapezoid method from glucose levels taken at -minute intervals in a three-hour oral glucose tolerance test (ogtt) administered to all afds subjects without a prior history of diabetes [ ]. we examined log (gauc) as our continuous trait of interest, in non-diabetic individuals with gauc measure- ment available, setting gauc to missing for diabetics and individuals with unknown diabetes status because for diabetics the gauc measurement is expected to be biased. we took the natural logarithm of gauc because the shapiro-wilk test strongly rejected normality of the residuals of the polygenic model in an analysis on gauc itself, whereas it did not so in an analysis on log (gauc). after removing mendelian errors as found by fbat (downloadable from url http://www.biostat.harvard.edu/ ,fbat/default.html), we used the check.marker function of r package genabel on these non-diabetics with gauc measurement available. we put extr.call and extr.perid.call equal to . , so that markers and individuals with call rates below . are removed prior to main analysis. for the main analysis we put callrate and perid.call to . so we discard iteratively markers and individuals with call rates below . . we discarded four snps, rs and rs in adipor , and rs and rs in casq , due to low callrates. all markers had minor allele frequencies above %. we also discarded individuals due to low callrates, by putting their gauc measurement to missing. all analyses are based on the remaining markers and individuals. in order to derive the correct relationships between the individuals of interest, fam-mdr also makes use of the remaining individuals without gauc measurement available and – in order to recognize relationships between offspring – of additional parental information ( parents, without genotype nor phenotype information). hence, ‘‘information’’ of individuals was exploited by fam-mdr. the individuals of interest correspond to independent families. of these, consisted of unrelated single individuals with no genotyped first- degree relatives, were nuclear families (comprising of the individuals or interest), and were multi-generational families. however, these families included or % of the individuals. because the present pgmdr implementation cannot deal with large multi-generational (non-nuclear) pedigrees, and only for reasons of comparison between pgmdr and fam-mdr, we split multi-generational pedigrees into nuclear families. in the resulting set of nuclear pedigrees, individuals were represented twice, most often as offspring in one pedigree and parents in another. the net result of the splitting process was a set of non-independent nuclear families, comprising ( = + ) individuals. of the individuals with gauc measurement available, were represented twice, resulting in a total of individuals of interest to us, in non-independent families. of these families, were part of the extended pedigrees, while the remaining were mutually independent. there is clearly a need to account for the lack of independence between these nuclear families. unfortunately, the pgmdr software is unable to do so. solely for reasons of comparison, fam-mdr was applied to the split-pedigree data, as well as to the original multi- generational family data. analyses were carried out with and without correction for the main effects of rs in hnf a, rs and rs in casq , and rs in adipor . they were regressed out in fam-mdr part i, or entered as covariates in pgmdr, using co- dominant coding. p-values were based on permutations for both pgmdr and fam-mdr, hence no stopping rules were used. the significance level was set at a~ : . without main effects correction, fam-mdr on the original data uses all individuals with gauc value available. when correcting for main effects, missing genotype information contributes to an increased missingness rate for the new trait values. here only or % of the individuals have non- missing new trait values. on the split-pedigree data, individuals are available for fam-mdr without main effects correction, and for fam-mdr with main effects correction. note that this is in fact an artificial increase in sample size of % and % respectively. in contrast to fam-mdr, pgmdr works with the transmitted genotype information. of the individuals with a gauc value available, the unrelated individuals (singletons) obviously did not have parental information available, giving rise to individuals eligible for pgmdr analysis. furthermore, whenever genotypes for any snp are completely missing for a family, pgmdr simply discards the whole family from the entire epistasis screening. as a result, pgmdr uses only individuals in an analysis without correction for main effects, and individuals in an analysis with main effects correction, amounting to reductions of % and % compared to the corresponding fam-mdr analyses. consequently, pgmdr does not use all information available. fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e results simulation study as a quality check on the simulated data, we first assessed the values of the hardy weinberg and linkage disequilibrium correlation coefficients rhw and rld, in the parents only. all correlation coefficients were consistent with the theoretical value of . more specifically, we observed that for all considered simulation settings the % confidence intervals of the correlation coefficients rhw and rld lied within the range ½{ : , : �. we have also fit a full mg model with a covariate coding for the exact dichotomization that is behind our models. in this way we were able to consistently estimate the effect sizes, showing that our data are indeed behaving in the way we intended. we first considered simulation results under the general null hypothesis of no association (no main effects, no two-order interactions). empirical type i error rates were defined as the number of times the selected best -locus model was assessed significant, divided by the number of simulations. from table , we notice that fam-mdr typically gives smaller empirical type i error rates than the nominal type i error rate of a~ : . in other words, fam-mdr has the tendency to be conservative. in contrast, fam-mdr* and pgmdr are much too liberal. the latter is not surprising, since both fam-mdr* and pgmdr completely ignore the multiple testing issue. these results are confirmed by figure , showing the probability-probability (pp) plots of the p-value distributions under the general null hypothesis of no association for p~ : and h ~ : . the pp-plots are based on datasets and permutations, without stopping rule to obtain exact p-values. the plots show the expected ordered p- values (i{ = )= on the horizontal axis and the observed ordered p-values p(i) on the vertical axis. by consequence, a certain theoretical significance level on the vertical axis can be related to a particular empirical type i error rate on the horizontal axis. for fam-mdr (panel a) the curve lies slightly above the diagonal, indicating a rather conservative approach. for fam- mdr* (panel b) and pgmdr (panel c) the curve lies far below the diagonal, pointing to an extremely liberal approach. only when performing the pgmdr on simulated data with two functional (and no non-functional!) snps (panel d), the pp-plot looks acceptable, although rather conservative as well. second, we considered the simulated null data under the null hypothesis of no epistasis, in the presence of main effects. if under this null a two-locus model is identified (that is, a two-locus model is assessed significant), then a type i error has been made with regard to the null hypothesis of no interaction, and the significant result may be largely driven by main effects. type i error rates for a variety of scenarios are given in table . the analyses correcting for main effects have reasonable type i error rates, although also they tend to be rather conservative. this holds for both models m and m . the analyses not correcting for main effects have the tendency to give rise to an increased number of false positives. this increase is sometimes dramatic, going even up to . the estimated type i error rates point towards the importance of using analysis techniques that are able to appropriately account for important lower order effects. the observation that type i error rates increase with increasing values of g , is to be expected. indeed, when g increases, also the main effects variance increases. moreover, as the minor allele frequency p of the functional snps increases, type i error rates increase for model m but decrease for model m . this can be explained by the relative importance of the main effects with varying p for the different models (table ). note that for model m and p~ : no results are stated because this situation corresponds to a pure epistasis scenario. figure s (supporting information) gives a graphical illustration of the liberal type i error rates. panel d shows results for the analysis not correcting for main effects on data generated under the null of no epistasis for model m and the extreme g ~ : . we observe that the probability-probability plot in this setting is perfectly horizontal at height . this extreme case corresponds to the fact that the type i error rate is for this situation. third, we considered simulated data under the alternative hypothesis of epistasis (possibly in the presence of main effects). for every simulation setting, empirical power was defined as the number of times the correct pair snp ,snp ð Þ was selected and declared significant, divided by the number of simulated data sets. for pgmdr, it happened that two or even three models were reported by the software. in this event, the reported models had exactly the same cross-validation consistency, and we selected the model with the lowest permutation p-value. in the rare event that also the reported permutation p-values were tied, we made a random choice, except when the true functional model was among the reported results. in the latter case, we always selected the true functional model among the tied results. table gives an overview of the simulation results under a variety of alternative hypotheses. figure displays our findings graphically for h ~ : . in the supporting information, we give additional power graphs for h ~ : and h ~ : , for model m (figure s ) and model m (figure s ), but these do not fundamentally differ from those for h ~ : . in general, fam-mdr has systematically higher power than pgmdr, even with appropriate correction for multiple testing. note that fam-mdr* may well be the most powerful approach but, like pgmdr, it does not appropriately handle multiple testing problems. there are a few exceptions to these general observations. however, in these exceptional cases, the power gain of pgmdr is always very small, and the apparent better performance of pgmdr can just as well be due to sampling variability. indeed, the standard error of a binomial proportion is about . for simulated datasets. the results of table show that power estimates increase with increasing two-locus heritability g . our simulation data does not show a systematic trend with increasing total heritability h . when correcting for main effects, table . type i error rates under the general null hypothesis of no association. corr. no c. p h f f* pg f f* pg . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . results are based on simulated datasets for each setting for fam-mdr and fam-mdr* and datasets for pgmdr. as an aid to interpretation the type i error rates § : are indicated in bold. abbreviations: corr. = with main effects correction, no c. = without main effects correction, f = fam-mdr, f* = fam-mdr*, pg = pgmdr. doi: . /journal.pone. .t fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e the power decreases with minor allele frequency p for model m . the reverse is observed for model m . this can be explained by the proportion s epi . s loci of the epistatic variance to the total two-locus variance, varying with p for the two models in a different way, as given in table . for example, for model m and p~ : , in which case the ratio s epi . s loci is only . , the power is very low. for the analysis without correction for main effects, power is less dependent on p and high power levels are probably indicative for excessive type i error rates due to lower order effects signaling through to the higher order models. correcting for main effects generally gives rise to lower power estimates than not correcting for main effects (table and figure ). there are two reasons for this. first, the epistatic variance s epi (targeted by an analysis with correction for main effects) is generally smaller than the total two-locus variance s loci (which is the focus of an analysis without correction for main effects). consequently, larger sample figure . probability-probability plots based on replicates under the complete null hypothesis of no association. data are generated with no main effects and no two-way interaction effects, with p~ : and h ~ : . analyses are performed without correction for main effects. the first three panels show results of fam-mdr (a), fam-mdr* (b) and pgmdr (c) for the usual situation study considering snps. the final panel (d) shows pgmdr results when only snps are considered. the straight lines indicate the theoretical probability-probability curve (light blue) and the % significance level (dark blue). doi: . /journal.pone. .g fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e sizes are needed to enable epistasis detection. second, there is some efficiency loss because every main effect corrected for contributes two degrees of freedom (as main effects were coded as co-dominant effects). that there is a price to pay for estimating additional parameters can most clearly be deduced from the results for model m and p~ : (pure epistasis), for which we still observe the reduction in power for the analysis with main effects corrections over an uncorrected analysis. another example is that for model m with p~ : the analyses without main effects corrections g ~ : have higher power than the corrected analyses for g ~ : , although in the first case s loci~ : and in the second case s epi~ : . amish family diabetes study table shows the results of epistasis screening with fam- mdr and pgmdr on the split pedigree data, and of fam- mdr on the multi-generational pedigree data, both with and without correction for co-dominant main effects of rs in hnf a, rs and rs in casq and rs in adipor . without correction for main effects, fam-mdr on the cut-pedigree data finds a significant two-locus model involving rs in casq and rs in apm . when performing a main effects correction, the same best interaction model is identified. however, the interaction is significant only at the % significance level, suggesting that the two-locus model is to some extent driven by the main effect of rs . pgmdr without main effects correction does not lead to a significant interaction. with correction for main effects, pgmdr reports a different near-significant two-locus model involving rs in casq and rs in hnf a. fam- mdr on the original data, with or without correction for main effects, does not yield any significant two-locus models. possible explanations for these contradicting results are reviewed in the discussion section. discussion the objectives of this paper were to introduce a new family- based and flexible epistasis detection analysis method, fam- mdr, which is based on multifactor dimensionality reduction of multi-locus genotypes, and to compare it to the current state-of-the art mdr methodology for families, pgmdr. although principles of the initial mdr approach are adopted in fam-mdr, there are some clear differences. these include an alternative way to identify risk categories associated with multi-locus genotypes, the flexibility to use any outcome type, the possibility to correct for lower order effects, covariates or confounding factors, the possibility to assess significance of multiple higher-order interaction models. since model selection is not based on evaluating prediction accuracy but on testing associations, fam-mdr does not involve computa- tionally intensive cross-validation steps. fam-mdr consists of two parts. in part i, residuals are derived from a polygenic model, removing additive polygenic effects and possibly important lower-order effects or confounding factors. these residuals are subsequently considered as new traits for the second part of fam-mdr. in part ii, the familial correlation-free residuals are submitted to the mb-mdr algorithm and either the best model (considered in this manuscript), or multiple epistasis models are checked for their significance. in contrary to first implementations of the mb-mdr algorithm, no simulation-based null distributions are derived to assess significance, but a permutation-based strategy is adopted. under the assumption of familial correlation-free traits in fam-mdr part ii, permutation- based p-values for the best model can easily be derived by randomly permuting the traits. this is in contrast to pgmdr’s implementation of a permutation strategy in that for pgdmr families are considered as the permutation units. the method of removing familial-correlation structure is not new. the grammar approach of aulchenko et al. [ ] and amin et al. table . type i error rates of fam-mdr under the null hypothesis of no epistasis. m m p = . p = . p = . p = . p = . g h corr. no c. corr. no c. corr. no c. corr. no c. corr. no c. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . results are based on simulated datasets for each setting. as an aid to interpretation the type i error rates § : are indicated in bold. abbreviations: corr. = with main effects correction, no c. = without main effects correction. doi: . /journal.pone. .t fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e figure . power of fam-mdr and pgmdr based on replicates, with h ~ : . the different panels show results for m (a) and m (b). abbreviations: corr. = with main effects correction, no corr. = without main effects correction. doi: . /journal.pone. .g fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e table . power of fam-mdr, fam-mdr* and pgmdr. m m corr. no c. corr. no c. p g h f f* pg f f* pg f f* pg f f* pg . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . results are based on simulated datasets for each setting. as an aid to interpretation the powers § : are indicated in bold. abbreviations: corr. = with main effects correction, no c. = without main effects correction , f = fam-mdr, f* = fam-mdr*, pg = pgmdr. doi: . /journal.pone. .t fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e [ ] also used this idea in the context of rapid genomewide main effects analysis. for multivariate traits and unrelated individuals, similar principles of first removing trait correlations and then submitting derived residuals to mb-mdr can be adopted. this is work in progress and is particularly useful when measurements over time are available. exploiting the time-relatedness of phenotypic measurements may in part compensate for the large sample sizes needed to detect epistasis in genomic studies. the current implementation of fam-mdr is not scalable to gwas. an efficient c++ implementation and a code version for parallel analyses are on their way. first simulations indicate that these enhancements will make gwas feasible. for now, when large-scale genomic screenings are performed with thousands of markers, since fam-mdr part i is preparatory for subsequent association analysis, fam-mdr can include a pre-selection step of good candidates of markers for epistasis analysis. these candidates may be selected on the basis of information theoretic measures [ , ] using information about the trait under investigation; or on the basis of evidence from other data, i.e. using external and independent information [ ], e.g. omics analyses. depending on the strategy, an additional correction for data snooping in the pre- screening step may be required to control type i error rates. also, a part iii can be added to a fam-mdr analysis to interpret the identified epistasis models. this is an important step of the analysis and may or may not involve deriving good estimates of the significant effects. special care needs to be taken when carrying out this step, in order not to be the victim of the so-called ‘‘winner’s curse’’ [ , ]. currently, mb-mdr and fam-mdr are based on wald statistics, whereas gmdr and pgmdr make use of score statistics. first, the score test is computationally more advantageous because it only needs parameter estimates under the null whereas the wald test needs parameter estimates under the alternative and the likelihood ratio test needs both. second, even though the three tests are asymptotically equivalent, the score test is the most powerful of the three when the true parameter is close to the null value. in line with the first release of an mb-mdr r package for unrelated individuals, wald statistics were implemented in the first version of the fam-mdr software. in the future, score statistics as well as robust non-parametric statistics will be offered as additional options in fam-mdr. one of the major results that our simulation study highlights is that pgmdr is too liberal in identifying epistasis models. this is due to the inadequate correction for multiple testing, implemented in the pgdmr software to date (figure ; panel c). in contrast, fam-mdr correctly deals with multiple testing and consequently leads to appropriate type i error rates (figure ; panel a). in effect, fam-mdr is rather conservative, which is a property inherited from the grammar approach it is built on. indeed, while first removing polygenic effects (fam-mdr part i), an over- correction may take place, resulting in power loss and conservatism to identify remaining genetic association signals. improvements to fam-mdr that can remove this artifact are on the way. a second result is that, generally speaking, fam-mdr has optimal power over pgmdr in virtual all considered simulation scenarios. in addition, we have indicated that occasional better achieved performance of pgmdr in terms of power is probably attributable to sampling variability. also note that when computing the pgmdr power estimates in our simulation study, in case of a tie we gave advantage to the model with the functional snp pair. a third important result is the influence of correcting for lower- order effects when searching for significant epistatic interactions. as was also pointed out by calle et al. [ ], mdr-like analysis that does not account for important marginal effects is prone to report false higher-order interactions, containing the significant lower-order effects not accounted for. although pgmdr accommodates covariate adjustment, more work is needed to enhance flexible implementation. fam-mdr code is currently available as an r-script, in which covariate adjustments are easily incorporated in the model statement of the polygenic function. more work is needed though to develop a genuine screening strategy to search for optimal models, starting from important main effects and ending with higher-order interaction models beyond the two-way interactions considered in this work, with the maximum order pre-defined by the user. this is future research, since our simulations have shown that it is of utmost importance to adjust for previous significant findings when moving to the search space of interactions of the next order. since the way lower-order interactions are accounted for is part of a parametric paradigm, the coding of these effects needs careful reflection. when lower- order effects are important, a correction is warranted. when lower-order effects are not important or not adequately coded, over-adjusting for lower-order effects may lead to there being virtually no variation left with which to identify higher-order interactions. hence, in reality the balance between necessary corrections for important main effects and avoiding over- correction needs to be considered to optimize the performance of any epistasis detection method. the current fam-mdr implementation is only valid under the assumption of no population structure, and our simulations assume a homogeneous population. by using both between- and within-family association – in contrast to pgmdr that uses only within-family association – fam-mdr gains power but this comes at the price of sacrificing the built-in protection against spurious results if population structure is present. a possible solution to this problem lies in the use of genomic control [ ]. although pgmdr is a flexible tool to handle binary or continuous outcome types, and accommodates covariate adjust- ment, our application to real-life data has revealed some important shortcomings that impact the power of a study. these include a rather inefficient use of available information and the inability to table . epistasis analyses of amish family diabetes study data. corr. no c. model p-value model p-value orig. f (f*) rs in casq ; rs in apm . ( . ) rs in casq ; rs in apm . ( . ) split f (f*) rs in casq ; rs in apm . ( . ) rs in casq ; rs in apm . (, . ) split pg rs in casq ; rs in hnf a . rs in adipor ; rs in hnf a . main effects corrections adjust the analyses for rs in hnf a, rs and rs in casq , and rs in adipor . abbreviations: corr. = with main effects correction, no c. = without main effects correction, orig. = original data, split = split pedigree, f = fam-mdr, f* = fam-mdr*, pg = pgmdr. doi: . /journal.pone. .t fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e analyze complex and extended pedigrees with the present pgmdr implementation. regarding missing genotypes, pgmdr discards families entirely when data on one snp are missing. without minimizing the need to also improve fam-mdr’s handling of missing data (whether at the genotype or phenotype level), not being able to account for the full complexity of a pedigree is certainly a drawback of pgmdr. we believe that methods that can accommodate mixed study designs will become more and more important due to the increasing practice of combining data from different groups in consortia collaborations. fam-mdr flexibly deals with both unrelated and related individuals in the same analysis whereas pgmdr excludes unrelated individuals, hereby reducing the power of the association analysis. multi-generational pedigrees may provide more information on inheritance patterns observed on genotype data, which improves the quality of family-based tests of association. due to limitations of the pgmdr software, only fam-mdr analysis was applied to the extended pedigree data as such. with (or without) fam-mdr correction for main effects of rs in hnf a, rs and rs in casq , and rs in adipor , no evidence for a significant interaction (or two-locus model) was found (table ). weak interactions between variations at these loci in contributing to the log (gauc) phenotype may still exist, but if so, fam- mdr was not able to identify them. in this context it is important to note that fam-mdr – like grammar – could be rather conservative, especially for larger extended pedigrees [ ]. on the other hand, the (nearly) significant findings for the simplified pedigree (table ) may potentially be false positive results driven by both the artificial increase in sample size and by not appropriately accounting for family structure. indeed, mcardle et al. [ ] showed that the type i error of detecting snp main effects is elevated when family structure is ignored, and more dramatically with increasing trait heritability, which may naturally extend to (interactive) two-locus models as well. lack of appropriate accounting for multiple testing (pgmdr and fam- mdr*) may also increase the likelihood of observing spurious associations. this is clearly seen for fam-mdr* and to some extent also for pgmdr (table ). improving the ability to detect gene-gene interactions in family studies of complex disease may prove critical in identifying the underlying sources of observed heritability. while it is apparent that type diabetes mellitus (t dm) is polygenic, the genetic sources of the observed heritability have yet to be completely identified [ ], and may include still unobserved gene-gene interactions. detecting interactions between genes associated with t dm has thus far been very challenging, due to a paucity of powerful statistical methods and study datasets with adequate sample sizes [ ]. several studies that have examined interactions between single variants in different genes have shown mixed evidence of two-way interactions in t dm and t dm-related traits like obesity and insulin resistance. using an approach which conditioned on linkage in one region to identify evidence of linkage elsewhere, a linkage study of t dm in mexican americans from starr county, texas, identified the interaction of genes on chromosomes (capn (calpain ), then niddm ) and (near cyp (cytochrome p , family , or aromatase)) in contributiing to t dm susceptibility [ ]. associ- ation studies investigating interactions between variants of the beta- adrenergic receptor (adrb ) and uncoupling protein (ucp ) genes observed in weak [ ] to no [ ] effects on weight gain and insulin resistance in finnish and danish populations, respectively. a study of type ii iodothyronine deiodinase (dio ) and adrb polymorphisms showed a synergistic effect on an increased bmi, suggesting an interaction between these two common gene variants [ ], while a study of intestinal fatty acid binding protein (fabp ) and adrb showed no interaction on levels of fasting plasma glucose or measures of insulin resistance [ ]. in a study of mexican-american families participating in the population-based san antonio family heart study [ ], the combined presence of common variants of peroxisome proliferator-activated receptor gamma (pparc) and adrb are correlated with significantly higher bmi, insulin, and leptin levels than the presence of the pparc variants alone. yet another study [ ] examined two-locus interactions among loci in t dm candidate genes in the risk of t dm, and found a significant interaction between variants in the uncoupling protein (ucp ) and pparc genes. identification of novel interactions and further confirmation of observed interactions may be critical in characterizing the genetic risk factors for t dm and many other complex disease that remain among the unidentified components of the heritability of these diseases, and may have practical application in the identification of individuals who may belong to groups at high risk of disease who can benefit from preventive care. in conclusion, fam-mdr – unlike pgmdr – is able to handle complex and large pedigrees with additional unrelated individuals. in fact, fam-mdr analysis on split pedigree data should not be trusted because it might lead to overly optimistic results. on the other hand, as pedigree size increases, the inherent conservative nature of fam-mdr could become more pronounced. finally, pgmdr results – and in fact also gmdr results – are too liberal as no correction for multiple testing is carried out. supporting information figure s probability-probability plots for fam-mdr analyses under the null hypotheses of no association and no epistasis. the situation considered is p = . and h = . . analyses are performed both with and without correction for main effects. results are based on replicates. panels a and b show results for data generated under the null of no association, whereas panels c and d consider data generated under the null hypothesis of no epistasis, for model m and with g = . . panels a and c show results for analysis with correction for main effects, panels b and d without. found at: doi: . /journal.pone. .s ( . mb tif) figure s additional power results for model m , based on replicates. panels a and b show results for h = . and h = . respectively. abbreviations: corr. = with main effects correction, no corr. = without main effects correction. found at: doi: . /journal.pone. .s ( . mb tif) figure s additional power results for model m , based on replicates. panels a and b show results for h = . and h = . respectively. abbreviations: corr. = with main effects correction, no corr. = without main effects correction. found at: doi: . /journal.pone. .s ( . mb tif) acknowledgments interesting discussions with yurii aulchenko and florence demenais are gratefully acknowledged. author contributions conceived and designed the experiments: mf hs. performed the experiments: mf hs. analyzed the data: tc acn tle kvs. contributed reagents/materials/analysis tools: tc vu vdw mf jmmj hs mlc kvs. wrote the paper: tc acn jmmj mlc mdr tle kvs. developed the method: tc ldl vdw jmmj kvs. designed the simulation study: tc kvs. performed the simulation study: tc kvs. fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e references . frazer ka, ballinger dg, cox dr, hinds da, stuve ll, et al. ( ) a second generation human haplotype map of over . million snps. nature : – . . hindorff la, sethupathy p, junkins ha, ramos em, mehta jp, et al. ( ) potential etiologic and functional implications of genome-wide association loci for human diseases and traits. proc natl acad sci u s a : – . . manolio ta, brooks ld, collins fs ( ) a hapmap harvest of insights into the genetics of common disease. j clin invest : – . . barrett jc, hansoul s, nicolae dl, cho jh, duerr rh, et al. ( ) genome- wide association defines more than distinct susceptibility loci for crohn’s disease. nat genet : – . . dixon ms, golstein c, thomas cm, van der biezen ea, jones jd ( ) genetic complexity of pathogen perception by plants: the example of rcr , a tomato gene required specifically by cf- . proc natl acad sci u s a : – . . boone c, bussey h, andrews bj ( ) exploring genetic interactions and networks with yeast. nat rev genet : – . . cantrell va, owens se, chandler rl, airey dc, bradley km, et al. ( ) interactions between sox and ednrb modulate penetrance and severity of aganglionosis in the sox dom mouse model of hirschsprung disease. hum mol genet : – . . desalle r, templeton ar ( ) the molecular through ecological genetics of abnormal abdomen. iii. tissue-specific differential replication of ribosomal genes modulates the abnormal abdomen phenotype in drosophila mercatorum. genetics : – . . hartmann b, reichert h, walldorf u ( ) interaction of gap genes in the drosophila head: tailless regulates expression of empty spiracles in early embryonic patterning and brain development. mech dev : – . . hollocher h, templeton ar ( ) the molecular through ecological genetics of abnormal abdomen in drosophila-mercatorum . . the nonneutrality of the y-chromosome rdna polymorphism. genetics : – . . hollocher h, templeton ar, desalle r, johnston js ( ) the molecular through ecological genetics of abnormal-abdomen . . components of genetic- variation in a natural-population of drosophila-mercatorum. genetics : – . . lehner b ( ) modelling genotype-phenotype relationships and human disease with genetic interaction networks. j exp biol : – . . schuldiner m, collins sr, thompson nj, denic v, bhamidipati a, et al. ( ) exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. cell : – . . tong ah, evangelista m, parsons ab, xu h, bader gd, et al. ( ) systematic genetic analysis with ordered arrays of yeast deletion mutants. science : – . . tong ah, lesage g, bader gd, ding h, xu h, et al. ( ) global mapping of the yeast genetic interaction network. science : – . . hirschhorn jn, lohmueller k, byrne e, hirschhorn k ( ) a comprehensive review of genetic association studies. genet med : – . . ioannidis jp ( ) non-replication and inconsistency in the genome-wide association setting. hum hered : – . . cheverud jm, routman ej ( ) epistasis and its contribution to genetic variance components. genetics : – . . fisher r ( ) the correlation between relatives on the supposition of mendelian inheritance. trans r soc edin : – . . dixon al, liang l, moffatt mf, chen w, heath s, et al. ( ) a genome-wide association study of global gene expression. nat genet : – . . moore jh ( ) the ubiquitous nature of epistasis in determining susceptibility to common human diseases. hum hered : – . . moore jh, williams sm ( ) traversing the conceptual divide between biological and statistical epistasis: systems biology and a more modern synthesis. bioessays : – . . motsinger-reif aa, reif dm, fanelli tj, ritchie md ( ) a comparison of analytical methods for genetic association studies. genet epidemiol : – . . risch n, merikangas k ( ) the future of genetic studies of complex human diseases. science : – . . kelly le, phillips am ( ) molecular and genetic characterization of the interactions between the drosophila stoned-b protein and dap- (intersectin). biochem j : – . . maxwell ca, moreno v, sole x, gomez l, hernandez p, et al. ( ) genetic interactions: the missing links for a better understanding of cancer susceptibility, progression and treatment. mol cancer : . . altshuler d, daly mj, lander es ( ) genetic mapping in human disease. science : – . . greene cs, penrod nm, williams sm, moore jh ( ) failure to replicate a genetic association may provide important clues about genetic architecture. plos one : e . . cordell hj ( ) epistasis: what it means, what it doesn’t mean, and statistical methods to detect it in humans. hum mol genet : – . . cordell hj ( ) detecting gene-gene interactions that underlie human diseases. nature reviews genetics : – . . onkamo p, toivonen h ( ) a survey of data mining methods for linkage disequilibrium mapping. hum genomics : – . . hahn lw, ritchie md, moore jh ( ) multifactor dimensionality reduction software for detecting gene-gene and gene-environment interactions. bioinfor- matics : – . . ritchie md, hahn lw, moore jh ( ) power of multifactor dimensionality reduction for detecting gene-gene interactions in the presence of genotyping error, missing data, phenocopy, and genetic heterogeneity. genet epidemiol : – . . ritchie md, hahn lw, roodi n, bailey lr, dupont wd, et al. ( ) multifactor-dimensionality reduction reveals high-order interactions among estrogen-metabolism genes in sporadic breast cancer. am j hum genet : – . . lou xy, chen gb, yan l, ma jz, mangold je, et al. ( ) a combinatorial approach to detecting gene-gene and gene-environment interactions in family studies. am j hum genet : – . . lou xy, chen gb, yan l, ma jz, zhu j, et al. ( ) a generalized combinatorial approach for detecting gene-by-gene and gene-by-environment interactions with application to nicotine dependence. am j hum genet : – . . martin er, ritchie md, hahn l, kang s, moore jh ( ) a novel method to identify gene-gene effects in nuclear families: the mdr-pdt. genet epidemiol : – . . rabinowitz d, laird n ( ) a unified approach to adjusting association tests for population admixture with arbitrary pedigree structure and arbitrary missing marker information. hum hered : – . . aulchenko ys, de koning dj, haley c ( ) genomewide rapid association using mixed model and regression: a fast and simple method for genomewide pedigree-based quantitative trait loci association analysis. genetics : – . . calle ml, urrea v, vellalta g, malats n, van steen k ( ) improving strategies for detecting genetic patterns of disease susceptibility in association studies. stat med : – . . hsueh wc, mitchell bd, aburomia r, pollin t, sakul h, et al. ( ) diabetes in the old order amish: characterization and heritability analysis of the amish family diabetes study. diabetes care : – . . amin n, van duijn cm, aulchenko ys ( ) a genomic background based method for association analysis in related individuals. plos one : e . . aulchenko ys, ripke s, isaacs a, van duijn cm ( ) genabel: an r library for genome-wide association analysis. bioinformatics : – . . thompson ea, shaw rg ( ) pedigree analysis for quantitative traits: variance components without matrix inversion. biometrics : – . . leutenegger al, prum b, genin e, verny c, lemainque a, et al. ( ) estimation of the inbreeding coefficient through use of genomic data. am j hum genet : – . . benjamini y, hochberg y ( ) controlling the false discovery rate - a practical and powerful approach to multiple testing. journal of the royal statistical society series b-methodological : – . . boerwinkle e, chakraborty r, sing cf ( ) the use of measured genotype information in the analysis of quantitative phenotypes in man. i. models and analytical methods. ann hum genet : – . . rubin db ( ) inference and missing data. biometrika : – . . evans dm, marchini j, morris ap, cardon lr ( ) two-stage two-locus models in genome-wide association. plos genetics : – . . li w, reich j ( ) a complete enumeration and classification of two-locus disease models. hum hered : – . . nettleton d, doerge rw ( ) accounting for variability in the use of permutation testing to detect quantitative trait loci. biometrics : – . . damcott cm, hoppman n, ott sh, reinhart lj, wang j, et al. ( ) polymorphisms in both promoters of hepatocyte nuclear factor -alpha are associated with type diabetes in the amish. diabetes : – . . damcott cm, ott sh, pollin ti, reinhart lj, wang j, et al. ( ) genetic variation in adiponectin receptor and adiponectin receptor is associated with type diabetes in the old order amish. diabetes : – . . fu m, damcott cm, sabra m, pollin ti, ott sh, et al. ( ) polymorphism in the calsequestrin (casq ) gene on chromosome q is associated with type diabetes in the old order amish. diabetes : – . . pollin ti, tanner k, o’connell jr, ott sh, damcott cm, et al. ( ) linkage of plasma adiponectin levels to q explained by association with variation in the apm gene. diabetes : – . . hsueh wc, st jean pl, mitchell bd, pollin ti, knowler wc, et al. ( ) genome-wide and fine-mapping linkage studies of type diabetes and glucose traits in the old order amish: evidence for a new diabetes locus on chromosome q and confirmation of a locus on chromosome q –q . diabetes : – . . chanda p, sucheston l, zhang a, ramanathan m ( ) the interaction index, a novel information-theoretic metric for prioritizing interacting genetic variations and environmental factors. eur j hum genet. . chanda p, zhang a, brazeau d, sucheston l, freudenheim jl, et al. ( ) information-theoretic metrics for visualizing gene-environment interactions. am j hum genet : – . . bush ws, dudek sm, ritchie md ( ) biofilter: a knowledge-integration system for the multi-locus analysis of genome-wide association studies. pac symp biocomput. pp – . fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e . lohmueller ke, pearce cl, pike m, lander es, hirschhorn jn ( ) meta- analysis of genetic association studies supports a contribution of common variants to susceptibility to common disease. nat genet : – . . xiao r, boehnke m ( ) quantifying and correcting for the winner’s curse in genetic association studies. genet epidemiol : – . . devlin b, roeder k ( ) genomic control for association studies. biometrics : – . . mcardle pf, o’connell jr, pollin ti, baumgarten m, shuldiner ar, et al. ( ) accounting for relatedness in family based genetic association studies. hum hered : – . . bogardus c ( ) missing heritability and gwas utility. obesity (silver spring) : – . . moore jh, williams sm ( ) new strategies for identifying gene-gene interactions in hypertension. ann med : – . . cox nj, frigge m, nicolae dl, concannon p, hanis cl, et al. ( ) loci on chromosomes (niddm ) and interact to increase susceptibility to diabetes in mexican americans. nat genet : – . . sivenius k, valve r, lindi v, niskanen l, laakso m, et al. ( ) synergistic effect of polymorphisms in uncoupling protein and beta -adrenergic receptor genes on long-term body weight change in finnish type diabetic and non- diabetic control subjects. int j obes relat metab disord : – . . urhammer sa, hansen t, borch-johnsen k, pedersen o ( ) studies of the synergistic effect of the trp/arg polymorphism of the beta -adrenergic receptor gene and the arg variant of the uncoupling protein- gene on features of obesity and insulin resistance in a population-based sample of young danish subjects. j clin endocrinol metab : – . . mentuccia d, proietti-pannunzi l, tanner k, bacci v, pollin ti, et al. ( ) association between a novel variant of the human type deiodinase gene thr ala and insulin resistance: evidence of interaction with the trp arg variant of the beta- -adrenergic receptor. diabetes : – . . ishii t, hirose h, kawai t, hayashi k, maruyama h, et al. ( ) effects of intestinal fatty acid-binding protein gene ala thr polymorphism and beta - adrenergic receptor gene trp arg polymorphism on insulin resistance and fasting plasma glucose in young to older japanese men. metabolism : – . . hsueh wc, cole sa, shuldiner ar, beamer ba, blangero j, et al. ( ) interactions between variants in the beta -adrenergic receptor and peroxisome proliferator-activated receptor-gamma genes and obesity. diabetes care : – . . cho ym, ritchie md, moore jh, park jy, lee ku, et al. ( ) multifactor- dimensionality reduction shows a two-locus interaction associated with type diabetes mellitus. diabetologia : – . fam-mdr epistasis screening plos one | www.plosone.org april | volume | issue | e the “problem” of minority education in an international perspective | semantic scholar skip to search formskip to main content> semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. doi: . /s - ( ) - corpus id: the “problem” of minority education in an international perspective @article{letendre theo, title={the “problem” of minority education in an international perspective}, author={g. letendre}, journal={international journal of educational research}, year={ }, volume={ }, pages={ - } } g. letendre published sociology international journal of educational research the chapters in this issue originated in the comparative and international education seminar given each year at the pennsylvania state university and re#ect nearly two years of ongoing work analyzing minority educational policy from a crossnational perspective. there are three goals of this special issue. the "rst is to provide readers with case studies of the impact of national educational policies on minorities in the us and in other nations. the second is to analyze the degree to which cross… expand view via publisher save to library create alert cite launch research feed share this paper citationshighly influential citations background citations view all citations citation type citation type all types cites results cites methods cites background has pdf publication type author more filters more filters filters sort by relevance sort by most influenced papers sort by citation count sort by recency factors affecting performance of the ethnic minority students in secondary schools m. a. kalam sociology pdf view excerpt, cites background save alert research feed managing school behavior: a qualitative case study pamela r. dodge political science highly influenced view excerpts, cites background save alert research feed examination of the fidelity of school-wide positive behavior support implementation and its relationship to academic and behavioral outcomes in florida jason lafrance psychology pdf save alert research feed using office discipline referral data for decision making about student behavior in elementary and middle schools l. irvin, r. horner, + authors j. b. boland psychology view excerpt, cites background save alert research feed teori ve uluslararası metinlerde azınlık tanımı okutan Çağatay political science save alert research feed turkish approach to minority concept evolution of minority concept and competence of treaty of lausanne in contemporary times mirhan yoğun political science view excerpt, cites background save alert research feed reimagining education's role in the imagined community: toward a more comprehensive theory of political socialization kristina brezicha sociology save alert research feed references showing - of references sort byrelevance most influenced papers recency the world educational revolution, - . j. meyer economics view excerpt, references methods save alert research feed explaining the origins and expansion of mass education j. boli, f. ramírez, j. meyer sociology comparative education review pdf save alert research feed the political construction of mass schooling: european origins and worldwide institutionalization f. ramírez, j. boli sociology view excerpt, references background save alert research feed the problem of japan: qualitative studies and international educational comparisons g. letendre sociology view excerpt, references background save alert research feed exploring and explaining the variability: cross-national perspectives on the school performance of minority students. m. a. gibson sociology view excerpt, references background save alert research feed world expansion of mass education, - j. meyer sociology pdf save alert research feed schooling immigrants in france in the s: success or failure of the republican model of integration? a. v. zanten sociology view excerpt, references background save alert research feed the ideology of childhood and the state: rules distinguishing children in national constitutions, - john boli-bennett, j. w. meyer sociology view excerpt, references background save alert research feed education in tokugawa japan r. dore history, sociology view excerpt, references background save alert research feed what do anthropologists have to say about dropouts? : the first centennial conference on children at risk, school of education, stanford university h. t. treuba, g. spindler, l. spindler history view excerpts, references background save alert research feed ... ... related papers abstract citations references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue use of dental services by immigrant canadians jcda • www.cda-adc.ca/jcda • march , vol. , no. • r epresenting more than . % of the canadian population in and arriving from many countries, foreign- born residents constitute a growing segment of canada’s population. recent literature has firmly established that the health and health- seeking behaviour of canada’s foreign-born residents, including refugees and immigrants, diverge from those of the native-born popula- tion. for example, the “healthy immigrant effect,” whereby the health status of immi- grants is good at the time of arrival but subsequently declines to a level below that of the native-born population, is well docu- mented. – recent immigrants are more likely to rank their health higher than canadian- born people and are less likely to report chronic conditions or disability; these patterns are attributed to the fact that those in good health are more likely to emigrate from their home country and also to the screening process at the time of entry, which may dis- qualify those with serious medical conditions. although it could be argued that the observed decline in health after arrival reflects less con- tact with the health care system than is the case for the native-born population, there is con- flicting evidence about immigrants’ limited use of the health care system. immigrants as a group are typically considered to underuse the health care system, perhaps because of better health status at the time of arrival. however, barriers to care, lack of knowledge of the health care system and recent health care restructuring in canada may discourage health care utilization by immigrants. surprisingly little is known about the dental health of and use of dental services by canada’s foreign-born population. for instance, a recent health canada report on immigrant health was silent on the topic of dental health needs of the immigrant population. yet immigrants dr. newbold email: newbold@mcmaster.ca contact author use of dental services by immigrant canadians k. bruce newbold, phd; amish patel, bsc abstract although the health status and health behaviour of foreign-born residents of canada have been well documented, little is known about their use of dental services. the authors, hypothesizing that foreign-born people would have lower utilization of dental care services than native-born canadians, undertook this study to identify the factors asso- ciated with dental visits by canadians aged years and older and to compare the use of dental services by foreign-born and native-born populations. according to data derived from statistics canada’s – national population health survey, foreign-born people were somewhat more likely than native-born canadians to have visited a dentist within the previous year. higher levels of education, greater income adequacy, and the presence of dental insurance were associated with greater use of dental services, whereas increasing age was associated with lower use. although immigrants reported greater use of dental services than native-born canadians, a variety of barriers to care may be present in this population. mesh key words: canada/epidemiology; dental health services; emigration and immigration/statistics & numerical data; insurance, dental © j can dent assoc ; ( ): this article has been peer reviewed. professional i s s u e s mailto:newbold@mcmaster.ca a jcda • www.cda-adc.ca/jcda • march , vol. , no. • may face greater needs than the native-born population with respect to their dental health because of lack of insur- ance, lower incomes, limited awareness of both facilities and the need for oral care, or other barriers to good dental health such as language. regardless, the general perception is that members of the immigrant canadian population visit the dentist less often, even though they have a greater need for dental services. the objective of this study was to compare the use of dental services by the foreign-born and native-born populations of canada and to determine factors associated with dental visits. methods data for this study were derived from statistic canada’s national population health survey (nphs) cycle ( – ). the target population of the nphs consists of household residents age years and older in all provinces and territories, except those living on reserves, on canadian forces bases and in some remote places. most interviews ( %) were conducted by tele- phone with computer-assisted interviewing techniques; the remainder of the interviews were conducted in person. the analysis compensated for nonresponding households (e.g., because of language barriers) by adjusting the weights assigned to reporting households. the nphs col- lects in-depth information on a number of attributes, including sociodemographic and socioeconomic charac- teristics, lifestyle and health care utilization for each member of the household. it also includes questions about use of dental services. the current paper focuses on use of dental services within the year preceding the survey and reasons for the visit(s). given the complex sampling design of the nphs, the weights developed by statistics canada were used in this analysis. both descriptive and multivariate statistics were used to evaluate patterns of use and differences between the native-born and foreign-born populations. table illustrates differences in the population profiles of the groups. because the age profile of the immigrant population was different from that of the native-born population, it was expected that the groups would have different utilization patterns, all other things being equal. standardized dental use ratios (sdurs), which are similar to standardized mortality ratios, were calculated for the use of dental services according to selected personal attributes, which allowed age and sex standardiza- tion. the sdur was calculated as the ratio of the observed proportion of immigrants reporting use of dental services to the expected proportion of individuals reporting use in the total canadian population, if immigrants experienced the same age- and sex-specific rates of use as the native- born population. a ratio of less than . indicates that the foreign-born population fares better than the native-born population, and vice versa. eight age–sex ( × ) groups were used for standardization. results although previous studies had suggested that foreign- born people would be less likely than native-born canadians to have used dental services, the nphs data analyzed here indicated similar rates of use in the past year ( . % versus . %; p = . ) (table ). relative to the native-born population, a smaller proportion of the foreign-born participants were under years of age and a ––– newbold ––– table characteristics of the foreign-born and native-born populations of canada, years of age and older, – % of population variable foreign-born native-born age (years) – . . – . . – . . ≥ . . sex male . . female . . education some high school . . without graduation high school graduate . . bachelor’s degree or higher . . income adequacy low . . lower middle . . middle . . upper middle . . high . . duration of residence in canada (years) – . na – . na ≥ . na region of origin u.s., europe or australia . na asia . na other . na overall % of all respondents . . n , , , , source: derived from the – nphs. na = not applicable. jcda • www.cda-adc.ca/jcda • march , vol. , no. • b larger proportion were older than years; the slight dif- ference in use of dental services may have been partly due to this difference in age distributions. greater use of dental services by foreign-born participants was observed among those aged and over; among those with middle, upper middle or high income adequacy; and among those with less than a high school education. standardized by age and sex, the sdurs indicated somewhat greater use of dental services among foreign-born respondents as a whole and among foreign-born respondents of male sex, with lower income adequacy and with some high school education. although the type of dental insurance (i.e., private or public) could not be determined, native-born canadians were more likely than immigrants to have dental insurance ( . % versus . %). this difference remained when the data were standardized for age and sex. significant differences in the use of dental services were also noted within the immigrant population. for example, only . % of immigrants who had resided in the country for less than years had used a dentist in the previous year. in contrast, more than % of immigrants who had resided in the country for or more years had visited a dentist. in addition, the region of origin appeared to have a significant impact upon use, with immigrants from asia reporting the lowest use ( . %) (table ). nearly equal proportions of native-born and foreign- born participants reported visiting a dentist because services were covered by dental insurance (about %) (table ). immigrants were more likely than native-born canadians to consult a dentist for treatment reasons, such as care of the teeth, gums or dentures ( . % versus . %). conversely, native-born canadians were more likely to report visits for preventive care, giving such reasons as “to check that everything is okay” ( . % versus . % for native-born and immigrants, respectively), “for good health” ( . % versus . %) and braces ( . % versus . %). logistic regression was used to determine the proba- bility of using dental services with adjustment for other variables such as age, sex and the presence of dental insur- ance (table ). two models were created to explore the determinants of dental use. the first was a pooled model that included both the native-born and foreign-born populations, which enabled determination of whether foreign-born participants were more (or less) likely to have used a dentist than the native-born population, with adjustment for other effects. the second model evaluated use of dental services by immigrants only. the model results are reported as odds ratios (ors), which allow clear interpretation of the effect of a variable. an or greater than . indicates an increased likelihood of use of dental services by participants in that category, and an or less than . indicates the reverse. for example, females in the ––– use of dental services by immigrants ––– table dental use by foreign-born and native-born canadians years of age and older, – % of respondents foreign- native- p variable born born value sdur dental visits % using dental . . . . services n , , age (years) – . . . na – . . . na – . . < . na ≥ . . . na n , , sex male . . . . female . . . . n , , education some high school . . . . without graduation high school graduate . . . . bachelor’s degree . . . . or higher n , , income adequacy low . . . . lower middle . . . . middle . . . . upper middle . . . . high . . . . n , , dental insurance % with insurance . . < . . n , , duration of residence in canada (years) – . na na – . na na ≥ . na na n , na region of origin u.s., europe, australia . na na asia . na na other . na na n , na source: derived from the – nphs. n = unweighted sample size, sdur = standardized dental use ratio, na = not applicable. c jcda • www.cda-adc.ca/jcda • march , vol. , no. • pooled model were . times more likely to have visited the dentist than males, all other things being equal. the pooled model demonstrated that immigrants were significantly more likely than native-born canadians to have visited a dentist (or = . ). in general, individuals with greater income adequacy, those who were better educated, were married or were younger, and those who had dental insurance were more likely to have visited a dentist. among foreign-born participants, recent arrivals (resident in canada for less than years) were less likely to have used a dentist. immigrants from asia were less likely to have used a dentist, whereas those with european origins were more likely to have used a dentist. discussion contrary to expectations, foreign-born residents of canada were significantly more likely than native-born canadians to have visited a dentist in the year preceding the survey, a finding that was supported by multivariate analyses adjusting for age and sex differences in the populations. yet a larger proportion of the native-born population reported having dental insurance. the foreign- born population and the pooled population (foreign- and native-born) were, respectively, . and . times more likely to have visited a dentist if they had insurance than if they did not have insurance. overall, the factors associated with use of dental ser- vices and identified in the logistic model were largely as expected. dental insurance, for example, significantly increased the likelihood of use. in terms of sociodemo- graphic effects, there was a negative correlation between age and use, with greater use among younger people (aged – years) and generally less use with increasing age. among the young, the greater likelihood of use probably reflects social pressure, the presence of parental dental insurance and/or dental care within the school system. conversely, lack of dental insurance coverage probably explains declining use with older age. female respondents and whites were also more likely to have used a dentist. surprisingly, individuals who spoke a language other than english or french were more likely to have used a dentist within the past year, which suggests that language may not be a barrier to dental care. socioeconomic variables also influenced use of dental services. income adequacy, which is defined by statistics canada and is based upon both household size and income level, was positively correlated with use (i.e., increasing likelihood of use with increasing income ade- quacy). education had a similar gradient, and those who had a bachelor’s degree or better were more likely to have used a dentist relative to all other educational levels. in both cases, the results probably reflect greater awareness of the need for care, greater ability to access resources, greater likelihood of dental insurance coverage and greater dis- posable income available for dental care. working status (i.e., working versus not working), which potentially reflects access to dental insurance and care through the employer, was not a significant determinant of use and was therefore not included in the reported model. among foreign-born respondents, other factors were significant predictors of use of dental services: duration of residency within canada and region of origin. with regard to duration of residency, recent arrivals (those who had arrived within the years before the survey) were signifi- cantly less likely to have used a dentist. cross-tabulation of results indicated a difference in use of about percentage points relative to those resident for more than years. social acceptability, adaptation, increasing awareness of ––– newbold ––– table reason for dental visits among foreign- and native-born people years of age and older, – % of respondents reason for visit to dentista foreign-born native-born p value check everything is okay . . . covered by insurance . . . prevention . . . for good health . . . care of teeth, gums, dentures . . < . clean, fluoride, maintenance . . . filling or extraction . . . braces . . < . other . . . n (unweighted) , , source: derived from the – nphs. arespondents were allowed to give more than one reason for dental visits. jcda • www.cda-adc.ca/jcda • march , vol. , no. • d dental resources, income and insurance are possible rea- sons for increasing use with increasing duration of resi- dency. indeed, there was a difference in insurance coverage of about percentage points between the newest immi- grant canadians (about %) and immigrants who had lived in canada for the longest period (about %) (table ). with regard to region of origin, immigrants who had arrived from countries outside north america, ––– use of dental services by immigrants ––– table logistic regression for use of dental services by respondents years of age and older, – a pooled foreign-born variable or % ci or % ci intercept . — . — immigration status (reference: native-born) foreign-born . ( . – . ) — — age (reference: ≥ years) – years . ( . – . ) . ( . – . ) – years . ( . – . ) — — – years . ( . – . ) . ( . – . ) education (reference: less than high school graduation) high school or better . ( . – . ) . ( . – . ) bachelor’s degree or better . ( . – . ) . ( . – . ) ethnic background (reference: nonwhite) white . ( . – . ) . ( . – . ) martial status (reference: not married) married . ( . – . ) . ( . – . ) gender (reference: male) female . ( . – . ) . ( . – . ) income adequacy (reference: low income adequacy) middle . ( . – . ) — — upper middle . ( . – . ) . ( . – . ) high . ( . – . ) . ( . – . ) dental insurance (reference: no insurance) insurance . ( . – . ) . ( . – . ) smoking status (reference: smokes daily) smokes occasionally . ( . – . ) — — language (reference: speaks an official language) other language . ( . – . ) . ( . – . ) origin (reference: other) europe — — . ( . – . ) asia — — . ( . – . ) duration of residence (reference: resident for years or more) arrived within past years — — . ( . – . ) n (unweighted) , , likelihood ratio , . , . rho squared . . % concordant . . source: derived from the – nphs. or = odds ratio, ci = confidence interval asuppressed values (indicated by a dash or not shown) were not statistically significant (working status, lower-middle income, smokers) or were not meaningful (origin, duration of residence) in the context of the model. e jcda • www.cda-adc.ca/jcda • march , vol. , no. • europe and australia were more likely to have used a den- tist in the past year than those of other origins (table ). those from asia had the lowest utilization rate ( . %), about percentage points lower than those from the united states, europe and australia. dental insurance was also one of the factors for which european immigrants had a slight advantage over immigrants from other regions (about percentage points higher than asian immi- grants). unmeasured factors, such as fear, language differ- ence, awareness, and transportation problems, may also have resulted in different utilization patterns among immigrants. although only small proportions of all respondents reported problems with visiting a dentist (data not shown), a somewhat larger proportion of for- eign-born respondents than native-born respondents indicated such problems ( . % vs. . %). about equal proportions of immigrant and native- born respondents identified the presence of insurance as a reason for a visit to the dentist, but these groups may differ in terms of other reasons for dental use. for example, data in table suggest that foreign-born respon- dents obtained dental services to address needs for phys- ical oral care (such as taking care of teeth, gums or dentures, cleaning and maintenance, and getting fillings or extractions) more often than native-born canadians. these results may indicate differences in oral health practices between the groups and may also indicate that immigrants have poorer dental health. the larger propor- tion of immigrants seeking physical oral care could also be due to a lack of services in the region of origin or a lack of prior dental care education. ––– newbold ––– table use of dental services and availability of insurance among foreign-born residents of canada years of age and older, by duration of residence and origin, / % of respondents at least one characteristic visit to dentist insurance duration of residence in canada (years) – . . – . . ≥ . . region of birth u.s., europe, australia . . asia . . other . . source: derived from the – nphs. conversely, the native-born population seemed more likely to have visited a dentist for preventive reasons, potentially reflecting greater dental insurance coverage. two self-reported reasons for use of dental services were to ensure that “everything is okay” and to “maintain good dental health.” although general check-ups and mainte- nance may include some physical corrections (similar to services provided to the immigrant group), it would appear that visiting the dentist was less often associated with a physical ailment and more often to ensure oral health. similarly, dental appointments to check braces, which may be viewed as an expensive health option (com- pared with other conditions), is also a preventive oral health measure. conclusions the lack of attention within the literature to immi- grant oral health is hardly surprising. the recent romanow report on health care in canada did not dis- cuss dental health, and oral health remains a relatively low priority within canada, with public funding of dental care low by international standards. federal funding has decreased over time, and funding for oral health at the provincial level is discretionary, although provisions are made within provincial health plans to cover emergency dental care. other oral health programs, including those for children, expectant mothers, people receiving welfare benefits and elderly people, have been cut back or simply do not exist. even the immigrant health literature, which has grown exponentially over recent years, is noticeably silent on this topic, yet immigrants represent a particu- larly vulnerable population in terms of both overall health status and dental health status. with an average of over , new immigrants per year, this group repre- sents a growing segment of canada’s population, and there is a potential that many new arrivals will have poor dental health or will lack the resources to access care. somewhat unexpectedly, the proportion of foreign- born respondents reporting use of dental services was greater than the proportion of native-born respondents after adjustment for age and sex. in addition, foreign- and native-born individuals reported different reasons for dental visits. there remains much room for improvement in the provision of dental care to the immigrant popula- tion. although dental insurance is an important factor in determining use of dental services, duration of residence since arrival, language, access to appropriate dental insur- ance and other factors may limit use and create barriers to care. in particular, immigrants who speak english as a second language, who speak little or no english at all or who are constrained by social and gender roles may be less likely to use a dentist. increasing the ability to obtain insurance may result in a shift toward prevention among immigrants, similar to the trend observed among native- jcda • www.cda-adc.ca/jcda • march , vol. , no. • f born respondents, with new arrivals benefiting the most. increased education and awareness of the need for dental services may also be appropriate. the question, of course, is who will pay for these enhancements. c references . ali j. mental health of canada’s immigrants. supplement to health reports, statistics canada; . . lillie-blanton m, rushing oe, ruiz s. key facts: race, ethnicity and medical care. the henry j. kaiser family foundation, . . dunn jr, dyck i. social determinants of health in canada’s immigrant population: results from the national population health survey. soc sci med ; ( ): – . . frisbie wp, youngtae y, hummer ra. immigration and the health of asian and pacific islander adults in the united states. am j epidemiol ; ( ): – . . gee em, kobayashi km, prus sg. examining the “healthy immigrant effect” in later life: findings from the canadian community health survey. . newbold kb, danforth j. health status and canada’s immigrant population. soc sci med ; ( ): – . . perez ce. health status and health behavior among immigrants. supplement to health reports, statistics canada; . p. – . . chen j, wilkens r, ng e. life expectancy of canada’s immigrants from to . health reports ; ( ): – (engl); – (fre). . laroche m. health status and health services utilization of canada’s immigrant and non-immigrant populations. can public policy ; ( ): – . . health canada. canadian research on immigration and health. ministry of health: ottawa, . . statistics canada. national population health survey (nphs) cycle ( – ). statistics canada: ottawa; . . romanow r. building on values: the future of health care in canada. final report, commission on the future of health care in canada, november . . birch s, anderson r. financing and delivering oral health care: what can we learn from other jurisdictions? j can dent assoc ; ( ): . available from: url: www.cda-adc.ca/jcda/vol- /issue- / .pdf. . lamotey j. determining family dental health. paper presented at access and care: towards a national oral health strategy. may – , . toronto. available from: url: http://individual.utoronto.ca/accessandcare/ (accessed december , ). ––– use of dental services by immigrants ––– acknowledgement: research for this article was supported by grant from the canadian institutes of heath research. dr. newbold is an associate professor of geography at mcmaster university in hamilton, ontario. mr. patel was an undergraduate student in kinesiology at mcmaster university when the article was written. correspondence to: dr. k. bruce newbold, school of geography and earth sciences, mcmaster university, main st. w., hamilton, on l s k . the authors have no declared financial interests. the authors humoral immunity to stress proteins and periodontal disease j periodontol • october humoral immunity to stress proteins and periodontal disease dennis e. lopatin,* charles e. shelburne,† neal van poperin,* charles j. kowalski,* and robert a. bagramian‡ background: there is evidence that microbial heat shock (stress) proteins (hsp) are immunodominant antigens of many microorgan- isms. immunity to these proteins has been shown in non-oral infections to contribute to protection. this study was undertaken to assess the relationship(s) between immunity to human and microbial heat shock proteins, periodontal disease status, and colonization by periodontal disease-associated microorganisms. methods: subgingival plaque and blood samples obtained from patients during an earlier clinical study were examined for the presence of specific periodontal disease-associated microorganisms and anti- bodies to selected human and microbial heat shock proteins (hsp , hsp , dnak, and groel). particle concentration immunofluorescence assay (pcfia) was used to detect anti-hsp antibodies and slot immunoblot assay (sib) was used to detect subgingival plaque species. regression models were used to examine the contribution of age, gender, gingival index, probing depth, attachment loss, calculus index, plaque index, and microbial colonization to the anti-hsp anti- body concentrations. results: our studies demonstrated that, when evaluated by anova, patients with higher anti-hsp (hsp , dnak, and groel) antibody con- centrations tended to have significantly (p ≤ . ) healthier periodontal tissues. this was most obvious when the relationship between mean probing depths and antibody concentrations were studied. for hsp antibodies, variables (probing depth and p. gingivalis concentration) were found to have significant contributions (r = . , p < . ). the equation derived from the regression model was y = − *pd + *pg. this confirmed the inverse relationship with probing depth and the positive relationship with colonization by p. gingivalis. attempts to model the other stress protein antibodies were not successful. conclusions: we believe that the present observations reflect the presence of protective anti-hsp antibodies, rather than simply the pres- ence of the microorganism in the gingival sulcus. the clinical signifi- cance of these observations lies in the potential of identifying patients who are at risk for developing periodontal disease based on their in- ability to mount an immune response to specific hsp or hsp epitopes, as well as the development of vaccines based on hsp epitopes. j periodontol ; : - . key words periodontal diseases/microbiology; protein, microbial heat-shock; protein, stress; antibody formation; immunity; humoral. a ssociations between host response and severity or progression of periodontal disease have classically been stud- ied in the context of immunity directed against specific micro- organisms. this has been true even though dental plaque repre- sents a highly complex array of microorganisms, each having both unique and common antigens that contribute to its overall antigenicity and immunogenicity. studying the potential role of host immunity in the context of such a complex anti- gen mixture is difficult and one is never certain whether differences in host response represent changes in magnitude of the response to a specific antigen or in qualitative differences in the antigenic array. recently, there has been a greater focus among investigators upon specific purified bacterial antigens such as lipopolysaccharides, lipote- ichoic acids, fimbrial proteins, and other cell membrane-associated antigens. - heat shock proteins (hsp) have been extensively evaluated in numerous medically significant dis- eases such as candidiasis, lyme disease, chlamydia, and tubercu- losis. we questioned whether this family of evolutionarily-conserved proteins had a significant role in periodontal disease. these pro- teins, defined in part by the mol- e c u l a r s i z e o f t h e i r p r o t o t y p e * department of biologic and materials sciences, school of dentistry, university of michigan, ann arbor, mi. † m, biomaterials technology center, st. paul, mn. ‡ department of periodontics, prevention, and geriatrics, university of michigan, ann arbor, mi. members, have significant roles in normal cellular function as molecular chaperones , and defense against environmental stresses. they have been shown to have an important role in inflammatory mechanisms, autoimmune diseases, - and atherosclerosis. in addition, these proteins have been shown to be the immunodominant antigens of many microorganisms including periodontal disease- associated microorganisms such as porphyromonas gingivalis - and actinobacillus actinomycetem- comitans. - because these proteins have been so highly conserved in evolution we felt that they might be used to assess “basal” or “generic” immunity in a variety of disease processes and would not necessar- ily be specifically linked to a single microorganism. in the present study, we have employed a panel of purified stress proteins and measured serum igg antibody levels to them using particle concentration fluorescence immunoassay. these data were then compared to clinical measurements of periodontal disease and colonization by microorganisms com- monly associated with periodontal disease. the spec- imens used in this study were derived from an amish and non-amish population examined in an earlier study. , materials and methods study population this study focused on the amish and non-amish liv- ing in rural southeastern michigan. the clinical data and archived specimens collected from a total of amish (n = ) and non-amish (n = ) specimens were used. this represented all of the subjects recruited during the first year of an earlier study. , the results of that study indicated that the amish did not present as a unique population that could be dis- tinguished from the non-amish. this study was per- f o r m e d u s i n g c l i n i c a l f i n d i n g s a n d s p e c i m e n s archived from that study. participation rate for these subjects was approximately %. ages ranged from to years; % ( ) males and % ( ) females. since the non-significant differences found in clinical measurements between the amish and non-amish were attributable to oral hygiene practice, later analyses treated all subjects as a single popula- tion. subsequent regression modeling confirmed this assumption. the oral disease in this population is consistent with age-associated chronic adult peri- odontitis with no evidence of early-onset periodontal diseases. clinical measurements one dentist conducted examinations of all existing teeth with the exception of third molars using the silness and löe plaque index, löe and silness gin- gival index, and modified ramfjord’s periodontal disease index for probing depth and attachment loss measurements. loss of periodontal attachment and pocket depth were measured to the nearest millime- ter using a periodontal probe. measurements were taken from sites of each tooth: disto-buccal, mid- buccal, mesio-buccal, disto-lingual, mid-lingual, and mesio-lingual. blood collection blood samples were collected in ml vacuum tubes without anticoagulant. after clotting, the tubes were centrifuged and the serum frozen at − °c. plaque specimens plaque samples were collected from the most peri- odontally diseased sites based on probing depth and/or inflammation. these samples were then pooled. this approach allowed us to assess the flora representative of the most diseased sites in each sub- ject. supragingival plaque about the most diseased sites was removed with a sterile curet and discarded. a second sterile curet was introduced into the sulcus or periodontal pocket and extended as far apically as possible. the root surface was then sampled with a curet and the adherent plaque on the scaler tip trans- ferred to a screw-capped cryotube containing . ml phosphate buffered saline (pbs; . m sodium phos- phate, . m nacl, ph . ) with . % formaldehyde, edta ( mm), pmsf ( . mm), pepstatin a ( . mm) and leupeptin ( . mg/l). sample vials were stored at − ° until assayed. slot immunoblot assay (sib) the sib was performed as previously described. the samples were ultrasonicated§ ( to seconds; % power) to disrupt aggregates of plaque particles. nitrocellulose sheets‖ were soaked for minutes in tbs ( . m nacl, . mm tris-hcl, . mm tris- base, ph . ) and inserted into the slot blot manifold.¶ standards (pure cultures) or undiluted plaque sam- ples were applied ( µl) to each well of the slot blot manifold which was then evacuated with gentle appli- cation of vacuum. the nitrocellulose membrane was then removed from the manifold for further process- ing. all subsequent incubations were performed on a rocking table# at room temperature. microbial detection and quantitation was performed after first immersing the nitrocellulose membrane in tbs containing . % non-fat dried milk** for to minutes to block unoccupied binding sites on the nitrocellulose membrane. the appropriate antibacter- ial antibody, diluted in tbs-tween (tbs-t; . % tween ) containing . % milk proteins** was humoral immunity to stress proteins volume • number § kontes instruments. ‖ ba- , schleicher & schuell, keene, nh. ¶ minifold ii, scheicher & schuell. # hoefer scientific co., san francisco, ca. ** blotto, kirkegaard & perry laboratories, gaithersburg, md. j periodontol • october lopatin, shelburne, van poperin, kowalski, bagramian applied and allowed to incubate for hour. following three -minute washes in tbs-t, goat anti-rabbit igg conjugated to alkaline phosphatase†† diluted in tbs- t containing . % milk proteins was applied and incubated for hour. after all washes, the bcip-nbt substrate solution‡‡ was applied and color develop- ment allowed to proceed to its maximum. absorbed polyclonal antisera prepared in rabbits specific for p. gingivalis, a. actinomycetemcomitans, t. denticola, and b. forsythus were used in the sib assay. the specificity of these antisera has been previously described. , particle concentration fluorescence immunoassay (pcfia) pcfia was performed as described by shelburne et al. stress proteins used in these studies were lim- ited to those that were commercially available since periodontal pathogen-specific stress proteins were either not available or were available in amounts insuf- ficient for screening purposes. the initial step in the performance of pcfia was the preparation of antigen- coupled latex particles. briefly, µg of the specific stress protein (human hsp , human hsp , e. coli dnak, and e. coli groel) was diluted to ml in . m sodium phosphate (ph . ) and combined with mg of carbodiimide§§ and ml of carboxyl latex particles‖‖ ( . µm, % w/v,) and incubated for to hours at °c with rotation. the coated particles were washed times in . m sodium phosphate and resuspended in ml of pbs + . % sterile milk proteins. twenty µl of the coated particles were dispensed into each well of well filtration plates.‖‖ sera were diluted : in pbs + . % sterile milk proteins, added to wells ( µl/ well) in triplicate, and incubated minutes at room temperature. the particles were then washed and µl of fitc labeled anti-human igg (various vendors) added. after an additional -minute incubation the particles were washed times and the fluorescence of the labeled anti-human igg captured by the solid phase was measured by epifluorimetry and expressed in rela- tive fluorescence units (rfu). controls included pooled human serum to control for inter-plate variability and fitc-labeled anti-human igg in the absence of : dilution of patient serum to control for non-specific binding. preliminary studies indi- cated that a : serum dilution was optimal, resulting in detection of all sample fluorescence at the same gain setting (gain = ) in the linear range of the machine. the relative amounts of fluorescence in each well was used as a semi- quantitative representation of the amount of anti- body present in the sample. statistical analysis the relationships between specific indices of periodontal disease, antibody level, and colo- nization of subgingival dental plaque were assessed by anova. fisher’s method for multiple comparisons was used for pair-wise comparison of the groups. the contribution of these variables to stress protein anti- body concentration, as well as those of age, gender, and amish/non-amish status, was assessed in multi- ple and stepwise regression models.¶¶ results with p ≤ . were considered significant. results clinical measurements a complete description of the clinical status of this population is available in earlier reports. , an overview of the clinical status of the subjects is pro- vided in table . all analyses described below used full mouth means for all clinical measurement (prob- ing depth, attachment loss, and gingival index). colonization and clinical measurements the relationship between colonization and the clinical measurements was determined by anova. as shown in table , when probing depth was examined, incr easing pr obing depth was associated with increased colonization by all species tested. in all cases but a. actinomycetemcomitans, these increases were significant. we observed no statistically signifi- cant relationships when gingival index or attachment loss were evaluated. anti-stress protein serum antibody concentrations and clinical measurements subjects were stratified into groups ( , , and ) based on their mean whole mouth gingival index ( = to < . ; = . to < . ; = > . ). the anti-stress pro- tein antibody concentrations in these groups were then compared by anova. as shown in figure b, a consistent trend is noted. gingival index strata of and were associated with higher antibody concentrations, while scores greater than (significant amounts of gin- †† bio-rad laboratories, hercules, ca. ‡‡ kirkegaard & perry laboratories. §§ sigma chemical co., st. louis, mo. ‖‖ epicon, idexx, westbrook, me. ¶¶ stat-view, sas institute, cary, nc. table . clinical description of subject population clinical measurement mean ± s.d. range of means by subject (minimum-maximum) plaque index . ± . . - . gingival index . ± . . - . probing depth (mm) . ± . . - . attachment loss (mm) . ± . . - . givitis) were associated with lower levels of antibody. in the case of anti-hsp and anti-groel anti- bodies, the concentrations were significantly (p < . ) lower in the stratum category compared to the category. for the other stress proteins, while trends were apparent, the differences were not within the % confidence level. a similar pattern is seen when examining the relationship between mean probing depth and anti-stress protein antibody con- centration (fig. a). the highest antibody concentrations were found in subjects in the mm and mm strata. subjects who have mean probing depths greater than mm ( mm stratum) have significantly (p < . ) reduced antibody concentrations for all stress proteins, except hsp . figure c shows the same relationships for attachment loss. again, the same trend is obvious and is significant (p < . ) for hsp and dnak. we then examined the relationship between the presence of anti-stress protein antibodies and colo- nization of the subgingival plaque by specific peri- odontal disease-associated microorganisms (fig. ). in this figure, we show the relationship between the antibody concentrations and levels of colonization as measured by the slot immunoblot assay. these levels (low, moderate, and high) correspond to < . × , . to × , and > × microorganisms in the undiluted plaque sample assessed in the assay. as shown in figure a, there is an association between colonization and anti-hsp concentration. in all cases, there is a significantly (p < . ) lower anti- hsp concentration associated with the lowest level of colonization regardless of the bacterial species examined. in all cases, with the exception of a. actino- mycetemcomitans, the highest antibody concentration is associated with the highest level of colonization. there does not appear to be any significant associ- ation in the relationship between the anti-hsp con- centrations and colonization. there is an apparent association with b. forsythus colonization; however, it is not statistically significant. this is also the case when the associations between anti-groel antibodies and colonization are examined (fig. c). in the cases of a. actinomycetemcomitans and b. forsythus while the antibody concentrations appear to be lower at the highest level of colonization, they are not statistically significant. finally, significant (p < . ) relationships between the anti-dnak antibody concentrations and coloniza- tion by p. gingivalis and t. denticola are evident in figure d. though not significant, a. actinomycetem- comitans reveals a trend with anti-dnak antibodies similar to that observed for the other three antibodies. in all cases, the antibody concentration at the highest level of colonization is lower than the preceding con- centration. similarly, b. forsythus reveals this pattern with anti-dnak and anti-groel antibodies. regression modeling of anti-stress protein antibodies in order to begin to understand the variables that con- tribute to the anti-stress protein antibody concentra- tions, we used step-wise and multiple regression models which examined the contribution of age, gen- der, amish/non-amish status, gingival index, probing depth, attachment loss, calculus index, plaque index, and microbial colonization. in the case of the hsp antibodies, variables were found to have significant contributions to the antibody concentration having a r = . and p < . . these variables were prob- ing depth (pd) and p. gingivalis concentration (pg). the equation derived from the regression model was y = − *pd + *pg. this confirmed the inverse relationship with probing depth and the posi- tive relationship with colonization by p. gingivalis. attempts to model the other stress protein antibodies were not successful. discussion there has been a considerable focus on stress proteins in current infectious disease research due to the obser- vations that these protein families are immunodomi- nant antigens of many human pathogens. as a result we felt that it was timely to assess the association between immunity to common stress proteins and one of the most common microbial-mediated diseases in humans, periodontal disease. we selected common, commercially available stress proteins, human and humoral immunity to stress proteins volume • number table . colonization versus mean probing depth mean sib score (mean ± sem) microorganism mm* mm* mm* p† n = n = n = p. gingivalis . ± . . ± . ‡ . ± . < . a. actinomycetemcomitans . ± . . ± . . ± . ns b. forsythus . ± . . ± . ‡ . ± . < . t. denticola . ± . . ± . ‡ . ± . § < . * stratification categories: mm, mean probing depth < . mm; mm, mean probing depth ≥ . and < . ; mm, mean probing depth ≥ . mm. † anova. ‡ significant difference (p < . ) between mm and mm categories. § significant difference (p < . ) between mm and mm categories. j periodontol • october lopatin, shelburne, van poperin, kowalski, bagramian microbial in origin. human hsp and hsp were used because they are amongst the most common of the stress protein families in eukaryotic systems. since there is evidence in studies of candida albicans that conser ved hsp epitopes, shared between humans and candida, were responsible for protection against systemic candidiasis, we felt that evaluating the association between anti-human hsp antibodies and oral disease might be informative. we chose groel and dnak (hsp and hsp ) since they rep- resented the most highly conserved stress proteins of microbial origin. the clinical specimens were derived from a patient population that was from an earlier study of an amish community. , based on an evaluation of the oral health of this population and comparisons with non- amish living in the same geographical location, we felt that, with the exception of a lack of routine oral hygiene, there were no significant differences between the amish and the non-amish in this area. while this is a randomly-selected population with few members pre- senting with advanced periodontitis, there is a clear relationship between disease severity (probing depth) and level of colonization by putative periodontal pathogens. our studies also demonstrated a clear relationship between the serum concentration of of the specific anti-stress protein antibodies and clinical measures of periodontal disease. the serum antibodies (igg) were highest when the subjects have the best oral health. this was most obvious when the mean probing depths are examined. it was interesting that throughout these analyses, while the antibodies reactive with human hsp tended to follow the same trends, they showed the least statistically significant relationships. however, its microbial homologue, dnak, demonstrated consid- figure . relationship between clinical measurements and serum anti-stress protein antibody concentration. antibody concentration for each stress protein is expressed in relative fluorescence units (rfu) as determined by particle concentration fluorescence immunoassay (pcfia). error bars indicate standard error of the mean for the antibody concentration in each clinical category. statistical significance of antibody titers (p ≤ . ): *significant differences between lowest and highest clinical stratum; †significant differences between middle and highest clinical stratum. a. mean gingival index; subjects were stratified into groups ( , , and ; white, gray, and black bars, respectively) based on their mean whole mouth gingival index ( = to < . ; = . to < . ; = > . ). sample sizes for categories , , and were , , and , respectively. b. mean probing depth; subjects were stratified into groups ( mm, mm, and mm; white, gray, black bars, respectively) based on their mean whole mouth probing depths ( mm, < . mm; mm, ≥ . and < . ; mm, ≥ . mm). sample sizes for categories mm, mm, and mm were , , and , respectively. c. mean attachment loss; subjects were stratified into groups ( mm, mm and mm; white, gray, black bars, respectively) based on their mean whole mouth attachment losses ( mm, < . mm; mm, ≥ . and < . mm, ≥ . mm). sample sizes for categories mm, mm and mm were , , and , respectively. humoral immunity to stress proteins volume • number erable disease-associated differences. this would sug- gest that even with the considerable homology within the hsp family, the epitopes that are being recog- nized immunologically are probably those which are not evolutionarily conserved. in contrast, a very signif- icant inverse relationship between disease and human hsp antibody concentration probably indicates that highly conserved epitopes are being recognized. while we did not possess purified microbial hsp protein at the time of this study, investigations in progress in our laboratory demonstrate a high degree of cross-reactivity between human hsp and the hsp homologues of p. gingivalis and a. actinomycetemcomitans based on antibody reactivity (unpublished data). similarly, serum igg antibody concentrations reactive with groel followed similar trends. mean gingival indices and attachment losses also followed these trends. our observations are somewhat similar of a report by schett et al. they examined anti-hsp antibod- ies in sera (igg) and found that the antibody concen- figure . relationship between serum anti-stress protein antibody concentration and colonization. antibody concentration for each stress protein is expressed in relative fluorescence units (rfu) as determined by particle concentration fluorescence immunoassay (pcfia). error bars indicate standard error of the mean for the antibody concentration in each colonization category. colonization by selected microorganisms is expressed as low (sib score = ), moderate (sib score = ) and high (sib score = + ) (white, gray, and black bars, respectively). statistical significance of antibody titers (p ≤ . ): *for significant differences between low and moderate colonization; †for significant differences between low and high colonization; and ‡for significant differences between moderate and high colonization. a) anti-hsp antibodies; b) anti-hsp antibodies; c) anti-groel antibodies; d) anti-dnak antibodies. sample sizes for low, medium, and high colonization categories by microorganism are as follows: p. gingivalis, , , (l,m,h, respectively); a. actinomycetemcomitans, , , ; b. forsythus, , , ; and t. denticola, , , . j periodontol • october lopatin, shelburne, van poperin, kowalski, bagramian trations were highest in periodontitis. this conflicts with our observations that in periodontitis the anti-hsp anti- body levels are lowest. a possible explanation for this discrepancy is not immediately obvious; however, spe- cific differences between our studies exist. there is a considerable difference in sample size between the studies. in their study, a total of subjects were divided into groups. there are also differences between the antigens tested. we tested only e. coli groel and schett et al. reported serum (igg) data only for recombinant mycobacterial hsp . finally, and perhaps the most important difference is that in our random population, we do not have the severe periodontitis that is observed in the schett groups. and as a result, our most diseased group is considerably healthier than theirs and resembles their intermediate (gingivitis) disease. our study also examined the association between colonization by specific microbial species and anti- stress protein antibodies. we found no significant associations between anti-groel or anti-hsp con- centrations and colonization by the specific micro- organisms in our test panel. again, we found this interesting since relationships between antibody con- centration and colonization were observed with anti- dnak antibodies, an hsp homologue, again indicating that, in this case, the non-conserved (anti- bacterial) epitopes are probably more important. however, we observed the most significant associa- tions between the anti-hsp concentrations and microbial colonization. since the antigen used to test for anti-hsp antibodies is derived from human sources, the antibodies detected most likely represent those directed against conserved epitopes, rather than species-specific or anti-bacterial. in all cases, except for a. actinomycetemcomitans, there appeared to be a significant association between increased col- onization and anti-hsp antibody concentration. statistical modeling clearly demonstrated the inverse relationship with probing depth and the positive rela- tionship with colonization. the model very clearly defines the relationship between p. gingivalis and hsp . the most surprising observation is the inverse relationship between the antibody concentrations and oral disease. most prior studies of humoral immunity to periodontal disease-associated microorganisms and oral health have shown a positive correlation. thus, the present observations may actually be identifying the presence of protective antibodies, rather than sim- ply presence of the microorganism in the gingival sul- cus. if these are, in fact, protective antibodies, the next critical step will be to localize the antigens using these antibodies in order to help assess the role of the anti- gen in the virulence of the microorganism. it will be critical to determine if the stress proteins play a role in adherence and colonization, or if they interfere with normal mammalian cell function once the microorgan- ism has established its infection. homologues of specific stress protein families have been demonstrated to be present in oral bacteria, including f. nucleatum, p. intermedia, p. nigrescens, p. melaninogenica, a. actinomycetemcomitans, and p. gingivalis. hsp /groel and hsp /dnak homo- logues have been detected using cross-reactive anti- bodies against prototype members. , , , , homologues of dnak, groel, and groesl have been cloned and sequenced from p. gingivalis and a. actin- omycetemcomitans. , , , , , in addition, the hsp gene homologue of a. actinomycetemcomitans was “accidentally” cloned by winston et al. there have been numerous suggestions that the hsp of pathogens may play a role in their viru- lence , studies by matthews and burnie demon- strate that immunity to candida albicans hsp is important for survival from systemic candidiasis. other studies have shown that the normally non- pathogenic s. cerevisiae can be made pathogenic by causing an over-expression of the hsp gene. mutations in an hsp gene (htra) in salmonella typhimurium result in reduced virulence. finally, reports by kirby et al. have shown that the potent bone-resorbing mediator of a. actinomycetemcomi- tans is homologous to groel. these findings sup- port the importance of understanding the role of stress proteins in microbial virulence and the function of the host response in blocking these effects. our studies employing stress protein homologues reveal that there is considerable conservation of hsp epitopes with periodontal disease-associated microor- ganisms. clearly, since we were able to demonstrate associations using purified human hsp, autoimmunity (as opposed to autoimmune disease) may serve an important function in host defense in periodontal dis- ease. this is not a novel observation and has been proposed by other investigators studying the role of host immunity to stress proteins. the relationship between anti-hsp immunity, oral health, and colonization is reminiscent of the observa- tions by matthews and burnie in their studies of sys- temic candidiasis. in interpreting our findings, it should be clear that we are not using antigens derived from any of the periodontal disease-associated microorgan- isms in our panel. the serum antibodies and the associ- ations that we have described are likely to reflect the contributions of specific antigenic epitopes that have been conserved through evolution due to their impor- tance to the inherent function of the stress protein. we would expect that if we had employed stress proteins derived from our microbial panel, significantly different results would have been obtained. in that case, we would predict that the predominant serum antibody response would be against the species-specific epitopes and would probably reflect infection “history” rather than protective antibodies. our laboratory is currently cloning the hsp homologue of p. gingivalis and once complete we will be able to address issues related to homology between human and p. gingivalis hsp and the epitopes that are involved in this apparent protec- tive response. once sufficient quantities of purified or recombinant hsps of periodontal disease-associated microorganisms are available we will be able to begin to address the importance of immunity to conserved versus microbe-specific epitopes. since matthews and burnie demonstrated that protection could be attrib- uted to the recognition of a specific conserved epitope, it may be possible to establish a genetic basis for resis- tance to p. gingivalis (or other species) colonization based on the ability to recognize a specific epitope. further elucidation of this model is dependent on evalu- ating the immunity to specific hsp epitopes. acknowledgments the authors acknowledge the expert technical assis- tance provided by mrs. christine a. binsfeld in the per- formance of the pcfia analysis. mr. shelburne is a research specialist in the biomaterials technology center of m. this study was supported by u.s. public service grants de , de , and de . references . ebersole jl. systemic humoral immune responses in periodontal disease. crit rev oral biol med ; : - . . boutsl ea, koseki t, nishihara t, ishikawa i. characterization of the immunodominant antigens of porphyr omonas gingivalis in high-responder patients. oral microbiol immunol ; : - . . wilson m, reddi k, henderson b. cytokine-inducing components of periodontopathogenic bacteria. j periodont res ; : - . . wilson m. biological activities of lipopolysaccharides from oral bacteria and their relevance to the pathogenesis of chronic periodontitis. sci prog ; : - . . yoshimura f, sugano t, kawanami m, kato h, suzuki t. detection of specific antibodies against fimbriae and membrane proteins from the oral anaerobe bacteroides gingivalis in patients with periodontal diseases. microbiol immunol ; : - . . daly cg, seymour gj, kieser jb. bacterial endotoxin: a role in chronic inflammatory periodontal disease? j oral pathol ; : - . . shinnick tm. heat shock proteins as antigens of bacterial and parasitic pathogens. curr top microbiol immunol ; : - . . craig ea, gambill bd, nelson rj. heat shock proteins: molecular chaperones of protein biogenesis. microbiol rev ; : - . . hendrick jp, hartl fu. molecular chaperone functions of heat-shock proteins. ann rev biochem ; : - . . lindquist s. the heat-shock response. ann rev biochem ; : - . . polla bs. a role for heat shock proteins in inflammation? immunol today ; : - . . minota s, cameron b, welch wj, winfield jb. autoantibodies to the constitutive -kd member of the hsp family of heat shock proteins in systemic lupus erythematosus. j exp med ; : - . . minota s, koyasu s, yahara i, winfield j. autoantibodies to the heat-shock protein hsp in systemic lupus erythematosus. j clin invest ; : - . . winfield j, jarjour w, minota s. stress protein auto- antibodies and the expression of stress proteins on the surface of human gamma-delta cells and other cells of the immune system. chem immunol ; : - . . kleindienst r, schett g, amberger a, et al. athero- sclerosis as an autoimmune condition. isr j med sci ; : - . . lu b, mcbride bc. stress response of porphyromonas gingivalis. oral microbiol immunol ; : - . . maeda h, miyamoto m, hongyo h, nagai a, kurihara h, murayama y. heat shock protein (groel) from porphyromonas gingivalis: molecular cloning and sequence analysis of its gene and purification of the recombinant protein. fems microbiol lett ; : - . . maeda h, miyamoto m, hongyo h, nagai a, kurihara h, mur yama y. heat shock protein (groel) from porphyromonas gingivalis: molecular cloning and sequence analysis of its gene and purification of the recombinant protein. fems microbiol lett : ; : - . . vayssier c, mayrand d, grenier d. detection of stress proteins in porphyromonas gingivalis and other oral bacteria by western immunoblotting analysis. fems microbiol lett ; : - . . nakano y, inai y, yamashita y, et al. molecular and immunological characterization of a -kda protein of actinobacillus actinomycetemcomitans. oral microbiol immunol ; : - . . lokensgard i, bakken v, schenck k. heat shock response in actinobacillus actinomycetemcomitans. fems immunol med microbiol ; : - . . bagramian ra, farghaly mm, lopatin d, sowers m, syed sa, pomerville jl. a comparison of periodontal disease among rural amish and non-amish adults. j clin periodontol ; : - . . bagramian ra, farghaly mm, lopatin d, sowers m, syed, sa, pomerville jl. periodontal disease in an amish population. j clin periodontol ; : - . . silness j, löe h. periodontal disease in pregnancy. (ii) correlation between oral hygiene and periodontal condition. acta odontol scand ; : - . . löe h, silness j. periodontal disease in pregnancy. (i) prevalence and severity. acta odontol scand ; : - . . ramfjord sp. the periodontal disease index (pdi). j periodontol ; (suppl.): - . . van poperin n, lopatin de. slot immunoblot assay for detection and quantitation of periodontal disease- associated microorganisms in dental plaque. j clin microbiol ; : - . . loesche wj, lopatin de, giordano j, alcoforado g, hujoel p. comparison of the benzoyl-dl-arginine- naphthylamide (bana) test, dna probes, and immunological reagents for ability to detect anaerobic periodontal infections due to porphyromonas gingivalis, treponema denticola, and bacteroides forsythus. j clin microbiol ; : - . . loesche wj, lopatin de, stoll j, van poperin n, hujoel pp. comparison of various detection methods for humoral immunity to stress proteins volume • number j periodontol • october lopatin, shelburne, van poperin, kowalski, bagramian periodontopathic bacteria: can culture be considered the primary reference standard? j clin microbiol ; : - . . shelburne ce, sandberg gp, binsfeld ca, wolff lf, curry ra. monoclonal antibodies to lipopolysaccharide of four oral bacteria associated with periodontal disease. j periodont res ; : - . . matthews r, burnie j. the role of hsp in fungal infection. immunol today ; : - . . schett g, metzler b, kleindienst r, et al. salivary anti- hsp antibodies as a diagnostic marker for gingivitis and a possible link to atherosclerosis. int arch allergy immun ; : - . . koga t, kusuzaki t, asakawa h, senpuku h, nishihara t, noguchi t. the -kilodalton groel-like protein of actinobacillus actinomycetemcomitans. j periodontal res ; : - . . ando t, kato t, ishihara k, ogiuchi h, okuda k. heat shock proteins in the human periodontal disease process. microbiol immunol ; : - . . hotokezaka h, ohara n, hayashida h, et al. trans- criptional analysis of the groesl operon from porphy- romonas gingivalis. oral microbiol immunol ; : - . . yoshida a, nakano y, yamashita y, yu h, ohishi m, koga t. isolation and characterization of the dnakj operon from actinobacillus actinomycetemcomitans. dna sequence ; : - . . winston jl, toth si, roe ba, dyer dw. cloning and characterization of the actinobacillus actinomyce- temcomitans gene encoding a heat-shock protein homologue. gene ; : - . . lathigra rb, butcher pd, garb, tr, young db. heat shock proteins as virulence factors of pathogens. curr top microbiol immunol ; : - . . fer nandez rc, logan sm, lee, sh, hof fman ps. elevated levels of legionella pneumophila stress protein hsp early in infection of human monocytes and l cells correlate with virulence. infect immun ; : - . . hodgetts s, matthews r, morrissey g, mitsutake k, piper p, bur nie j. over-expression of sacchar omyces cerevisiae hsp enhances the virulence of this yeast in mice. fems immunol med microbiol ; : - . . kirby ac, meghji s, nair sp, et al. the potent bone- resorbing mediator of actinobacillus actinomyce- temcomitans is homologous to the molecular chaperone groel. j clin invest ; : - . send reprint requests to: dr. dennis e. lopatin, department of biologic and materials sciences, school of dentistry, university of michigan, north university ave., ann arbor, mi - . fax: / - . accepted for publication february , . short reports journal of medical genetics , , - linkage analysis of manic depression in an irish family using h-ras and ins dna markers manic depression (bipolar affective disorder) is one of the major psychiatric illnesses. it is distinguished from unipolar major depression by the occurrence of manic episodes, symptoms of which show a variable combination of heightened and expansive mood, restlessness, irritability, pressure of speech, disinhibition, increased energy, and grandiose ideas or delusions. it has a lifetime risk of slightly less than % in most populations studied. a large genetic component has been shown using twin and adoption studies. egeland et all have shown linkage between the manic depressive phenotype in one north american pedigree and two polymorphic dna markers on the tip of the short arm of chromosome . other studies ' have failed to show this linkage in icelandic and other north american pedigrees. we have ruled out tight linkage between these dna markers and the manic depressive phenotype, assuming that the disorder is segregating as an autosomal dominant trait in a large irish pedigree. a single, unilateral source of the manic depression is likely but cannot be proven. the diagnoses were based on the research diagnostic criteria of spitzer et al, compiled using a combination of interviews, a review of the case notes, and the schizophrenia and affective disorders schedule-lifetime version (sads-l). all cases were of bipolar affective disorder, apart from one case of unipolar depression. of the unaffected subjects only those over the age of were used to minimise the risk of false negative phenotype assignment. the pedigree is shown in the figure. dna samples from members of the pedigree were received for publication november . revised version accepted for publication january . digested with the restriction enzymes pvuii and sacd. they were separated by electrophoresis on agarose gels and transferred to nylon membranes. hybridisations were carried out with the dna probes h-ras to sacd digests and ins to pvuii digests. both of these loci show high frequency restriction fragment length polymorphisms owing to the insertion or deletion of short, repeated dna sequences (variable tandem repeats). the resulting genotypes are shown in the figure. lod scores were calculated using the computer program liped and the results are presented in the table. these data exclude the possibility of close linkage between manic depression and the chromosome markers h-ras and ins, under the assumption that there is an autosomal dominant gene responsible for the disorder in this family. this would indicate that the gene or genes responsible for manic depression in this family are at other, as yet unknown, loci. further work is needed to identify other manic depressive gene loci in this and other pedigrees. isolation and examination of these genes will lead to a better understanding of the pathogenesis of the disease and its interactions with the environment. michael gill*, patrick mckeont, and peter humphries* *department of genetics, trinity college dublin; and tdepression and manic depression research unit, st patrick's hospital, dublin, ireland. abbcab bc bcab ab bc bc bc bc ac ab bb ab figure pedigree of family showing age, h-ras alleles (a,b,c), and ins alleles ( , , , ). table lod scores calculated between the two marker loci, h-ras i and ins, and the manic depression phenotype, for various values of recombination fraction ( ), using three selected penetrance values for the susceptible genotypes (aa and aa); was the maximum penetrance of the susceptible genotype found in the amish study' and - was the average penetrance found in their sample. penetrance recombination frequency - - - - - - - h-ras - -x - - - - ( - - - - - - - - -x - - ( - - - - - - - - - - - -x - - - - - - - - - - - - ins - -x - - - - - - - - - - - - - -x - - - - - - ( - - - i - - - - - -xc - - - - - - - - - - - - co p yrig h t. o n a p ril , b y g u e st. p ro te cte d b y h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n s e p te m b e r . d o w n lo a d e d fro m http://jmg.bmj.com/ short reports references egeland ja, gerhard ds, pauls dl, et al. bipolar affective disorders linked to dna markers on chromosome . nature ; : - . hodgkinson s, sherrington r, gurling h, et al. molecular genetic evidence for heterogeneity in manic depression. nature ; : - . detera-wadleigh sd, berettini wh, goldin lr, boorman d, anderson s, gershon es. close linkage of c-harvey-ras- and the insulin gene to affective disorder is ruled out in three north american pedigrees. nature ; : - . spitzer rl, endicott j, robins e. research diagnostic criteria: rationale and reliability. arch gen psychiatr ; : - . correspondence and requests for reprints to dr m gill, department of genetics, lincoln place gate, trinity college, dublin , ireland. prenatal diagnosis of mosaicism for del( )(q * q * ) and a normal cell line a year old single hispanic woman had amniocentesis because of maternal age. she had had five pregnancies, resulting in two normal children with a previous partner, one elective abortion, and one tubal ectopic pregnancy with the present year old partner. the medical and family histories were unremarkable. two separate primary amniotic fluid cell cultures at weeks' gestation showed mosaicism for ,xy/ ,xy, del( )(q - q - )(fig ). six of cells ( %) from one primary culture and eight of cells ( %) from the other primary culture showed the deletion. the chromosomes of the parents were normal. the pregnancy was electively terminated by prosta- glandin at weeks' gestation. the fetus weighed g (at about the th centile). noted were the following cranio- facial anomalies: high and narrow forehead, long philtrum, small and thin lips especially the lower (fig ), long and broad thumbs, contractures at the middle interphalangeal joints, bilateral transverse palmar creases, long and broad big toes, and long toes. necropsy showed a large foramen q fig partial gtg banded karyotype from an amniotic fluid cell. the arrows indicate the breakpoints in the normal chromosome (left) and in the idiogrammatic (right). the dark band q - and some ofthe light staining band q - are deleted in the anomalous chromosome . received for publication june . revised version accepted for publication august . fig thefetus at weeks. ovale that was indistinguishable from an atrial septal defect. the deletion was found in % ( / ) of cultured cells from amniotic fluid, in % ( / ) of cells from cord blood, and in % ( / ) of cells from umbilical cord tissue obtained at the time of pregnancy termination. since this pregnancy, the couple has had another pregnancy resulting in a normal son. mosaicism for a structural anomaly at prenatal diagnosis is an uncommon event, occurring in only of about genetic amniocenteses.' since de grouchy et al first described a syndrome associated with partial deletion of the long arm of chromosome , several other physical anomalies associated with deletion of q - *q - have been described. this deletion was found in a proportion of cells from the present fetus, who showed some craniofacial features similar to those of the child previously reported, including a high and narrow forehead and long philtrum. the deletion responsible for this case is more proximal than the deletion associated with de grouchy syndrome, which appears to involve q (probably q - ). we thank mr william herbert who participated in the patient's care. partial support was provided by us public health, maternal and child health services, grant no . miriam g wilson and ming s lin genetics division, department of pediatrics, university of southern california school of medicine, and los angeles county- university of southern california medical center, los angeles, california, usa. references hsu lyf, perlis te. united states survey on chromosome mosaicism and pseudomosaicism in prenatal diagnosis. prenat diagn ; : - . co p yrig h t. o n a p ril , b y g u e st. p ro te cte d b y h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n s e p te m b e r . d o w n lo a d e d fro m http://jmg.bmj.com/ prognostic significance of peritoneal lavage cytology in staging gastric cancer: systematic review and meta-analysis vol:.( ) gastric cancer ( ) : – https://doi.org/ . /s - - -y review article prognostic significance of peritoneal lavage cytology in staging gastric cancer: systematic review and meta‑analysis sara jamel · sheraz r. markar · george malietzis · amish acharya · thanos athanasiou · george b. hanna received: february / accepted: july / published online: august © the author(s) . this article is an open access publication conclusion this study suggests that patients with initial positive cytology may have a good prognosis following neo- adjuvant treatment if the cytology results change to negative after treatment. keywords gastric cancer, stomach neoplasm · laparoscopy · peritoneal cytology · cancer staging · cancer prognosis introduction the main treatment of advanced nonmetastatic gastric can- cer is surgical resection with perioperative chemotherapy or chemoradiotherapy [ , ]. efforts to prolong survival in metastatic gastric cancer have showed little improvement [ , ]. accurate staging of gastric cancer is crucial in selecting the appropriate treatment option, whether curative or pallia- tive. the japanese gastric cancer association included the results of cytological examination of peritoneal lavage fluid as a key prognostic factor in their classification of gastric carcinoma [ , ]. however, recently published guidelines suggested that cytology-positive status in the absence of other noncurative factors, that is, macroscopic disease, can be managed with d gastrectomy and perioperative chemo- therapy [ ]. initial data of those treated with surgery alone showed poor -year survival; however, more recent publica- tions have shown that the use of postoperative chemotherapy improves overall survival rates to %, [ , ]. on the other hand, if the information on cytology status were available before surgery, a chemotherapy-first strategy could be taken whereby patients whose cytology status turned negative could be preferentially treated with curative surgery [ , ]. the incidence of positive peritoneal cytology for patients with gastric cancer varies, in published reports, from % to abstract background peritoneal cytology has been used as a part of the cancer staging of gastric cancer patients. the primary aim of this systematic review was to evaluate the value of peritoneal cytology as part of the staging of gastric cancer and survival prediction. the second aim was to establish if positive cytology may be modified by neoadjuvant therapy, to improve prognosis. methods an electronic literature search was performed using embase, medline, web of science, and cochrane library databases up to january . the logarithm of the hazard ratio (hr) with % confidence intervals (ci) was used as the primary summary statistic. comparative studies were used, and the outcome measure was survival in three groups: ( ) positive versus negative cytology at staging lapa- roscopy immediately preceding surgery; ( ) effect of neo- adjuvant therapy on cytology and survival; and ( ) positive cytology in the absence of macroscopic peritoneal disease was compared with obvious macroscopic peritoneal disease. results pooled analysis demonstrated that positive cytology was associated with significantly reduced over- all survival (hr, . ; % ci, . – . ; p < . ). interestingly, negative cytology following neoadjuvant chemotherapy was associated with significantly improved overall survival (hr, . ; % ci, . – . ; p < . ). the absence of macroscopic peritoneal disease with positive cytology was associated with significantly improved overall survival (hr, . ; % ci, . – . ; p < . ). * george b. hanna g.hanna@imperial.ac.uk department of surgery and cancer, imperial college london, th floor qeqm building, st mary’s hospital, south wharf road, london w ny, uk http://crossmark.crossref.org/dialog/?doi= . /s - - -y&domain=pdf prognostic significance of peritoneal lavage cytology in staging gastric cancer: systematic… % [ ]. peritoneal washings positive for cancer cells have been demonstrated to correlate with the extent of cancer (t / t , %; t /t , %; m+, %) [ ] and have been consid- ered as stage iv disease [ ]. the influence of positive cytol- ogy on survival has been shown as a powerful independent predictor of survival when compared to other postoperative pathological variables such as the tumor serosal invasion or lymph node involvement [ , , , ]. positive cytology was shown to be the most powerful predictor of outcome, with a risk ratio of . for patients undergoing curative resection [ ]. furthermore, studies have also shown that the number and arrangement of cytology-positive cells have an effect on survival at the time of gastrectomy [ , ]. the results of the randomized controlled trial by the apan clinical oncology group (jcog ) and korea gastric cancer association (kgca ), comparing gastrectomy plus chemotherapy versus chemotherapy alone in advanced gastric cancer with a single noncurable factor, showed no advantage of resecting the primary gastric cancer in the presence of peritoneal metastasis [ ]. nevertheless, the treatment recommendations for gastric cancer in the event of positive cytology range from palliative chemotherapy to attempts at neoadjuvant therapy followed by surgical resec- tion [ , ]. the aim of this study was to evaluate the value of peri- toneal cytology as part of the staging of gastric cancer and survival prediction. the secondary aim is to establish if positive cytology may be modified by neoadjuvant therapy to improve prognosis. methods literature search strategy an electronic literature search was undertaken using embase, medline, web of science, and cochrane library databases up to january . the search terms ‘gastric can- cer,’ ‘laparoscopy,’ ‘peritoneal cytology,’ ‘cancer staging,’ and ‘prognosis,’ and medical subject headings (mesh) ‘stomach neoplasms,’ ‘neoplasm metastasis,’ ‘laparos- copy,’ and ‘cytology’ were used in combination with the boolean operators and or or (fig. ). two authors (s.j. and s.r.m.) performed the electronic search independently in january . the electronic search was supplemented by a hand-search of published abstracts from meetings of the society of academic and research surgery, digestive disease week, the association of upper gastro-intestinal surgeons of great britain and ireland, and the american society of clinical oncology for – . the reference lists of articles obtained were also searched to identify fur- ther relevant citations; as was the current controlled trials register (http://www.controlled-trials.com). abstracts of the articles identified by the electronic search were scrutinized by two of the authors (s.j. and s.r.m.) to determine their suitability for inclusion in the pooled analysis. any discord- ances regarding study inclusion between these two authors were settled in discussion with a third independent author (a.a.). the quality of evidence provided by each study was evaluated using the oxford levels of evidence-based medi- cine scoring system (http://www.cebm.net/oxford-centre- evidence-based-medicine-levels-evidence-march- ). publications were included in this review if they meet the following criteria: • studies concerning patients with gastric cancer • comparative studies of patients with positive and nega- tive peritoneal cytology • comparative studies evaluating the effect of neoadjuvant chemotherapy upon patients with positive cytology from gastric cancer • comparative studies of patients with positive peritoneal cytology in the absence of macroscopic peritoneal dis- ease and patients with macroscopic peritoneal disease. publications were excluded if they met any of the follow- ing criteria: • studies published in a language other than english • case reports or cohort studies including fewer than ten patients • noncomparative studies or studies not concerning peri- toneal cytology and gastric cancer. in the situation in which authors from the same institution had published a primary paper and then an updated analysis with a larger patient cohort, the most recent publication was included in the analysis. outcome measures for meta‑analysis of comparative studies the primary outcome measure evaluated was the hazard ratio (hr) for overall survival. three comparisons were made: . positive versus negative cytology at staging laparoscopy immediately preceding surgery. . initially positive cytology that became negative follow- ing neoadjuvant therapy was compared with positive cytology that remained positive despite neoadjuvant therapy. . positive cytology in the absence of macroscopic perito- neal disease was compared with obviously macroscopic peritoneal disease. http://www.controlled-trials.com http://www.cebm.net/oxford-centre-evidence-based-medicine-levels-evidence-march- http://www.cebm.net/oxford-centre-evidence-based-medicine-levels-evidence-march- s. jamel et al. statistical analysis the logarithm of the hazard ratio (hr) with % confi- dence intervals (ci) was used as the primary summary sta- tistic. to estimate hr and its variance, this was extracted from the study directly or required additional calculation depending on the method of data being presented: annual mortality rates, survival curves, number of deaths, or per- centage of freedom from death [ ]. meta-analysis of data was conducted using a random effects model. publication bias was explored graphically with funnel plots to detect asymmetry and any outliers. interstudy heterogeneity was assessed using the chi-square statistic and the i value to measure the degree of variation not attributable to chance alone: this was graded as low (i < %), moderate (i = – %), or high (i > %). the significance level was set at p < . . calculations were performed by g.m. and verified by t.a. this study was performed in line with cochrane recommendations, following the moose guidelines, using appropriate sta- tistical software (stata/se ) [ ]. results patient demographics the total number of patients included in this meta-analysis was , with a male to female ratio of : . (table ). the tumor demographics have been described for each group: negative versus positive cytology (table ). meta‑analysis positive versus negative cytology pooled analysis of studies [ , , , , – ] included patients in total, in the positive and in the negative cytology group at staging laparoscopy. the median follow-up period ranged from to months. this pooled analysis demonstrated that positive cytology was associated with a significantly reduced overall survival (hr, . ; % ci, . – . ; p < . ) (fig. ). there was evidence of significant statistical heterogeneity for this result (i = . %). fig. prisma flow diagram of literature search in this meta- analysis prognostic significance of peritoneal lavage cytology in staging gastric cancer: systematic… t ab le d em og ra ph ic s of p at ie nt s w ith c yt ol og y- po si tiv e (c yt + ve ) a nd c yt ol og y- ne ga tiv e (c yt − ve ) r es ul ts st ud y to ta l p at ie nt s f: m ra tio m ed ia n ag e a ge ra ng e n o. p at ie nt s c yt + ve r ec ur re nc e n o. p at ie nt s c yt − ve r ec ur re nc e c om or bi di tie s c om or bi di tie s b ad gw el l / . – b en tr em / . – b ri to / . . . – . c hu w a / . c e ua no ra st er / . fu ka ga w a / . ji an g – k an g . . k at su ra gi / . k od er a l a to rr e / / . – l ee m ak in o / . de m an zo n / . m iy as hi ro / . – n ak ag aw a / . – n od a / . r ib ei ro / . r os en be rg / . w on g to ta l s. jamel et al. table pathological features of gastric cancer in both positive cytology (a) and negative cytology (b) nodal involvement primary tumor (clinical t disease) tumor differentiation histological type angio- lymphatic invasiont –t t –t differentiated poorly dif- ferentiated intestinal diffuse (a) positive cytology badgwel bentrem brito – ( ), – ( ) chuwa euanoraster fukagawa jiang kang katsuragi kodera la torre lee makino de manzoni miyashiro nakagawa noda riheiro rosenberg wong (b) negative cytology badgwel bentrem brito chuwa euanoraster fukagawa jiang kang katsuragi kodera la torre lee makino de manzoni miyashiro nakagawa noda ribeiro rosenberg wong prognostic significance of peritoneal lavage cytology in staging gastric cancer: systematic… following neoadjuvant therapy: positive versus negative cytology pooled analysis of five studies [ , , – ] included patients in total; in the positive cytology and in the negative cytology group. the median follow-up period ranged from to months. this pooled analysis demon- strated that negative cytology following neoadjuvant chemo- therapy was associated with significantly improved overall survival (hr, . ; % ci, . – . ; p < . ) (fig. ). there was evidence of significant statistical heterogeneity for this result (i = . %). positive cytology versus macroscopic peritoneal disease pooled analysis of seven studies [ , , , , , ] included patients in total, in the positive cytology and in the macroscopic peritoneal disease group. the median follow-up period ranged from to months. this pooled analysis demonstrated that positive cytology in the absence of macroscopic peritoneal disease was asso- ciated with a significantly improved overall survival (hr, . ; % ci, . – . ; p < . ) (fig. ). there was no evidence of significant statistical heterogeneity for this result (i = %). bias exploration/sensitivity analyses funnel plots were created for combined and subgroup analy- sis for the various factors to visually assess the publication bias; these demonstrated symmetry. to determine the influ- ence of each study’s individual dataset, we performed sensi- tivity analyses for the subgroups as described. a single study involved in the pooled meta-analysis was excluded each time, and the corresponding hr was not changed notice- ably (data not shown). discussion this meta-analysis has demonstrated negative peritoneal cytology before treatment improves survival rate when com- pared with positive cytology. cytology should be considered a modifiable factor as it was found in this meta-analysis, that the change in cytology status from a positive to nega- tive result following chemotherapy was shown to carry an improvement in overall survival. furthermore, although pos- itive cytology is considered stage iv disease, the prognosis and overall survival associated with positive cytology versus macroscopic peritoneal metastasis are not equivalent [ ]. fujiwara et al. have shown that the change in cytology status to negative following receiving neo-adjuvant intraperitoneal fig. forrest plot of pooled analysis demonstrated that posi- tive cytology results were asso- ciated with significantly reduced overall survival (hr, . ; % ci, . – . ; p < . ) s. jamel et al. chemotherapy and systemic chemotherapy improved progno- sis [ ]. it is worth noting that although lorenzen et al. have also shown that the change in cytological status to negative following chemotherapy led to improved prognosis, almost % with negative cytology became positive following chemotherapy, thus worsening their prognosis and outcome [ ]. the prediction of response of patients to neoadjuvant therapy as assessed by cytology remains a challenging area for future research to provide patient- and tumor-targeted therapy. regarding peritoneal disease, this meta-analysis has shown that positive cytology alone carries better sur- vival compared with macroscopic peritoneal dissemina- tion. although survival with no treatment can be similar between these two groups, the use of neo-adjuvant chemo- therapy was shown to improve the -year overall survival from % in gross peritoneal disease to % in positive cytology with no overt peritoneal disease [ ]. therefore, the concept that positive cytology is a potentially modifi- able factor is further supported. interestingly, miyashiro fig. forrest plot for pooled analysis demonstrated that nega- tive cytology results following neoadjuvant chemotherapy were associated with significantly improved overall survival (hr, . ; % ci, . – . ; p < . ) fig. pooled analysis demon- strated that positive cytology in the absence of macroscopic peritoneal disease was associ- ated with significantly improved overall survival (hr, . ; % ci, . – . ; p < . ) prognostic significance of peritoneal lavage cytology in staging gastric cancer: systematic… et al. also studied the number of cancer cells detected in cytology studies versus peritoneal metastasis and found that when a higher number of cells was detected, survival was similar to those with peritoneal metastasis [ ]. there was insufficient evidence available to define a threshold of positive cancer cells from cytology that changed sur- vival from this review, which remains an important area for future research. there are a number of limitations to this systematic review and meta-analysis that need to be acknowledged. first, the lack of randomized control trials (rcts) that met the inclusion criteria is therefore reducing the power of the analyses. second, only studies in the english-language lit- erature were included, so it is possible that relevant stud- ies in other languages will be identified in the future. also, patient demographics and co-morbidities were not reported in all the included studies. in conclusion, the results of this meta-analysis support the importance of peritoneal cytology results in the assess- ment of gastric cancer patients. we have shown that nega- tive cytology and the change in cytological status from positive to negative improve survival in gastric cancer. this knowledge justifies the notion to reconsider the presence of positive peritoneal cytology as an absolute indication for palliative intent of treatment without further consideration to changing status following chemotherapy (fig. ). the change of initial positive cytology to negative subsequent to treatment should be the subject of a prospective large-scale multicenter study that examines long-term survival benefits. compliance with ethical standards conflict of interest no funding sources were used in the prepara- tion of this manuscript, and the authors have no conflicts of interest to declare. ethical approval no ethical approval or informed consent statement was required for this review article. sources of funding sheraz r. markar is supported by the national institute for health research (nihr). the views expressed are those of the authors and not necessarily those of the nhs, the nihr, or the department of health. open access this article is distributed under the terms of the creative commons attribution . international license (http://crea- tivecommons.org/licenses/by/ . /), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appro- priate credit to the original author(s) and the source, provide a link to the creative commons license, and indicate if changes were made. references . japanese classification of gastric carcinoma. japanese gastric can- cer, nd edn. gastric cancer. ; : – . . bentrem d, wilton a, mazumdar m, et al. the value of perito- neal cytology as a preoperative predictor in patients with gastric carcinoma undergoing a curative resection. ann surg oncol. ; : – . . miyashiro i, takachi k, doki y, et al. when is curative gastrec- tomy justified for gastric cancer with positive peritoneal lavage cytology but negative macroscopic peritoneal implant? world j surg. ; : – . . association japanese gastric cancer. japanese gastric cancer treatment guidelines (ver. ). gastric cancer. ; : – . . kodera y, ito s, mochizuki y, et al. long-term follow up of patients who were positive for peritoneal lavage cytology: final report from the ccog study. gastric cancer. ; : – . . bando e, makuuchi r, miki y, et al. clinical significance of intraoperative peritoneal cytology in gastric carcinoma-analysis of patients. th international gastric cancer congress ; abstract p – . . mezhir jj, shah ma, jacks lm, et al. positive peritoneal cytology in patients with gastric cancer: natural history and outcome of patients. indian j surg oncol. ; : – . . okabe h, hata h, ueda s, et al. a phase ii study of neoadjuvant chemotherapy with s- and cisplatin for stage iii gastric cancer: kugc . j surg oncol. ; : – . . badgwell b, cormier jn, krishnan s, et al. does neoadjuvant treatment for gastric cancer patients with positive peritoneal cytol- ogy at staging laparoscopy improve survival? ann surg oncol. ; : – . . conlon kc. staging laparoscopy for gastric cancer. ann ital chir. ; : – . . fujitani k, yang hk, kurokawa y, et al. randomized controlled trial comparing gastrectomy plus chemotherapy with chemotherapy alone in advanced gastric cancer with a single non-curable factor: japan clinical oncology group study jcog and korea gastric can- cer association study kgca . jpn j clin oncol. ; : – . . itsuka y, kaneshima s, tanida o, et al. intraperitoneal free cancer cells and their viability in gastric cancer. cancer (phila). ; : – . gastric cancer cytology status at staging laparoscopy nega ve posi ve repeat cytology post chemotherapy nega ve posi ve surgery pallia ve surgery +/-chemotherapy chemotherapy fig. management algorithm for gastric cancer patients depending on their cytology status and response to chemotherapy http://creativecommons.org/licenses/by/ . / http://creativecommons.org/licenses/by/ . / s. jamel et al. . bonenkamp jj, songun i, hermans j, et al. prognostic value of positive cytology findings from abdominal washings in patients with gastric cancer. br j surg. ; : – . . sakuramoto s, sasako m, yamaguchi t, et al. adjuvant chemo- therapy for gastric cancer with s- , an oral flu-oropyrimidine. n engl j med. ; : – . . parmar mk, torri v, stewart l. extracting summary statistics to perform meta-analyses of the published literature for survival endpoints. stat med. ; : – . . stroup df, berlin ja, morton sc, et al. meta-analysis of obser- vational studies in epidemiology: a proposal for reporting. meta- analysis of observational studies in epidemiology (moose) group. jama. ; : – . . lee sd, ryu kw, eom bw, et al. prognostic significance of peri- toneal washing cytology in patients with gastric cancer. br j surg. ; : – . . la torre m, ferri m, giovagnoli mr, et al. peritoneal wash cytol- ogy in gastric carcinoma. prognostic significance and therapeutic consequences. eur j surg oncol. ; : – . . ribeiro u jr, safatle-ribeiro av, zilberstein b, et al. does the intraoperative peritoneal lavage cytology add prognostic infor- mation in patients with potentially curative gastric resection? j gastrointest surg. ; : – . . rosenberg r, nekarda h, bauer p, et al. free peritoneal tumour cells are an independent prognostic factor in curatively resected stage ib gastric carcinoma. br j surg. ; : – . . brito am, sarmento bj, mota ed, et al. prognostic role of posi- tive peritoneal cytology in patients with resectable gastric cancer. rev col bras cir. ; : – . . chuwa ew, khin lw, chan wh, et al. prognostic significance of peritoneal lavage cytology in gastric cancer in singapore. gastric cancer. ; : – . . emoto s, kitayama j, ishigami h, et al. clinical significance of cytological status of peritoneal lavage fluid during intraperitoneal chemotherapy for gastric cancer with overt peritoneal dissemina- tion. ann surg oncol. ; : – . . euanorasetr c, lertsithichai p. prognostic significance of peri- toneal washing cytology in thai patients with gastric adenocar- cinoma undergoing curative d gastrectomy. gastric cancer. ; : – . . fukagawa t, katai h, saka m, et al. significance of lavage cytology in advanced gastric cancer patients. world j surg. ; : – . . jiang cg, xu y, wang zn, et al. clinicopathological analysis and prognostic significance of peritoneal cytology in chinese patients with advanced gastric cancer. anz j surg. ; : – . . kang kk, hur h, byun cs, et al. conventional cytology is not beneficial for predicting peritoneal recurrence after curative sur- gery for gastric cancer: results of a prospective clinical study. j gastric cancer. ; : – . . katsuragi k, yashiro m, sawada t, et al. prognostic impact of pcr-based identification of isolated tumour cells in the peritoneal lavage fluid of gastric cancer patients who underwent a curative r resection. br j cancer. ; ( ): – . . makino t, fujiwara y, takiguchi s, et al. the utility of pre-oper- ative peritoneal lavage examination in serosa-invading gastric cancer patients. surgery (st. louis). ; : – . . de manzoni g, verlato g, di leo a, et al. peritoneal cytology does not increase the prognostic information provided by tnm in gastric cancer. world j surg. ; : – . . nakagawa s, nashimoto a, yabusaki h. role of staging laparos- copy with peritoneal lavage cytology in the treatment of locally advanced gastric cancer. gastric cancer. ; : – . . noda s, yashiro m, toyokawa t, et al. borrmann’s macroscopic criteria and p-smad expression are useful predictive prognostic markers for cytology-positive gastric cancer patients without overt peritoneal metastasis. ann surg oncol. ; : – . . wong j, kelly kj, mittra a, et al. rt-pcr increases detection of submicroscopic peritoneal metastases in gastric cancer and has prognostic significance. j gastrointest surg. ; : – . . shimizu h, imamura h, ohta k, et al. usefulness of staging lapa- roscopy for advanced gastric cancer. surg today. ; : – . . aizawa m, nashimoto a, yabusaki h, et al. the clinical signifi- cance of potentially curative resection for gastric cancer follow- ing the clearance of free cancer cells in the peritoneal cavity by induction chemotherapy. surg today. ; : – . . lorenzen s, panzram b, rosenberg r, et al. prognostic signifi- cance of free peritoneal tumor cells in the peritoneal cavity before and after neoadjuvant chemotherapy in patients with gastric carci- noma undergoing potentially curative resection. ann surg oncol. ; : – . . fujiwara y, takiguchi s, nakajima k, et al. neoadjuvant intraperi- toneal and systemic chemotherapy for gastric cancer patients with peritoneal dissemination. ann surg oncol. ; : – . prognostic significance of peritoneal lavage cytology in staging gastric cancer: systematic review and meta-analysis abstract background methods results conclusion introduction methods literature search strategy outcome measures for meta-analysis of comparative studies statistical analysis results patient demographics meta-analysis positive versus negative cytology following neoadjuvant therapy: positive versus negative cytology positive cytology versus macroscopic peritoneal disease bias explorationsensitivity analyses discussion references lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / open accessr e s e a r c h a r t i c l e research articlepedhunter . and its usage to characterize the founder structure of the old order amish of lancaster county woei-jyh lee , toni i pollin , jeffrey r o'connell , , richa agarwala and alejandro a schäffer* abstract background: because they are a closed founder population, the old order amish (ooa) of lancaster county have been the subject of many medical genetics studies. we constructed four versions of anabaptist genealogy database (agdb) using three sources of genealogies and multiple updates. in addition, we developed pedhunter, a suite of query software that can solve pedigree-related problems automatically and systematically. methods: we report on how we have used new features in pedhunter to quantify the number and expected genetic contribution of founders to the ooa. the queries and utility of pedhunter programs are illustrated by examples using agdb in this paper. for example, we calculated the number of founders expected to be contributing genetic material to the present-day living ooa and estimated the mean relative founder representation for each founder. new features in pedhunter also include pedigree trimming and pedigree renumbering, which should prove useful for studying large pedigrees. results: with pedhunter version . querying agdb version . , we identified , presumed living ooa individuals and connected them into a -generation pedigree descending from founders ( females and males) after trimming. from the analysis of cumulative mean relative founder representation, founders ( females and males) accounted for over % of the mean relative founder contribution among living ooa descendants. discussion/conclusions: the ooa are a closed founder population in which a modest number of founders account for the genetic variation present in the current ooa population. improvements to the pedhunter software will be useful in future studies of both the ooa and other populations with large and computerized genealogies. background the old order amish (ooa) of lancaster county in pennsylvania are a closed founder population, with approximately , - , living individuals that can be connected into a single -generation pedigree. other large ooa populations live in ohio and indiana. there have been numerous medical genetics studies on the ooa. for several decades, the medical genetics studies focused on monogenic diseases such as brittle hair dis- ease [ , ]. more recently, research interests have broadened to include complex traits, such as parkinson disease [ , ], dementia [ ], diabetes [ ], blood pressure [ , ], hip frac- tures/osteoporosis [ ], and vision phenotypes [ ]. inves- tigators at the university of maryland school of medicine (um-som) [ ] have recruited over , ooa from lancaster county for several studies of complex adult- onset diseases beginning in with the initiative of dr. alan r. shuldiner [ , ]. these ooa studies have used genome-wide linkage analysis [ - ], candidate gene association analysis [ ], and most recently genome-wide association studies (gwas) to discover variants influenc- ing traits such as cardiac repolarization [ ], type dia- betes [ ], hypertension [ ], and fasting and post- prandial triglyceride levels [ ] or to validate locus asso- ciations first discovered in other populations, e.g., diabe- tes [ ], human height [ ], fasting glucose levels [ ], * correspondence: schaffer@helix.nih.gov national center for biotechnology information, national library of medicine, national institutes of health, rockville pike, bethesda, maryland , usa full list of author information is available at the end of the article biomed central © lee et al; licensee biomed central ltd. this is an open access article distributed under the terms of the creative commons at- tribution license (http://creativecommons.org/licenses/by/ . ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.biomedcentral.com/ lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of waist circumference [ ], bilirubin levels [ ] and response to the anti-clotting agent clopidogrel [ ]. the ooa comprise one of several groups in the more general category of anabaptists; other anabaptist groups living in north america include other amish, menno- nites, and hutterites. medical geneticists have been inter- ested in anabaptist populations because they are closed populations and have written genealogies and other fea- tures such as a homogeneous, rural lifestyle and high standard of living [ - ]. their genealogies were mostly published in paper books, which make integration and search challenging and time-consuming tasks. in we set out to construct a computer-searchable genealogy database of the ooa of lancaster county in pennsylvania for use by geneticists [ ]. to support the database, we developed a suite of query software that would solve pedigree-related problems automatically and systematically. the digital genealogy database expanded to include other anabaptist populations and was renamed anabaptist genealogy database (agdb) [ - ], and the query software package was named ped- hunter [ , ]. the initial source to construct agdb was a computer file updating the fisher family history (ffh) book [ ] edited by ms. katie beiler. later versions integrated the amish and amish mennonite genealogies (aamg) book [ ], a large computerized genealogy file from mr. james hostetler and two smaller updates from ms. beiler of recent births, deaths, and marriages in the lancaster area. the queries and utility programs of ped- hunter are illustrated by examples using agdb in this paper. several groups have used agdb in their research. some worked on rare diseases, such as nemaline myopa- thy [ ], congenital microcephaly [ ], and dystonia [ , ]. although agdb contains no explicit phenotype data, lifespan can be inferred when both birth and death dates are available. several studies on lifespan using agdb have established that lifespan is heritable [ ], that lifespan may be associated with other implicit traits [ , ], and that lifespan can be associated with experi- mentally measured traits [ ]. a frequent problem in medical genetics is to recon- struct the pedigree relationships among distant relatives. pedhunter was first designed to solve optimal pedigree connection problems and other problems related to pedi- gree construction, verification, and analysis. pedhunter is not formally tied to agdb; in particular, access to agdb requires ethics approval from an institutional review board (irb), while pedhunter is freely available. ped- hunter has been used to construct genealogies for link- age and haplotype analysis on hutterite families [ - ] and analyses of an icelandic population [ ], a southern italy population [ ], and a northern italy population [ ]. in this paper, we report on new features in pedhunter and on how those features can be used to quantify the impact of the pedigree structure of a founder population on the amount of genetic variation present in the current population. under a model of genetic drift, the number of founder alleles present in the current population will depend on factors such as sibship size and number of new genomes that enter each generation. from agdb we can answer this question: how many ooa founders contrib- uted what expected percent of the genetic material to the present-day living ooa? the answer impacts the genetic architecture, and hence phenotypic distribution of important traits such as low density lipoprotein (ldl) and triglyceride (tg) levels. a recent study characterized the patterns of linkage disequilibrium in the ooa [ ]. in this paper, we quantify the representation of founder genes in the current population that contribute to those patterns of linkage disequilibrium. methods pedhunter versions pedhunter version . [ ] that provided queries was first released in . in versions . , . , . , and the cur- rent . we increased the number of queries to . the full list of query programs and seven utility programs is in the additional file . pedhunter . has been tested on platforms running the linux, sunos, windows, and mac os x operating systems. the queries are imple- mented using transact-sql and c version of open cli- ent db-library. all pedhunter queries and utility programs are available as executable files that can be used from the command line prompt and in unix shell scripts. the current version of pedhunter is freely avail- able and can be downloaded from http:// www.ncbi.nlm.nih.gov/cbbresearch/schaffer/ped- hunter.html. pedhunter queries a genealogy database stored either as a sybase relational database or in structured ascii plaintext files. before version . , the source codes for these two variants were separate with much duplication. the single set of code files in version . can be adapted to either type of database representation with small changes to one code header file. queries in pedhunter . pedhunter . supports four categories of queries as basic operations: ) testing a relationship; ) finding all individuals satisfying a certain relationship; ) printing information; and ) complex queries. we use italics to indicate the names of specific queries. queries that find pedigrees print the pedigrees in linkage format [ ]. in the second category, pedhunter . adds two queries pertinent to our study of ooa founder structure: founder_descendant to find founders of a given individ- http://www.ncbi.nlm.nih.gov/cbbresearch/schaffer/pedhunter.html http://www.ncbi.nlm.nih.gov/cbbresearch/schaffer/pedhunter.html http://www.ncbi.nlm.nih.gov/cbbresearch/schaffer/pedhunter.html lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of ual, and a new query count_descendant to count number of descendants per ancestor from an input file in the for- mat of ancestor-descendant pairs. new complex queries pertinent to our study include: calculate_r to calculate relative founder representation (rfr) for a founder- descendant pair, and average_r to calculate mean rfr per founder in agdb, as explained below. examples of queries useful for analysis of the anabaptist genealogy database to find possible participants in agdb to be recruited into a study, the living query is useful to find living indi- viduals. the founder_descendant query can be followed to find the founders of each living individual. for each founder-descendant pair, the calculate_r tool computes the rfr, defined below. the average_r tool then com- putes the mean rfr for each founder. the person infor- mation for founders can be obtained using the person_info query. prior to running the asp query to find "all shortest paths" pedigree(s) connecting a set of sam- pled individuals, the subset query is required to first find a maximal subset of individuals that shares a common ancestor. pedigree renumbering pedhunter is also useful for genetic evaluations on large pedigrees. for example, at the united states department of agriculture (usda), the number of animals in the hol- stein dairy pedigree used for genomic evaluation of important economic traits has grown from , to , in less than months as new animals are added. the ability of pedhunter to scale to millions of subjects is a feature. other pedigree storage/query packages, such as pedsys [ ], are not able to process such a large pedi- gree (though pedsys adds the capability to connect large amounts of phenotype data with individuals in smaller pedigrees, such as the subset of more than , ooa individuals that have been studied at um-som). to facil- itate handling large pedigrees, we added the renumber_pedigree utility to pedhunter to number and order subject identifiers, and add missing spouses/mates if necessary into the pedigree. the renumbering process ensures the property that identifiers of parents are smaller than the identifiers of their children, which enables more efficient calculation of kinship coefficients [[ ], ch. ]. adding missing parents into the pedigree is necessary for some software packages, such as link- age, which assume that each person has either zero or two parents in the pedigree. the original identifiers are included in the output, so that information can still be connected to these identifiers. anabaptist genealogy database version . agdb was created in sybase sql server release . .x of the sybase relational database management software. each individual in agdb is assigned a unique integer, called the program id. two main tables in the pedhunter pedigree storage system are the person table and the par- ent-child relationship table. there have been several versions of agdb based on the sources mentioned in background and with sizes summa- rized at the beginning of results. the current agdb ver- sion . (agdb ) was created in , after the most recent published description [ ], to combine all the sources and updates. some small batches of corrections and updates have been incorporated based on feedback from users. as indicated by the change in the first word of agdb from the original "amish" to "anabaptist", many of the individuals in agdb are not ooa. as explained in results, we extracted a subpedigree from agdb that should include most living ooa individuals in the lan- caster area and their ancestors. we used the method described in the next subsection to predict which individ- uals are ooa. prediction of old order amish status an adult or near-adult (older adolescent) is of ooa sta- tus if the individual belongs to the ooa church, which means that the individual has chosen to be baptized. for the purpose of our query, we included children and young adults who were not yet baptized but lived with their ooa parents. for individuals in the printed ffh book, determining the ooa status by eye is usually easy, because for most family records, the religious affiliation is included. however, there are some omissions and some cases that are unclear. due to the syntax in ffh, the word "ooa" appeared only once per family record. when agdb was generated, the ooa status was captured only into the record of the person whose name preceded the word "ooa". if the family head was married, the ooa status was usually assigned to the spouse of family head in agdb. for example, the ffh book reads " . christian fisher b april , , d nov. , , farmer, m bar- bara yoder (yost yoder) ooa, ...". christian fisher's per- son record in agdb does not include any ooa status, but barbara yoder's record does. the spouse and children of the person assigned ooa status should also have ooa status in most cases. therefore, to predict if an individual in the genealogy requires some inferences across rela- tionship links. for individuals added into agdb by ms. beiler after the ffh book was printed, the amount of information about religious affiliation rapidly declined to zero. we believe that virtually all individuals added in updates by ms. beiler in and are ooa, due to biased ascertainment. prediction of ooa status is done in three different ways: ) for an individual born in or before , we con- sider person records of self, parents and spouses; ) for an lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of individual born in - , we check person records of self, parents, spouses and spouses' parents; ) for an indi- vidual born in or later, we examine person records of self, parents, grandparents and spouses. for an individual i, if any of the relatives of i considered has ooa status, then we predict that i has ooa status. pedigree trimming on founders working with large pedigrees, trimming redundant or irrelevant individuals (as defined below) from a pedigree will reduce the computational time of some pedigree analysis methods [ ]. in a nuclear family that is at the top of the pedigree and has only one child, we can replace both parent founders with their only child in the analysis because such a child's genomic data represents all genomic data derived from those parents. nuclear fami- lies at the top of pedigree are recursively trimmed, until no more trimming is possible. figure illustrates a mar- ried founder couple hans beuttschi and margaret zum bach with their only son peter beuttschi. after one round of trimming, peter beuttschi replaces his parents as a trimmed founder. peter beuttschi was married to marga- rete oswald, who is a female founder, and gave birth to their only son also named peter beuttschi. after a second round of trimming, peter beuttschi replaces his parents as a new trimmed founder. estimation of birth years for founders many of the older person records in agdb did not have birth dates in the data sources. to report our analysis by birth cohorts, it is necessary to estimate birth years for individuals; the estimated birth years are used for the analysis in this project, but are not recorded within agdb. for simplicity and to allow inclusion of records with known dates missing the month or day, we used only birth years but not actual birth dates. to systematically estimate missing birth years, we performed a frequency test on known parent-child pairs with known birth years for both individuals in agdb . we extracted birth year of each founder record with known birth year, and sub- tracted from birth year of the oldest child with known birth year. there are , known founder-and-oldest- child pairs. the mean birth year difference is " . years", and the median birth year difference is " years". there- fore, we used years per parent-child generation in the estimation of birth years for founders in agdb . if the birth year of a founder was unavailable, we sub- tracted years from the birth year of the (known or esti- mated) oldest child. if birth year of a child is unavailable, we recursively estimated birth years among the children of the child. the following example estimates a founder (unknown name in agdb )'s birth year to be " " by subtracting years (three generations) from the esti- mated oldest child (henry stehly)'s estimated oldest child (magdalena stehly)'s oldest child (catherine sieber) who was born in . mean relative founder representation we created and used the calculate_r tool to calculate the relative representation of each founder in each study par- ticipant. we define the rfr of a given founder in a given descendant as the expected proportion of alleles in the descendant that were inherited identical-by-descent (ibd) from the founder. for example, an offspring inher- its half its genome from each parent, thus the founder representation for each parent is one-half. the expected proportion can be computed as twice the kinship coeffi- cient between the parent and offspring. the kinship coef- ficient is defined as the probability at a given locus that the allele selected from one individual will be identical by descent to a randomly selected allele of a second individ- ual. for example, twice the kinship coefficient between a parent and an offspring, and the rfr of that parent in that offspring, is . . in a three-generation pedigree, the grandparent-grandchild kinship coefficient is . ; thus the relative representation of each grandparent in a grandchild is . . it should be noted that founder repre- sentation represents the average across the genome, whereas at any autosomal locus the two alleles an individ- ual inherits come from at most two founders. from these definitions and the pedigree structure we use average_r to calculate the mean rfr for each founder over all study descendants. by definition the rfrs in a given individual will sum up to . a subtle point is that the founder representation (expected ibd) as described above is calculated assuming no inbreeding in the founders because by definition, their ancestors are not in the genealogy. conceptually, the probability of inheriting a founder allele is a property of mendelian sampling in the pedigree, independent of the figure sample pedigree trimming in agdb . two recursive rounds of pedigree trimming on three founders down to one trimmed founder in agdb . hans beuttschi margaret zum bach peter beuttschi margarete oswald peter beuttschi lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of probability that the two alleles of a founder are inherited ibd from unknown ancestors. thus, the rfr of a parent in an offspring is . only under the assumption of no inbreeding. if the parent were completely inbred (say a mouse strain) then twice the kinship coefficient would be . . the former agrees with what we expect, while the lat- ter would imbalance the founder representation between an inbred father and non-inbred mother. results the size of agdb has grown from agdb , completed in containing , individuals and , marriages, to the current agdb , containing , individuals and , marriages [ - ]. in , we built a special version called fisher that includes , individuals and , marriages to accommodate three updates since ffh was published in . the results here are based on both fisher and agdb . the subjects of interest in the ongoing genetic studies at um-som are in fisher, but some of their ancestors who are not in fisher can be found in agdb . distribution of old order amish the procedure to analyze mean rfr of founders in pre- sumed living ooa individuals is illustrated in figure . by executing the age tool in pedhunter . on the , individuals in fisher, we collected , individuals born in - . using the living tool in pedhunter . , we found , presumed living individuals, with no death date recorded in fisher. by predicting the ooa status among , individuals born in - , we find , to be ooa. among , presumed living individuals, the results showed , presumed living ooa individuals born in - and in fisher. the difference between the , individuals used here and the , - , estimate in the background is due to children born in - and individuals born before who are still alive. we focused attention on the indi- viduals born in - because death records for those born before are rather incomplete, and birth records after are currently incomplete, although we plan to address these deficiencies in agdb. table reports the birth year and gender distribution among above , presumed living ooa individuals in fisher. the results show increasing numbers of births over time. the year with the most newborns is , in which there were , birth records ( females, males, and of unknown gender). the data consistently show more males than females born. we then located these , individuals in agdb by mapping their program ids from fisher to agdb . using the ancestors tool in pedhunter, we constructed a pedigree containing a total of , individuals, includ- ing the above , presumed living individuals, in figure procedure to analyze mean rfr in agdb . flowchart to analyze mean rfr of founders in presumed living ooa descendants. fisher database for each fisher id i: was i born in - without a known death date (as presumed living)? is i an ooa? discard i. no yes no agdb database convert fisher id i to agdb id d.convert fisher id i yes identify all ancestor founders of d. form pairs of married founder couples. for each founder couple (p,m): number of offspring for (p,m)? replace p and m by the offspring c. = form pairs of ma couplep f ma for each founder ouplep number of offspri replace p and m by == form pairs of trimmed founder and presumed living ooa descendant. form pairs of trimme presumed living oo � for each founder- descendant pair (f,d): calculate rfr as r of founder f in presumed living ooa descendant d. calculate mean rfr for each founder f over all presumed living ooa descendants. r sort all trimmed founders by the descending order of mean rfr ’s.r procedure to analyze mean rfr in agdb lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of agdb . the , individuals form a -generation pedigree, in which there are founders. there are living individuals recorded as founders themselves. the ooa study at um-som confirms that many of these are spouses of individuals who left the amish church, although they may have been ooa at some time and may have ooa children. among the founders, are female and are male. there are marriages between female founders and male founders; five male founders had two marriages to female founders, with the second mar- riage following the death of the first spouse in all cases. among marriages, founder couples have exactly one child. by applying the trimming technique described in methods, founders are reduced down to trimmed founders after one round and trimmed founders after two rounds. all subsequent analysis of founders uses this trimmed set of founders. in the trimmed set, there are female founders and male founders, and married founder couples including females and males. table reports the birth years for the founders. the two most ancient founders are a married couple, estimated to have been born in . prior to , birth years of more than % of founders are not recorded in agdb . all but one founder born after have known birth years. old order amish founder structure using the pedigree structure from agdb , one can esti- mate the contribution of the founders to the current ooa gene pool. this is an estimate because, as described in methods, the calculations are based on probabilistic analysis of the pedigree structures rather than observed dna segregation. moreover, there may be additional relationships (not in the genealogy) among the desig- nated founders and some relationships in the genealogy may be inaccurate. table reports on the birth years of founders and numbers of their living ooa descen- dants. the largest coverage number is , living descendants, who are descended from the oldest founder couple. of founders, were born before . however, many of these founders had few descendants. we were interested in calculating the number of founders contributing to the majority of the extant population to evaluate qualitatively and quantitatively our assumptions about the utility of the ooa for gene mapping. we used the calculate_r and average_r tools in ped- hunter . to calculate the relative representation of each founder in an average living ooa individual. by ranking founders in descending order of their founder representa- tion, we were able to count the number of founders repre- sented in the majority of expected alleles in an average individual among living ooa individuals. we computed the average expected genetic contribu- tion of each of the founders ( females and males) to each of the , presumed living ooa descendants as summarized in figure . we found that founders ( females and males) accounted for over % of the average founder contribution, with a sin- gle founder accounting for nearly % of the average con- tribution. half of the total founder representation came from only founders ( females and males). these data quantify the extent to which the ooa are a closed founder population ideal for elucidating the role of genetic variation in complex diseases. to put the coverage analysis in some chronological per- spective, it is useful to consider isaac huyard who was born on february , . he married into the ooa on december , after working as a servant for an amish family, and is anecdotally the last individual who was born and reached adulthood non-ooa, and then became ooa [ ]. of the highest contributing founders (accounting for % of gene pool) were born in table : distribution of birth years and genders for presumed living ooa in fisher. birth year female male unknown gender sum - , - , , , - , , , - , , , - , , , - , , , - , , , total , , , birth year cohorts of ten years are reported in rows, and genders in three categories are reported in columns. the total number of presumed living ooa individuals in fisher is , . lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of or before . the other three high-contributing found- ers were born in , and . on the other hand, founders born after account for only . % of the founder representation. thus, a detailed study of the ped- igree structure of the ooa as catalogued in agdb sup- ports the notion that there has been very little influx of genetic material into the ooa population since the mid- th century. among founders born after isaac huyard, we found that founders are adopted, and another two founders are likely adopted. one of the improvements in going from agdb to agdb was the identification of adopted table : distribution of known and estimated birth years of founders in agdb . birth year female male sum - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) - ( ) ( ) ( ) - ( ) ( ) - - - - - - - - - - ( ) ( ) - total ( ) ( ) ( ) birth year cohorts of ten years are reported in rows, and genders are reported in columns. the numbers represent both known and estimated birth years in the age group; the numbers in parentheses are the number of founders among that cohort whose birth years were estimated, as described in methods. lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of individuals, so that those "non-biological parent to child" links are not in the pedigrees that we construct, if the adoptive relationships are known. relevance of founder structure to published and ongoing studies as of october , the ooa studies at um-som included approximately , participants. % of these participants studied are descended entirely from a subset (numbers of founders per individual ranged between and ) of the founders born before . that is, the entire gene pool of those individuals was derived from founders born before . % of participants studied are descended entirely from a subset (numbers of found- ers ranged between and ) of the founders born before . a subset of founders with more than living descendants comprises the entire gene pool of % of the study participants. a subset of founders with table : distribution of birth years and numbers of descendants among founders in agdb . birth year ≤#(d)< ≤#(d)< ≤#(d)< , , ≤#(d)< , , ≤#(d) sum - - - - - - - total birth year cohorts of fifty years are reported in rows, and numbers of descendants #(d) are reported in columns. founders born earlier have larger numbers of presumed living ooa descendants. figure cumulative mean rfr in agdb . cumulative mean rfr of founders in , presumed living ooa descendants. lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of more than descendants comprises the entire gene pool of % of the study participants. excess of female founders the number of female founders ( ) is larger than the number of male founders ( ) among founders. we evaluated three possible causes for the excess of female founders: ) remarriages of male founders after widow- hood; ) marriages comprising one founder and one non- founder; ) possible overestimate of female founders due to the difficulty of tracking relationships between females with different married surnames. we mentioned previously that there are marriages between female founders and male founders. in addition to the married founder couples, there are female founders married to non-founder males, and there are male founders married to non-founder females. thus, remarriage of widowed male founders is only a minor factor in the excess of female founders. the propensity for female founders to marry non-founders is a more substantial factor, but this may be confounded by difficulty in correctly determining the founder status of females. the lack of knowledge about relationships among female founders is partly due to the male bias in the ffh and aamg books. among female founders, only have partial names given, and only have surnames, making it difficult to track relationships. there are distinct surnames using identical spelling, and after grouping some sets such as {moser, mosser, musser} that are likely to be different spellings of the same surname. if any individuals with the same surname share ancestry, we would be able to reduce the number of female founders. occasionally, the books hint at a hidden relationship among founders, via footnotes, but the footnotes were not used systematically as they are often speculative. we conclude that the excess of female founders is mostly due to cryptic or unknown relationships, so that some of the apparent female founders are not really founders. discussion/conclusions with new queries and utility programs in pedhunter ver- sion . , we identified , presumed living ooa indi- viduals born in - and connected them into a - generation pedigree descended from founders, after trimming. because of the small number of founders, the frequency of consanguineous marriages in ooa steadily increased over time and reached approximately % for individuals born in - . among consanguineous marriages, the median kinship coefficient stayed stable in the th century, but rose in the th century. table reports kinship coefficients of married ooa couples who had at least one offspring in agdb . numbers of couples and kinship coefficients are both increased in temporal statistics. analysis of cumulative mean rfr shows that founders accounted for over % of the average founder contribution among all living ooa descendants. such results confirm that the ooa in lancaster county are truly a closed population. the combination of lack of new genetic material, lack of socio-economic variation, and detailed genealogies make the ooa ideally suited for identifying some rare variants that are associated with complex phenotypes [ ]. the examples of gwas repli- cations cited in background prove that some trait-associ- ated snp alleles seen in other populations can also be found in the ooa. our characterization of the founder structure provides an explanation for why other trait- associated alleles did not enter the ooa population; for example, cystic fibrosis is one of the most common reces- sive diseases in individuals of european ancestry, but hardly seen among the ooa [ ]. that the ooa have a small number of founders, but linkage disequilibrium (ld) patterns similar to outbred european populations [ ] may seem paradoxical. the apparent paradox is explained by noting that ld is a mea- sure of non-random association of alleles at different loci. linkage between the loci maintains this association under random mating and drift, while recombination will decay the association. thus, allele and haplotype frequen- cies drift together. for example, suppose two snps have d' = in the founders, so that only three of the four possi- ble haplotypes are observed, with frequencies . , . and . , respectively, but drift to . , . and . in the current population. both allele and haplotype frequencies have changed, but ld has not changed. the assumption of common alleles is important as random drift over the generations spanned by agdb will not eliminate com- mon variation. for low frequency alleles there is longer ld in the amish due to linkage as shown in [ ] and also in some of our association studies [ , ], where the most significant signal can be more than kbp from the causal allele. one weakness in our characterization of the ooa founder structure is the apparent excess of female found- ers. we tested three hypotheses and concluded that the excess is mostly due to cryptic or unknown relationships, such that some female founders are not really founders. analyses of mitochondrial genomes could provide evi- dence regarding some of these cryptic relationships. the male lineage and y chromosome inheritance have been validated [ ] a unique y chromosome str haplotype bred true within each of the male lineages represented in the um-som study sample. the surnames of the males comprising these lineages captured % of the households in the lancaster county amish address book, which contains distinct surnames. this number lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of is much lower than the total male founders because of genetic drift, conversion of some earlier settlers to other anabaptist sects, and westward migration [ ]. one limitation of our rfr calculations is that the vari- ance of the kinship coefficient due to mendelian sampling variance is not included in the calculation. for example, the kinship coefficient is . for both parent-offspring and full sibs, but the variance is zero for parent-offspring and non-zero for full sibs. analytical expressions of kin- ship variances are not possible for complex pedigrees, but empirical variances can be obtained through simulation by repeated gene-dropping of distinct founder alleles through the pedigree. computationally efficient gene- dropping can be achieved using the ancestor-first pedi- gree renumbering described above. we may implement a function r-empirical in a future version of pedhunter. the notion of "founder" we used is with respect to a trimmed genealogy, not including any explicit conditions on the locations of birth or death. the data sources focus on individuals who lived at least some years in the present united states, but not exclusively. to quantify this, we looked at the source information on founders with known or estimated birth years in and before , and we found that founders ( females and males) probably died in europe or on the sea. therefore, there may be even more female founders who never reached north america. to increase the utility of agdb and other digitized genealogies, we continue to enhance pedhunter with queries and utility programs to assist the discovery pro- cess on pedigrees in large genealogies. for example, agdb has been used to estimate the encatchment popu- lation of specific hospitals to determine the denominator of the hip-fracture incidence [ ]. for a study of osteo- genesis imperfecta, agdb was used prospectively to identify individuals likely to carry a genetic variant of phenotypic interest [ ]. a pedigree constructed from agdb made it possible to trace the origin of a rare apoc null allele conferring a favourable lipid profile and apparent cardioprotective phenotype to a couple born at the turn of the th century [ ]. additionally, pedhunter has been used in other pedigrees, to discover genetic drift and founder effects [ ]. in sum, we quantified the founder structure of the ooa and implemented numerous improvements to the software pedhunter that will be useful in future studies of both the ooa and other populations with large, comput- erized genealogies. additional material abbreviations aamg: amish and amish mennonite genealogies; agdb: anabaptist geneal- ogy database; ffh: fisher family history; gwas: genome-wide association studies; ibd: identical-by-descent; ld: linkage disequilibrium; ooa: old order amish; rfr: relative founder representation; um-som: university of maryland school of medicine. competing interests the authors declare that they have no competing interests. additional file pedhunter . queries and utility programs. table : distribution of birth years and kinship coefficients among married ooa couples with offspring in agdb . birth year #(couples) average % percentile median % percentile - . . . . - . . . . - . . . . - . . . . - . . . . - . . . . - . . . . - . . . . - , . . . . - , . . . . - , . . . . - . . . . union set , . . . . birth year cohorts of ten years are reported in rows. a couple is assigned to the interval containing the average of the two birth years. numbers of married ooa couples #(couples) and kinship coefficients are reported in columns. couples born later tend to have larger kinship coefficients. http://www.biomedcentral.com/content/supplementary/ - - - -s .pdf lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of authors' contributions w-jl implemented the queries added in pedhunter version . , carried out the analysis of founder contributions and agdb shown here, and wrote the paper. tip developed the method for analyzing founder contributions, analyzed the founder contributions using an earlier version of agdb with the pedsys pack- age [ ], suggested additions to pedhunter, and wrote parts of the paper about founder contributions. jro helped develop the method for founder contributions and suggested additions to pedhunter. ra implemented most of the queries added in pedhunter versions . through . and organized data for all versions of agdb including version . and fisher formally announced in this paper. aas conceived agdb and pedhunter, assisted in their implemen- tation, and supervised the project. all authors edited the paper, read and approved all submitted versions including the final manuscript. acknowledgements this research was supported in part by the intramural research program of the nih, nlm. thanks to kathy ryan, braxton mitchell, alan shuldiner and the research team at the university of maryland and amish research clinic for collaborating on pedhunter/agdb usages in studies that stimulated the development of many queries, along with the outstanding cooperation of the amish community, without which the aforementioned studies would not have been possible. thanks to eric grant for suggesting the all_relatives query and for various other suggestions that improved the documentation. author details national center for biotechnology information, national library of medicine, national institutes of health, rockville pike, bethesda, maryland , usa, department of medicine, division of endocrinology, diabetes and nutrition, university of maryland school of medicine, w. redwood street, baltimore, maryland , usa and animal improvement programs laboratory, agricultural research service, united states department of agriculture, baltimore avenue, beltsville, maryland , usa references . nakabayashi k, amann d, ren y, saarialho-kere u, avidan n, gentles s, macdonald jr, puffenberger eg, christiano am, martinez-mir a, salas- alanis jc, rizzo r, vamos e, raams a, les c, seboun e, jaspers ngj, beckmann js, jackson ce, scherer sw: identification of c orf (ttdn ) gene mutations and genetic heterogeneity in nonphotosensitive trichothiodystrophy. am j hum genet , : - . . seboun e, lemainque a, jackson ce: amish brittle hair syndrome gene maps to p . . am j med genet a , : - . . lee sl, murdock dg, mccauley jl, bradford y, crunk a, mcfarland l, jiang l, wang t, schnetz-boutaud n, haines jl: a genome-wide scan in an amish pedigree with parkinsonism. ann hum genet , : - . . racette ba, good lm, kissel am, criswell sr, perlmutter js: a population- based study of parkinsonism in an amish community. neuroepidemiology , : - . . mccauley jl, hahs dw, jiang l, scott wk, welsh-bohmer ka, jackson ce, vance jm, pericak-vance ma, haines jl: combinatorial mismatch scan (cms) for loci associated with dementia in the amish. bmc med genet , : . . hsueh w-c, mitchell bd, aburomia r, pollin t, sakul h, gelder ehm m, michelsen bk, wagner mj, st jean pl, knowler wc, burns dk, bell cj, shuldiner ar: diabetes in the old order amish: characterization and heritability analysis of the amish family diabetes study. diabetes care , : - . . hsueh w-c, mitchell bd, schneider jl, wagner mj, bell cj, nanthakumar e, shuldiner ar: qtl influencing blood pressure maps to the region of pph on chromosome q - in old order amish. circulation , : - . . mcardle pf, dytch h, o'connell jr, shuldiner ar, mitchell bd, abney m: homozygosity by descent mapping of blood pressure in the old order amish: evidence for sex specific genetic architecture. bmc genet , : . . streeten ea, beck tj, o'connell jr, rampersand e, mcbride dj, takala sl, pollin ti, uusi-rasi k, mitchell bd, shuldiner ar: autosome-wide linkage analysis of hip structural phenotypes in the old order amish. bone , : - . . peet ja, cotch mf, wojciechowski r, bailey-wilson je, stambolian d: heritability and familial aggregation of refractive error in the old order amish. invest ophthalmol vis sci , : - . . pollin ti: the old order amish of lancaster county: elucidating the male founder structure and mapping metabolic syndrome quantitative trait loci. in phd thesis university of maryland baltimore, graduate program in human genetics; . . mitchell bd, mcardle pf, shen h, rampersaud e, pollin ti, bielak lf, jaquish c, douglas ja, roy-gagnon m-h, sack p, naglieri r, hines s, horenstein rb, chang y-pc, post w, ryan ka, brereton nh, pakyz re, sorkin j, damcott cm, o'connell jr, mangano c, corretti m, vogel r, herzog w, weir mr, peyser pa, shuldiner ar: the genetic response to short-term interventions affecting cardiovascular function: rationale and design of the heredity and phenotype intervention (hapi) heart study. am heart j , : - . . hsueh w-c, st jean pl, mitchell bd, pollin ti, knowler wc, ehm mg, bell cj, sakul h, wagner mj, burns dk, shuldiner ar: genome-wide and fine- mapping linkage studies of type diabetes and glucose traits in the old order amish: evidence for a new diabetes locus on chromosome q and confirmation of a locus on chromosome q -q . diabetes , : - . . pollin ti, hsueh w-c, steinle ni, snitker s, shuldiner ar, mitchell bd: a genome-wide scan of serum lipid levels in the old order amish. atherosclerosis , : - . . streeten ea, mcbride dj, pollin ti, ryan k, shapiro j, ott s, mitchell bd, shuldiner ar, o'connell jr: quantitative trait loci for bmd identified by autosome-wide linkage scan to chromosomes q and q in men from the amish family osteoporosis study. j bone miner res , : - . . damcott cm, ott sh, pollin ti, reinhart lj, wang j, o'connell jr, mitchell bd, shuldiner ar: genetic variation in adiponectin receptor and adiponectin receptor is associated with type diabetes in the old order amish. diabetes , : - . . post w, shen h, damcott c, arking de, kao whl, sack pa, ryan ka, chakravarti a, mitchell bd, shuldiner ar: associations between genetic variants in the nos ap (capon) gene and cardiac repolarization in the old order amish. hum hered , : - . . rampersaud e, damcott cm, fu m, shen h, mcardle p, shi x, shelton j, yin j, chang y-pc, ott sh, zhang l, zhao y, mitchell bd, o'connell j, shuldiner ar: identification of novel candidate genes for type diabetes from a genome-wide association scan in the old order amish: evidence for replication from diabetes-related quantitative traits and from independent populations. diabetes , : - . . wang y, o'connell jr, mcardle pf, wade jb, dorff se, shah sj, shi x, pan l, rampersaud e, shen h, kim jd, subramanya ar, steinle ni, parsa a, ober cc, welling pa, chakravarti a, weder ab, cooper rs, mitchell bd, shuldiner ar, chang y-pc: whole-genome association study identifies stk as a hypertension susceptibility gene. proc natl acad sci usa , : - . . pollin ti, damcott cm, shen h, ott sh, shelton j, horenstein rb, post w, mclenithan jc, bielak lf, peyser pa, mitchell bd, miller m, o'connell jr, shuldiner ar: a null mutation in human apoc confers a favorable plasma lipid profile and apparent cardioprotection. science , : - . . damcott cm, pollin ti, reinhart lj, ott sh, shen h, silver kd, mitchell bd, shuldiner ar: polymorphisms in the transcription factor -like (tcf l ) gene are associated with type diabetes in the amish: replication and evidence for a role in both insulin secretion and insulin resistance. diabetes , : - . . sanna s, jackson au, nagaraja r, willer cj, chen w-m, bonnycastle ll, shen h, timpson n, lettre g, usala g, chines ps, stringham hm, scott lj, dei m, lai s, albai g, crisponi l, naitza s, doheny kf, pugh ew, ben- shlomo y, ebrahim s, lawlor da, bergman rn, watanabe rm, uda m, tuomilehto j, coresh j, hirschhorn jn, shuldiner ar, schlessinger d, collins fs, davey smith g, boerwinkle e, cao a, boehnke m, abecasis gr, mohlke kl: common variants in the gdf -uqcc region are associated with variation in human height. nat genet , : - . . chen wm, erdos mr, jackson au, saxena r, sanna s, silver kd, timpson nj, hansen t, orrù m, grazia piras m, bonnycastle ll, willer cj, lyssenko v, shen h, kuusisto j, ebrahim s, sestu n, duren wl, spada mc, stringham received: december accepted: may published: may this article is available from: http://www.biomedcentral.com/ - / / © lee et al; licensee biomed central ltd. this is an open access article distributed under the terms of the creative commons attribution license (http://creativecommons.org/licenses/by/ . ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.bmc medical genetics , : http://www.biomedcentral.com/ - / / http://creativecommons.org/licenses/by/ . http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of hm, scott lj, olla n, swift aj, najjar s, mitchell bd, lawlor da, smith gd, ben-shlomo y, andersen g, borch-johnsen k, jørgensen t, saramies j, valle tt, buchanan ta, shuldiner ar, lakatta e, bergman rn, uda m, tuomilehto j, pedersen o, cao a, groop l, mohlke kl, laakso m, schlessinger d, collins fs, altshuler d, abecasis gr, boehnke m, scuteri a, watanabe rm: variations in the g pc /abcb genomic region are associated with fasting glucose levels. j clin invest , : - . . heard-costa nl, zillikens mc, monda kl, johansson ?, harris tb, fu m, haritunians t, feitosa mf, aspelund t, eiriksdottir g, garcia m, launer lj, smith av, mitchell bd, mcardle pf, shuldiner ar, bielinski sj, boerwinkle e, brancati f, demerath ew, pankow js, arnold am, chen y-di, glazer nl, mcknight b, psaty bm, rotter ji, amin n, campbell h, gyllensten u, pattaro c, pramstaller pp, rudan i, struchalin m, vitart v, gao x, kraja a, province ma, zhang q, atwood ld, dupuis j, hirschhorn jn, jaquish ce, o'donnell cj, vasan rs, white cc, aulchenko ys, estrada k, hofman a, rivadeneira f, uitterlinden ag, witteman jc, oostra ba, kaplan rc, gudnason v, o'connell jr, borecki ib, van duijn cm, cupples la, fox cs, north ke: nrxn is a novel locus for waist circumference: a genome-wide association study from the charge consortium. plos genet , :e . . sanna s, busonero f, maschio a, mcardle pf, usala g, dei m, lai s, mulas a, piras mg, perseu l, masala m, marongiu m, crisponi l, naitza s, galanello r, abecasis gr, shuldiner ar, schlessinger d, cao a, uda m: common variants in the slco b locus are associated with bilirubin levels and unconjugated hyperbilirubinemia. hum mol genet , : - . . shuldiner ar, o'connell jr, bliden kp, gandhi a, ryan k, horenstein rb, damcott cm, pakyz r, tantry us, gibson q, pollin ti, post w, parsa a, mitchell bd, faraday n, herzog w, gurbel pa: association of cytochrome p c genotype with the antiplatelet effect and clinical efficacy of clopidogrel therapy. jama , : - . . patton ma: genetic studies in the amish community. ann hum biol , : - . . mckusick va: medical genetic studies of the amish: selected papers baltimore and london: johns hopkins university press; . . francomano ca, mckusick va, biesecker lg: medical genetic studies in the amish: historical perspective. am j med genet c semin med genet , c: - . . agarwala r, biesecker lg, hopkins ka, francomano ca, schaffer aa: software for constructing and verifying pedigrees within large genealogies and an application to the old order amish of lancaster county. genome res , : - . . agarwala r, biesecker lg, tomlin jf, schäffer aa: towards a complete north american anabaptist genealogy: a systematic approach to merging partially overlapping genealogy resources. am j med genet , : - . . agarwala r, schäffer aa, tomlin jf: towards a complete north american anabaptist genealogy ii: analysis of inbreeding. hum biol , : - . . agarwala r, biesecker lg, schäffer aa: anabaptist genealogy database. am j med genet c semin med genet , c: - . . beiler k: fisher family history lancaster, pennsylvania: eby's quality printing; . . gingerich hf, kreider rw: amish and amish mennonite genealogies gordonville, pennsylvania: pequea publishers; . . johnston jj, kelley ri, crawford to, morton dh, agarwala r, koch t, schäffer aa, francomano ca, biesecker lg: a novel nemaline myopathy in the amish caused by a mutation in troponin t . am j hum genet , : - . . rosenberg mj, agarwala r, bouffard g, davis j, fiermonte g, hilliard ms, koch t, kalikin lm, makalowska i, morton dh, petty em, weber jl, palmieri f, kelley ri, schäffer aa, biesecker lg: mutant deoxynucleotide carrier is associated with congenital microcephaly. nat genet , : - . . saunders-pullman r, raymond d, senthil g, kramer p, ohmann e, deligtisch a, shanker v, greene p, tabamo r, huang n, tagliati m, kavanagh p, soto-valencia j, de carvalho aguiar p, risch n, ozelius l, bressman s: narrowing the dyt dystonia region and evidence for locus heterogeneity in the amish-mennonites. am j med genet a , a: - . . fuchs t, gavarini s, saunders-pullman r, raymond d, ehrlich me, bressman sb, ozelius lj: mutations in the thap gene are responsible for dyt primary torsion dystonia. nat genet , : - . . mitchell bd, hsueh w-c, king tm, pollin ti, sorkin j, agarwala r, schäffer aa, shuldiner ar: heritability of life span in the old order amish. am j med genet , : - . . sorkin j, post w, pollin ti, o'connell jr, mitchell bd, shuldiner ar: exploring the genetics of longevity in the old order amish. mech ageing dev , : - . . mcardle pf, pollin ti, o'connell jr, sorkin jd, agarwala r, schäffer aa, streeten ea, king tm, shuldiner ar, mitchell bd: does having children extend life span? a genealogical study of parity and longevity in the amish. j gerontol a biol sci med sci , : - . . njajou ot, cawthon rm, damcott cm, wu s-h, ott s, garant mj, blackburn eh, mitchell bd, shuldiner ar, hsueh w-c: telomere length is paternally inherited and is associated with parental lifespan. proc natl acad sci usa , : - . . greenwood cm, bureau a, loredo-osti jc, roslin nm, crumley mj, brewer cg, fujiwara tm, goldstein dr, morgan k: pedigree selection and tests of linkage in a hutterite asthma pedigree. genet epidemiol , (suppl ):s -s . . lamont re, loredo-osti jc, roslin nm, mauthe j, coghlan g, nylen e, frappier d, innes am, lemire eg, lowry rb, greenberg cr, triggs-raine bl, morgan k, wrogemann k, fujiwara tm, zelinski t: a locus for bowen- conradi syndrome maps to chromosome region p . . am j med genet a , a: - . . wittke-thompson jk, ambrose n, yairi e, roe c, cook eh, ober c, cox nj: genetic studies of stuttering in a founder population. j fluency disord , : - . . pinto jm, thanaviratananich s, hayes mg, naclerio rm, ober c: a genome-wide screen for hyposmia susceptibility loci. chem senses , : - . . thorsson b, sigurdsson g, gudnason v: systematic family screening for familial hypercholesterolemia in iceland. arterioscler thromb vasc biol , : - . . ciullo m, bellenguez c, colonna v, nutile t, calabria a, pacente r, iovino g, trimarco b, bourgain c, persico mg: new susceptibility locus for hypertension on chromosome q by efficient pedigree-breaking in an italian isolate. hum mol genet , : - . . dagklis a, fazi c, sala c, cantarelli v, scielzo c, massacane r, toniolo d, caligaris-cappio f, stamatopoulos k, ghia p: the immunoglobulin gene repertoire of low-count chronic lymphocytic leukemia (cll)-like monoclonal b lymphocytosis is different from cll: diagnostic implications for clinical monitoring. blood , : - . . van hout cv, levin am, rampersaud e, shen h, o'connell jr, mitchell bd, shuldiner ar, douglas ja: extent and distribution of linkage disequilibrium in the old order amish. genet epidemiol , : - . . terwilliger jd, ott j: handbook of human genetic linkage baltimore, maryland the johns hopkins university press; . . dyke b: pedsys: a pedigree data management system san antonio, texas southwest foundation for biomedical research, population genetics laboratory; . . lange k: mathematical and statistical methods for genetic analysis nd edition. new york, new york: springer-verlag; . . lange k, sinsheimer js: the pedigree trimming problem. hum hered , : - . . huyard de: isaac huyard joins the amish. in amish roots: a treasury of history, wisdom, and lore. reprint edition edited by: hostetler ja. baltimore, maryland: the johns hopkins university press; : - . . morton dh, morton cs, strauss ka, robinson dl, puffenberger eg, hendrickson c, kelley ri: pediatric medicine and the genetic disorders of the amish and mennonite people of pennsylvania. am j med genet c semin med genet , c: - . . shen h, damcott cm, rampersaud e, pollin ti, horenstein rb, mcardle pf, peyser pa, bielak lf, post ws, chang ypc, ryan ka, miller m, rumberger ja, sheedy pf, shelton j, oconnell jr, shuldiner ar, mitchell bd: the apob r q polymorphism is common in the old order amish and is a major cause of increased ldl-c concentrations and coronary artery calcification. arch intern med in press. . pollin ti, mcbride dj, agarwala r, schäffer aa, shuldiner ar, mitchell bd, o'connell jr: investigations of the y chromosome, male founder structure and ystr mutation rates in the old order amish. hum hered , : - . http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= lee et al. bmc medical genetics , : http://www.biomedcentral.com/ - / / page of . streeten ea, mcbride dj, lodge al, pollin ti, stinchcomb dg, agarwala r, schäffer aa, shapiro jr, shuldiner ar, mitchell bd: reduced incidence of hip fracture in the old order amish. j bone miner res , : - . . daley e, streeten ea, sorkin jd, kuznetsova n, shapses sa, carleton sm, shuldiner ar, marini jc, phillips cl, goldstein sa, leikin s, mcbride dj jr: variable bone fragility associated with an amish col a variant and a knock-in mouse model. j bone miner res , : - . . pardo lm, mackay i, oostra b, van duijn cm, aulchenko ys: the effect of genetic drift in a young genetically isolated population. ann hum genet , : - . pre-publication history the pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/ - / / /prepub doi: . / - - - cite this article as: lee et al., pedhunter . and its usage to characterize the founder structure of the old order amish of lancaster county bmc medical genetics , : http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids= http://www.biomedcentral.com/ - / / /prepub abstract background methods pedhunter versions queries in pedhunter . examples of queries useful for analysis of the anabaptist genealogy database pedigree renumbering anabaptist genealogy database version . prediction of old order amish status pedigree trimming on founders estimation of birth years for founders mean relative founder representation results distribution of old order amish old order amish founder structure relevance of founder structure to published and ongoing studies excess of female founders discussion/conclusions additional material wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ linkage of plasma adiponectin levels to q explained by association with variation in the apm gene toni i. pollin, keith tanner, jeffrey r. o’connell, sandra h. ott, coleen m. damcott, alan r. shuldiner, , john c. mclenithan, and braxton d. mitchell we performed a genome-wide linkage scan of plasma adiponectin levels in nondiabetic participants in the amish family diabetes study. the highest logarithm of odds (lod) score ( . ; p � . ) occurred on chro- mosome q between markers d s and d s , which flank apm /acdc, the adiponectin gene. the apm � a/� insertion/deletion polymorphism in the � untranslated region (single nucleotide polymor- phism [snp] � ; deletion allele frequency . in amish) showed strong association with adiponectin lev- els in a dosage-dependent manner in a direction con- sistent with that reported in previous studies, with deletion heterozygosity increasing adiponectin levels by . � . �g/ml and deletion homozygosity increasing levels by . � . �g/ml (p < . ). two other snps, rs and rs , showed moderate associa- tion. in a subset of subjects genotyped for both snp � and rs , including the apm snp � genotype as a covariate reduced the linkage signal at q by . lod units (from . to . ) and including both snps reduced the signal by . lod units (to . ). these findings, combined with a two-point lod score of . for snp � , provide evidence that variation in apm is responsible for linkage of adipo- nectin levels to q in the old order amish. diabetes : – , a diponectin is a fat-secreted hormone involved in insulin sensitivity, free fatty acid oxidation, and inhibition of inflammation ( , ). circulat- ing adiponectin levels are decreased in obesity ( ), diabetes ( ), hypertension ( ), and dyslipidemia ( ), which are components of the metabolic syndrome, or in- sulin resistance syndrome. adiponectin is one of a number of adipose tissue�secreted proteins collectively called adipocytokines, the discovery of which in the past decade has radically changed the view of adipose tissue from that of a simple energy storage depot to that of an active endo- crine organ. also known as acrp , adipoq, and gbp , adiponectin was discovered in and as the most abundantly expressed sequence tag in an adipose mrna library ( – ). the chromosomal region q , which con- tains apm (also known as acdc), the gene encoding adiponectin, has been linked to several features of the metabolic syndrome ( ) and diabetes ( ). adiponectin levels have been significantly linked to chromosomes ( , ), and ( ), and ( ) and suggestively linked to others ( , ). several investigators have characterized single nucleotide polymorphisms (snps) in the adiponec- tin gene and found one or more of these snps to be associated with diabetes ( ) and other metabolic syn- drome features, as well as with adiponectin levels them- selves ( – ). we measured adiponectin levels in participants in the amish family diabetes study (afds) to ) confirm and further define the relation between adiponectin levels and other metabolic syndrome components ( ) and ) iden- tify loci harboring genetic variants that may influence adiponectin levels (and thus insulin resistance and type diabetes). after finding that our strongest linkage signal for adiponectin levels in our genome scan occurred in the chromosomal region containing apm , the adiponectin structural gene, we performed association and linkage analysis between apm variation and adiponectin levels. our findings suggest that sequence variation in apm influences adiponectin levels. research design and methods recruitment for the afds began in early with the goal of identifying genes influencing the risk of type diabetes and related traits. the study protocol was approved by the institutional review board at the university of maryland school of medicine, and informed consent was obtained from each study participant. with the help of liaisons from the old order amish community, we identified individuals with type diabetes. these probands and their first- and second-degree relatives and spouses age years or older were invited to participate. all subjects could be connected into a single -generation pedigree ( ). among the individuals recruited and included in a -cm genomewide scan, there were subjects with type diabetes ( prevalent cases and incident cases) contained in sibships (including affected subjects in multiplex sibships). stored fasting plasma from subjects (including with diabetes) of the scanned subjects was available for measuring adiponectin levels. because of the potential influence of diabetes and its treatment on adiponectin levels, we excluded type diabetic subjects from the analysis, leaving a total of subjects for the linkage analysis. fasting plasma adiponectin levels were measured in an from the university of maryland school of medicine, baltimore, maryland; and the baltimore veterans affairs medical center, geriatric research, education and clinical center, baltimore, maryland. address correspondence and reprint requests to toni i. pollin, phd, division of endocrinology, diabetes, and nutrition, university of maryland school of medicine, w. redwood st., rm. , baltimore, md e-mail: tpollin@medicine.umaryland.edu. received for publication july and accepted in revised form september . afds, amish family diabetes study; ld, linkage disequilibrium; qtl, quantitative trait locus; snp, single nucleotide polymorphism; solar, se- quential oligogenic linkage analysis routines; utr, untranslated region. © by the american diabetes association. the costs of publication of this article were defrayed in part by the payment of page charges. this article must therefore be hereby marked “advertisement” in accordance with u.s.c. section solely to indicate this fact. diabetes, vol. , january additional nondiabetic subjects not included in the original genome-wide scan/linkage analysis; these subjects were included in the association analysis (for a total of subjects). phenotypes. blood samples were obtained from an antecubital vein after an overnight fast at the amish research clinic in strasburg, pennsylvania, or in subjects’ homes. adiponectin levels were measured in fasting plasma samples using a commercial radioimmunoassay kit (linco) according to the manufac- turer’s instructions. the manufacturer reports coefficients of variation of . – . and . – . % for inter- and intra-assay precision, respectively. samples were diluted at : ( �l plasma in , �l milliq water). � counts were measured for min on an automated � counter (packard cobra-ii auto gamma). all samples were assayed in duplicate, and results of samples with � counts differing by � % were discarded and the samples retested. assays in which adiponectin levels for quality control samples did not fall into the expected range were discarded. other phenotyping for the afds has been previously described in detail ( ). short tandem repeat genotyping. genotyping was performed on dna extracted from leukocytes using a screening set of highly polymorphic microsatellite short tandem repeat markers on the autosomes and the x chromosome from the abi prism linkage mapping set (applied biosystems division/perkin-elmer, foster city, ca). the mean marker heterozygosity was . (range . – . ). the average intermarker distance was . cm. the largest gap between markers was . cm, occurring on chromosome . the genotyping error rate based on blind replicates was . % on average. candidate gene snp genotyping. the adiponectin structural gene, apm or acdc, is � kb in length and contains three exons, one noncoding and two coding. from public databases and previous publications ( , ), we selected five snps (rs [promoter]), rs [promoter], rs [intron ], rs [exon ], and rs [intron ]) and one single base pair insertion/deletion polymorphism , bp downstream of the atg start codon in the � untranslated region (hereafter denoted as snp � ). these polymorphisms were chosen because they were distributed throughout the gene, had been previously reported to be common, and in some studies had been found to be associated with diabetes and related phenotypes in cauca- sian populations. the five snps were genotyped using the snpstream ultra high throughput genotyping system (beckman coulter, fullerton, ca) according to the manufacturer’s instructions. briefly, the target genomic sequences containing the snps were amplified as part of -plex pcrs, which were subjected to an extension reaction using �-tagged extension primers and fluorescent dye�labeled terminators. in a thermal cycled extension step, the primers hybridized to the specific amplicons one base adjacent to the snp site and were extended by one base at the � end with a fluorescently labeled nucleotide. these reaction products were transferred to an array plate, where each of the extension products in the multiplex reaction were sorted by hybridization of the unique �-tag sequence to its complementary probe immobilized in a mini-array within each well. the plates were imaged by the snpscope (beckman coulter). snps were called by comparing the two fluorescent signals. the error rates for these snps based on % blind replicates were %, except for snps rs and rs , which had error rates of . and . %, respectively. snp � was genotyped using the psq hs a pyrosequencer according to the manufacturer’s methods (pyrosequencing, uppsala, sweden; www. pyrosequencing.com). briefly, a pcr product was generated from a primer pair that included one primer covalently coupled to biotin, the biotinylated template was bound to streptavidin-coated sepharose hp beads, and this mixture was then annealed to a sequencing primer. stepwise elongation of a sequencing primer strand upon sequential addition of a specified sequence of deoxynucleotide triphosphates and the degradation of nucleotides by apyrase were carried out simultaneously. as the sequencing reaction progressed, the dna strand was extended and the sequence was determined from the measured signal output of light upon nucleotide incorporation. the resulting peaks in the pyrogram were analyzed using pyrosequencing software. the error rate for snp � based on % blind replicates was %. sequencing. to determine if snps found to be associated with variation in adiponectin levels were marking other functional snps, particularly those altering an amino acid sequence, we sequenced the entire coding region of apm , which comprises most of exon and a portion of exon , in a subset of individuals enriched for the presence of associated polymorphisms. sequencing was performed on an abi dna sequencer. statistical analysis. although virtually all subjects could be connected into a single -generation pedigree, we divided the sample into discrete fam- ilies for linkage analysis to reduce computational burden. these families contained – genotyped and phenotyped individuals and provided a large number of relative pairs, including parent-offspring pairs, sibling pairs, avuncular (aunt/uncle�niece/nephew) pairs, and first-cousin pairs. heritability, linkage, and association analyses were carried out using a variance components methodology. for heritability and linkage analyses, we partitioned variation in the adiponectin trait into components attributable to environmental covariates, the additive effects of genes (i.e., residual herita- bility), and a specific quantitative trait locus (qtl, the linkage component). these analyses were conducted using maximum likelihood procedures as im- plemented in the sequential oligogenic linkage analysis routines (solar) program ( ). the residual heritability was modeled as a function of the expected genetic covariances between relatives, and the qtl effect was mod- eled as a function of the identity-by-descent probabilities at the marker locus. allele frequencies were estimated from the data using maximum likelihood methods ( ). the hypothesis of linkage was evaluated by the likelihood ratio test, which determines whether the locus-specific effect is significantly � (ho [null hypothesis]: � qtl vs. ha [alternative hypothesis]: � qtl � ). in each model, we simultaneously adjusted for the effects of sex and sex-specific age and age squared. because of the sensitivity of variance components to violations of normality, the three adiponectin data points whose values were � sd from the mean were truncated and their values set to the value corresponding to sd from the mean (winsorization; ). to estimate the probability of obtaining a false-positive result and to obtain empirical loga- rithm of odds (lod) scores, we used the lodadj routine in solar to generate , fully informative unlinked markers. we evaluated evidence for linkage of adiponectin levels to these simulated markers and defined the probability of obtaining a false-positive result as the proportion of the , replicates for which a lod score greater than or equal to that observed for the original linked locus was obtained. all lod scores in this study were obtained by converting the empirical p value obtained by simulation to its correspond- ing lod score {lod ÷ [ *ln ( )]}. before association analysis, genotypes were checked for mendelian con- sistency using the pedcheck software package ( ) and inconsistencies (� . % of genotypes) were resolved or removed. using variance components, we estimated the effects of the snp genotype on adiponectin levels, adjusting for sex and sex-specific age and age squared). genotype was parameterized according to the number of copies of the minor allele the subject carried (genotype if major allele homozygote, if heterozygote, and if minor allele homozygote). parameter estimates were obtained conditional on the pedigree structure. for each snp, the likelihood ratio test was used to compare a model that included the apm snp as a covariate with a model that did not include the snp. allele frequencies were estimated by the maximum likelihood estimates conditioned on the pedigree structure as implemented in solar. linkage disequilibrium (ld) was estimated using an algorithm implemented in the software package zaplo, which uses both pedigree and ld information to find all possible haplotype configurations of the data under a zero-recombinant assumption ( ). to test whether the apm association explained the linkage to q , variance components linkage analysis was repeated with the associated apm polymorphism genotype as a covariate. the gene-dropping option of mendel . ( ) was used to simulate the segregation , times of an unlinked snp with the same frequency as the apm polymorphism. these simulated snp genotypes were then used as covariates in , repetitions of the linkage analysis to attempt to assess the significance of the lod change that occurred with the inclusion of the apm variant as a covariate. power estimation. we evaluated the power of our sample to detect linkage to qtls accounting for , , and % of the total variation in a model trait using simulation, as previously described ( ). for each of the three effect sizes, qtls were simulated and the power to detect linkage was defined as the proportion of replicates for which we obtained lod scores greater than selected values ( . and . ). results heritability and genome scan. the heritability of the plasma adiponectin trait, adjusted for sex and sex-specific age and age squared, was estimated at . � . . the maximum lod score in the entire genome scan was . (p . ), occurring on chromosome q between markers d s and d s (fig. and table ). we observed four other regions of suggestive linkage (table ): q – , near marker d s (lod . , p . ); q , between markers d s and d s (lod . , p . ); p – , near marker d s (lod . , p . ); and p , near marker d s (lod . , p . ). t.i. pollin and associates diabetes, vol. , january power estimation. the results of the power simulation indicated that the sample provided reasonable power ( %) to detect linkage (at lod scores � . ) for a qtl accounting for � % of the total trait variance. for a qtl accounting for % of the variance, power would be % to detect a lod score � . and % for a lod score � . . the power was much lower for a qtl accounting for only % of the variance ( % for a lod score � . and % for a lod score � . ). candidate gene analysis. the two markers flanking our strongest linkage signal, d s and d s , flank a . -mb region that contains the structural gene (apm ) encoding adiponectin. this observation motivated us to evaluate whether sequence variation in apm might influ- ence adiponectin levels in this population. we genotyped five snps and an insertion/deletion polymorphism (snp � ) distributed throughout the apm gene and known to be polymorphic in caucasian populations ( , ) and then performed single snp association analyses. as shown in table , the strongest association occurred with snp � , the single nucleotide insertion/deletion polymor- phism in the � untranslated region. heterozygosity for the insertion/deletion polymorphism was associated with an increase in the adiponectin level of . � . �g/ml, and deletion homozygosity was associated with an increase of . � . �g/ml (p � . for additive model). the rs and rs snps showed moderate associa- tion in a dosage-dependent manner with adiponectin levels (p . and . , respectively). when individuals with the rs gt or gg genotypes were excluded from the analysis (remaining n ), the association of snp � with adiponectin levels persisted, with
. � . �g/ml,
. � . �g/ml, and p . , suggesting that the snp � association with adiponec- tin levels is largely independent of rs . however, when rs was added to a model in the full set already containing snp � , the log likelihood in- creased from � , . to � , . for a nearly signifi- cant p value of . , suggesting an independent effect of rs . the further addition of rs to the two- fig. . genome-wide scan results by chromosome. linkage and association of adiponectin levels diabetes, vol. , january snp model did not alter the association. the snps rs , rs , and rs showed no association with adiponectin levels. including the additive effect of snp � in the vari- ance components model decreased the variance in adi- ponectin levels by . %, and including both snp � and rs decreased the variance by . % from base- line. the combination of all six snps resulted in a de- crease of . % from baseline. as shown in table , the three associated snps are in strong ld with one another, as estimated by pairwise d� coefficients ( . – . ), but weakly predictive of one another (because of differing allele frequencies), as indi- cated by low to moderate pairwise r estimates ( . – . ). the rs g allele, which is much less common than the snp � -dela allele ( . vs. . ), is found almost exclusively in one of the haplotypes containing the snp � -dela allele (table ). the rs -t allele is found on the majority of rs -snp t-dela hap- lotypes and is absent from the g-dela haplotype. taken with the association findings discussed in the preceding paragraph, the association of rs with adiponectin levels may be an independent effect or may be an enhance- ment of the snp � effect. unfortunately, these two possibilities cannot be distinguished by the association data. in contrast, the modest rs association is most likely driven by its ld with its flanking snps. to assess whether the association with apm polymor- phisms explained the linkage at q , we reran the ge- nomewide scan using the snp � and/or rs genotypes as covariates. when snp � was included in the model, the lod score decreased . units from . to . , corresponding to an . -fold (i.e., . -fold) de- crease in the evidence for linkage (lod scores computed on the sample containing subjects genotyped for snp � and rs ) (fig. ). when snp rs was added to the base linkage model, there was a . -unit drop in the lod score, and when both snp � and rs were added simultaneously to the model, there was a . -unit drop in the lod score, for a total . -fold decrease in the evidence for linkage. the two-snp model provided a significantly improved fit over the model in- cluding snp � only (p . ). assessing whether snp � accounted for a “signifi- cant” proportion of the linkage was not straightforward. to gain some insights into this issue, we performed a simu- lation in which we dropped an unlinked snp of the same frequency ( . ) , times through a -generation table multipoint linkage analysis peaks with lod � . (corresponding to p � . ) chromosome location distance (cm) closest marker(s) lod (p) nearby linkages in related traits in old order amish nearby linkages to related traits in other populations q d s /d s . ( . ) — multiple metabolic syndrome qtls (bmi, waist, hip, weight, insulin, insulin:glucose): lod . – . @ – cm ( ) diabetes: mls . and mlb- lod . @ d s ( ) q – d s . ( . ) disinhibition (eating behavior): lod . @ cm ( ) glucose : lod . @ cm ( ) — q d s . ( . ) total serum cholesterol: lod . @ cm ( ) — p -p d s . ( . ) bmi-adjusted leptin: lod . @ cm ( ) adiponectin levels: lod . @ cm ( ) obesity: mls . @ cm ( ) bmi: lodfa . @ cm ( ) p d s . ( . ) bmi: lod . @ cm ( ) leptin: lod . @ cm ( ) fasting glucose to fasting insulin: lod . @ cm ( ) — lodfa, paternal lod; mlb, maximum likelihood binomial; mls, maximum likelihood score. table association of six apm snps with adiponectin levels snp name gene region position (from atg start codon) base change minor allele frequency mean adiponectin level (�g/ml) p (additive model) rs promoter � , c g . . � . ( ) . � . ( ) . � . ( ) . rs promoter � , a g . . � . ( ) . � . ( ) . � . ( ) . rs intron � , a g . . � . ( ) . � . ( ) . � . ( ) . rs exon � t g (gly gly) . . � . ( ) . � . ( ) . � . ( ) . rs intron � g t . . � . ( ) . � . ( ) . � . ( ) . snp � � utr � , insa dela . . � . ( ) . � . ( ) . � . ( ) � . data are means � se (n of individuals). mean adiponectin levels are adjusted for age and age squared; all analyses are adjusted for sex and sex-specific age and age squared. ins, insertion; del, deletion; , homozygous for major allele; , heterozygous; , homozygous for minor allele. t.i. pollin and associates diabetes, vol. , january pedigree connecting virtually all subjects. we then repeat- ed the linkage analysis using the simulated snp as a covariate. none of the replicates resulted in a reduction as great as . lod units, suggesting that association with apm snp � , and possibly rs and/or nearby apm snps, is quite likely the cause of the linkage to q . furthermore, the two-point lod score for apm snp � was . , whereas those for the other poly- morphisms ranged from . (rs ) to . (rs , which was also the next most significantly associated polymorphism). because we did not initially sequence apm in an amish sample, but rather selected polymorphisms for genotyping based on published information, we followed up the pos- itive association results with direct sequencing analysis of the coding region (the � end of exon and the � end of exon ) to determine whether our positive associations might be tracking a potentially functional coding variant. the sample for sequencing consisted of a set of rela- tively unrelated married couples ( individuals, al- leles) in upper generations in which at least one member was heterozygous for the g allele at rs . we did not detect any variants in the coding region that would explain the association. discussion although we were unable to detect chromosomal loci linked to adiponectin levels significant at the lod � . level, five regions ( q , q – , q , p -p , and p ) provided evidence of suggestive linkage. the high- est lod score, . , was observed in the region contain- ing apm , the adiponectin structural gene. although apm might seem an obvious candidate gene for control of adi- ponectin levels, a genome-wide scan for adiponectin levels in pima indians showed no evidence for linkage to this region (although suggestive linkage was observed between markers d s and d s , which map to q ) ( ). in contrast, strong linkage of adiponectin levels to q has been recently reported in the iras (insulin resistance atherosclerosis study) family study (lod . ) ( ). one interesting finding of that study was that evidence for linkage was provided entirely by the hispanic-american sample (lod . ); no evidence for linkage was seen in the african-american families (lod . ) ( ). weak linkage to q (lod . ) was found in another genome- wide scan of adiponectin levels in caucasians, where much higher signals on chromosomes and were seen ( ). linkage in the q – region (lod . ), about cm centromeric to q , has been observed in mexican americans ( ). based on these findings, it is possible that variation in apm is an important determinant of circulat- ing adiponectin levels in some populations, but not others. our linkages for adiponectin on chromosomes q – , q , p – , and p are close to linkages we ob- served in the amish for other obesity-related traits, such as total serum cholesterol, bmi-adjusted leptin, and bmi (table ). although some of these traits are somewhat correlated with adiponectin levels ( ), they provide addi- tional support for the idea that these regions are true linkages rather than false-positives. the p region has also been reported by others to be close to linkages for adiponectin ( ), obesity ( ), and bmi ( ), thus provid- ing additional evidence that a gene influencing obesity and related traits resides in this region. to confirm our suspicion that the linkage signal on q resulted from variation in the adiponectin gene itself, we performed association analysis with six previously report- ed snps (table ). snp � showed strong association with adiponectin levels and appeared to explain most of the linkage signal at q , as accounting for this snp led to a % drop in the lod score, corresponding to an . -fold drop in the evidence for linkage. this insertion/deletion polymorphism has been previously reported to be associ- ated with adiponectin levels ( ). another group has found the corresponding insertion to be in ld with the t/ g haplotype previously associated with type diabetes ( ) and has suggested that snp � may be a causal variant via mechanisms involving regulatory elements in the � region of the apm gene. based on searches in utrsite and utrscan, the polymorphism does not reside within a known functional sequence; the closest known func- tional element identified is a k-box binding region bp downstream. however, functional elements of the � untranslated region (utr) continue to be elucidated, and the possibility that the variant alters a protein or micro- rna binding site and/or rna secondary structure cannot be not ruled out ( ). studies of the effect of the polymor- phism on rna production and stability along with addi- tional characterization of the � utr sequence will be need- ed to confirm the causative nature of this polymorphism. table estimated pairwise ld for apm snps rs rs rs rs rs snp � rs — . . . . . rs . — . . . . rs . . — . . . rs . . . — . . rs . . . . — . snp � . . . . . — upper triangle shows r and lower triangle shows d�. table haplotype frequencies (� %) of associated snps rs rs snp � frequency cumulative frequency t g insa . . t t dela . . g g dela . . t g dela . . ins, insertion; del, deletion. linkage and association of adiponectin levels diabetes, vol. , january in addition to association with snp � , there ap- peared to be a further source of association in rs independent from the snp � association, as evi- denced by ) an apparent additive effect between the two polymorphisms that reached statistical significance in the linkage analysis and ) the persistence of the snp � association when the sample was restricted to those with the rs tt genotype. no common variants were detected in a set of relatively unrelated individuals enriched for the presence of the rs and snp � minor alleles, increasing the likelihood that these variants directly influence adiponectin levels, although the possi- bility remains that variants outside the coding region are influencing the phenotype. as in the amish, the rs -t allele has been asso- ciated with higher adiponectin levels in a japanese popu- lation ( ). the amish data also replicate associations of the rs -g, rs -t, and snp � -del al- leles with increased adiponectin levels in the french population ( ). unlike the french ( ), the amish did not show association of the rs -g allele with decreased adiponectin levels; however, a follow-up analysis of the amish in which subgroups in the lower and upper th bmi percentile were analyzed separately did reveal a recessive association between the rs -g allele and lower adiponectin levels in the high bmi (� . ) group only (p . ). the two-point linkage analysis of the relation of the snps themselves to adiponectin levels provides additional evidence that the sequence variation within apm ex- plains the q linkage, as the highest lod score among the snps, . , which was almost identical to the multi- point peak score, was observed at the polymorphism (snp � ) with the strongest association result. in summary, we have provided evidence for linkage of adiponectin levels to several distinct regions in the ge- nome in the amish. among them, q contains the struc- tural gene for adiponectin itself, apm , in which sequence variation appears to be an important determinant of adi- ponectin levels. because adiponectin is a key regulator of insulin sensitivity and other metabolic syndrome�related traits, we would expect this gene, and likely specific snps therein (e.g., snp � , rs ) to be important con- tributors to these traits. replication of our findings along with further investigation of sequence variation within apm and functional analysis of these variants will be required to further discern the role of apm as a susceptibility gene for obesity, type diabetes, and the metabolic syndrome. acknowledgments this study was supported in part by a research grant from glaxowellcome and axys pharmaceuticals; national insti- tutes of health grants dk- and dk- ; an amer- ican diabetes association research award to a.r.s.; an american heart association mid-atlantic predoctoral fel- lowship to t.i.p.; university of maryland general clinical research center grant m -rr- ; and the general clinical research centers program, national center for research resources, national institutes of health. the authors thank wendy warren, mary ann drolet, denis massey, mary morrissey, janet reedy, and our amish liaisons for their energetic efforts in study subject recruit- ment and characterization; drs. alejandro schäffer and fig. . effect of adjusting for rs and snp � on lod score at q . t.i. pollin and associates diabetes, vol. , january richa agarwala for assistance in pedigree construction; and jack shelton for sequencing. this work would not have been possible without the outstanding cooperation of the amish community. appendix electronic database information for internet-based re- sources used in this study: ) ncbi unists: http://www. ncbi.nih.gov/entrez/query.fcgi?db unists; ) ucsc hu- man genome browser gateway: http://genome.ucsc.edu/cgi- bin/hggateway; and ) utrscan/utrsite: http://bighost. area.ba.cnr.it/big/utrhome/. references . havel pj: update on adipocyte hormones: regulation of energy balance and carbohydrate/lipid metabolism. diabetes (suppl. ):s –s , . matsuzawa y, funahashi t, kihara s, shimomura i: adiponectin and metabolic syndrome. arterioscler thromb vasc biol : – , . arita y, kihara s, ouchi n, takahashi m, maeda k, miyagawa j, hotta k, shimomura i, nakamura t, miyaoka k, kuriyama h, nishida m, yamashita s, okubo k, matsubara k, muraguchi m, ohmoto y, funahashi t, matsu- zawa y: paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. biochem biophys res commun : – , . hotta k, funahashi t, arita y, takahashi m, matsuda m, okamoto y, iwahashi h, kuriyama h, ouchi n, maeda k, nishida m, kihara s, sakai n, nakajima t, hasegawa k, muraguchi m, ohmoto y, nakamura t, ya- mashita s, hanafusa t, matsuzawa y: plasma concentrations of a novel, adipose-specific protein, adiponectin, in type diabetic patients. arterio- scler thromb vasc biol : – , . adamczak m, wiecek a, funahashi t, chudek j, kokot f, matsuzawa y: decreased plasma adiponectin concentration in patients with essential hypertension. am j hypertens : – , . matsubara m, maruoka s, katayose s: decreased plasma adiponectin concentrations in women with dyslipidemia. j clin endocrinol metab : – , . hu e, liang p, spiegelman bm: adipoq is a novel adipose-specific gene dysregulated in obesity. j biol chem : – , . maeda k, okubo k, shimomura i, funahashi t, matsuzawa y, matsubara k: cdna cloning and expression of a novel adipose specific collagen-like factor, apm (adipose most abundant gene transcript ). biochem bio- phys res commun : – , . scherer pe, williams s, fogliano m, baldini g, lodish hf: a novel serum protein similar to c q, produced exclusively in adipocytes. j biol chem : – , . kissebah ah, sonnenberg ge, myklebust j, goldstein m, broman k, james rg, marks ja, krakower gr, jacob hj, weber j, martin l, blangero j, comuzzie ag: quantitative trait loci on chromosomes and influence phenotypes of the metabolic syndrome. proc natl acad sci u s a : – , . vionnet n, hani e, dupont s, gallina s, francke s, dotte s, de matos f, durand e, lepretre f, lecoeur c, gallina p, zekiri l, dina c, froguel p: genomewide search for type diabetes-susceptibility genes in french whites: evidence for a novel susceptibility locus for early-onset diabetes on chromosome q -qter and independent replication of a type -diabetes locus on chromosome q – q . am j hum genet : – , . arya r, fowler s, schneider j, almasy l, o’connell p, comuzzie a, blangero j, stern m, duggirala r: evidence of a novel major locus for adiponectin levels on chromosome q in mexican americans (abstract). diabetes (suppl. ):a , . guo x, saad mf, langefeld cd, beck sr, taylor kd, jinagouda s, bergman rn, sutton bs, bowden dw, rotter ji: genome-wide linkage of plasma adiponectin reveals a major locus on chromosome q: the iras family study (abstract). diabetes (suppl. ):a , . comuzzie ag, funahashi t, sonnenberg g, martin lj, jacob hj, black ae, maas d, takahashi m, kihara s, tanaka s, matsuzawa y, blangero j, cohen d, kissebah a: the genetic basis of plasma variation in adiponectin, a global endophenotype for obesity and the metabolic syndrome. j clin endocrinol metab : – , . lindsay rs, funahashi t, krakoff j, matsuzawa y, tanaka s, kobes s, bennett ph, tataranni pa, knowler wc, hanson rl: genome-wide linkage analysis of serum adiponectin in the pima indian population. diabetes : – , . vasseur f, helbecque n, dina c, lobbens s, delannoy v, gaget s, boutin p, vaxillaire m, lepretre f, dupont s, hara k, clement k, bihain b, kadowaki t, froguel p: single-nucleotide polymorphism haplotypes in the both proximal promoter and exon of the apm gene modulate adipocyte- secreted adiponectin hormone levels and contribute to the genetic risk for type diabetes in french caucasians. hum mol genet : – , . menzaghi c, ercolino t, di paola r, berg ah, warram jh, scherer pe, trischitta v, doria a: a haplotype at the adiponectin locus is associated with obesity and other features of the insulin resistance syndrome. dia- betes : – , . hara k, boutin p, mori y, tobe k, dina c, yasuda k, yamauchi t, otabe s, okada t, eto k, kadowaki h, hagura r, akanuma y, yazaki y, nagai r, taniyama m, matsubara k, yoda m, nakano y, tomita m, kimura s, ito c, froguel p, kadowaki t: genetic variation in the gene encoding adiponectin is associated with an increased risk of type diabetes in the japanese population. diabetes : – , . pollin ti, mitchell bd, hsueh wc, tanner k, shuldiner ar, mclenithan jc: adiponectin and cardiovascular risk in the old order amish (abstract). genet epidemiol : , . hsueh wc, mitchell bd, aburomia r, pollin t, sakul h, gelder em, michelsen bk, wagner mj, st jean pl, knowler wc, burns dk, bell cj, shuldiner ar: diabetes in the old order amish: characterization and heritability analysis of the amish family diabetes study. diabetes care : – , . almasy l, blangero j: multipoint quantitative-trait linkage analysis in general pedigrees. am j hum genet : – , . fernandez jr, etzel c, beasley tm, shete s, amos ci, allison db: im- proving the power of sib pair quantitative trait loci detection by phenotype winsorization. hum hered : – , . o’connell jr, weeks de: pedcheck: a program for identification of genotype incompatibilities in linkage analysis. am j hum genet : – , . o’connell jr: zero-recombinant haplotyping: applications to fine mapping using snps. genet epidemiol (suppl. ):s –s , . lange k, cantor r, horvath s, perola m, sabatti c, sinsheimer j, sobel e: mendel version . : a complete package for the exact genetic analysis of discrete traits in pedigree and population data sets (abstract). am j hum genet (suppl.):a , . hsueh wc, mitchell bd, schneider jl, st jean pl, pollin ti, ehm mg, wagner mj, burns dk, sakul h, bell cj, shuldiner ar: genome-wide scan of obesity in the old order amish. j clin endocrinol metab : – , . comuzzie ag, funahashi t, sonnenberg g, martin lj, jacob hj, black ae, maas d, takahashi m, kihara s, tanaka s, matsuzawa y, blangero j, cohen d, kissebah a: the genetic basis of plasma variation in adiponectin, a global endophenotype for obesity and the metabolic syndrome. j clin endocrinol metab : – , . hager j, dina c, francke s, dubois s, houari m, vatin v, vaillant e, lorentz n, basdevant a, clement k, guy-grand b, froguel p: a genome-wide scan for human obesity genes reveals a major susceptibility locus on chromo- some . nat genet : – , . lindsay rs, kobes s, knowler wc, bennett ph, hanson rl: genome-wide linkage analysis assessing parent-of-origin effects in the inheritance of type diabetes and bmi in pima indians. diabetes : – , . pesole g, liuni s, grillo g, licciulli f, mignone f, gissi c, saccone c: utrdb and utrsite: specialized databases of sequences and functional elements of � and � untranslated regions of eukaryotic mrnas. update . nucleic acid res : – , . steinle ni, hsueh wc, snitker s, pollin ti, sakul h, st jean pl, bell cj, mitchell bd, shuldiner ar: eating behavior in the old order amish: heritability analysis and a genome-wide linkage analysis. am j clin nutr : – , . hsueh wc, st jean pl, mitchell bd, pollin ti, knowler wc, ehm mg, bell cj, sakul h, wagner mj, burns dk, shuldiner ar: genome-wide and fine-mapping linkage studies of type diabetes and glucose traits in the old order amish: evidence for a new diabetes locus on chromosome q and confirmation of a locus on chromosome q – q . diabetes : – , . pollin ti, hsueh wc, steinle ni, snitker s, shuldiner ar, mitchell bd: a genome-wide scan of serum lipid levels in the old order amish. athero- sclerosis : – , . hsueh wc, mitchell bd, schneider jl, burns dk, wagner mj, bell cj, st jean pl, ehm mg, shuldiner ar: a genome-wide scan for susceptibility loci to insulin levels in the old order amish (abstract). diabetes (suppl. ):a , linkage and association of adiponectin levels diabetes, vol. , january original article genetic and environmental influences on bone mineral density in pre- and post-menopausal women lillian b. brown Æ elizabeth a. streeten Æ jay r. shapiro daniel mcbride Æ alan r. shuldiner Æ patricia a. peyser braxton d. mitchell received: february / accepted: may / published online: july � international osteoporosis foundation and national osteoporosis foundation abstract genetic factors influencing acquisition of peak bone mass account for a substantial proportion of the variation in bone mineral density (bmd), although the extent to which genes also contribute to variation in bone loss is debatable. few prospective studies of related individuals have been carried out to address this issue. to gain insights into the nature of the genetic factors contributing to variation in bmd, we studied wo- men from large amish families. we evaluated and compared the genetic contributions to bmd in pre- and post-menopausal women, with the rationale that genetic variation in pre-menopausal women is due primarily to genetic determinants of peak bone mass, while genetic variation in post-menopausal women is due to the combined genetic effects of peak bone mass and bone loss. bone mineral density was measured at one point in time at the hip and spine by dual energy x-ray absorp- tiometry (dxa). we used variance decomposition pro- cedures to partition variation in bmd into genetic and environmental effects common to both groups and to pre- and post-menopausal women separately. total variation in bmd was higher in post- compared to pre-menopausal women. genes accounted for – % of the total variation in bmd in pre-menopausal women compared to – % of the total variation in post- menopausal women. in absolute terms, however, the genetic variance was approximately similar between the two groups because the environmental variance was / - to -fold larger in the post-menopausal group. the genetic correlation in total hip bmd was . between pre- and post-menopausal women and differed signifi- cantly from one, consistent with the presence of at least some non-overlapping genetic effects in the two groups for bmd at this site. overall, these analyses suggest that many, but not all, of the genetic factors influencing variation in bmd are common to both pre- and post- menopausal women. keywords bone loss Æ bone mineral density Æ genetics Æ heritability Æ peak bone mass Æ variance introducton osteoporosis is a major public health problem that is associated with significant morbidity and mortality. according to the third national health and nutrition examination survey (nhanes iii), % of u.s. women over age have low bone mass and % of white postmenopausal women have osteoporosis at the femoral neck (hip) [ ]. osteoporotic fractures are one of the most common causes of disability and contributors to medical care costs in many regions of the world [ ]. large prospective studies have shown that almost all types of fracture are increased in adults with low bone mineral density (bmd) [ ]. fractures result in functional impairment, including impaired basic activities of daily living, subsequent nursing home care, the loss of ambulatory ability and loss of the ability to live inde- pendently [ , ]. risk of fracture is particularly acute in women be- cause of the sharp decline in bmd that begins at about osteoporos int ( ) : – doi . /s - - - l.b. brown Æ p.a. peyser department of epidemiology, university of michigan school of public health, ann arbor, mi, usa e.a. streeten Æ d. mcbride Æ a.r. shuldiner Æ b.d. mitchell (&) division of endocrinology, diabetes and nutrition, university of maryland school of medicine, w redwood street, baltimore, md , usa e-mail: bmitchel@medicine.umaryland.edu tel.: + - - fax: + - - j.r. shapiro kennedy krieger institute, baltimore, md, usa j.r. shapiro department of physical medicine and rehabilitation, johns hopkins university, baltimore, md, usa a.r. shuldiner geriatric research and education clinical center (grecc), veterans administration medical center, baltimore, md, usa the time of the menopause. on average, women lose to % of their bmd per year during the first years after menopause, and this rate of bone loss is faster in the spine than other skeletal sites [ , ]. after this period of accelerated bone loss, the rate of bone loss slows down until age , when bone loss begins to accelerate again [ ]. despite this overall trend, there appears to be con- siderable variability among women in the rate of bone loss, with up to % of women losing at least % per year for more than years [ ]. at least one study has shown that with over – years of follow up, the risk of fracture was increased to a similar degree for women starting out with low bone mass (defined as a t score <) sd) and for women starting out with normal bone mass, but experiencing a rapid rate of bone loss, with each group experiencing a doubling of the fracture risk. when baseline bone mass was low and bone loss was rapid, however, the risk of fracture was higher still (odds ratio = . ) [ ]. from studies of young adults, it is well established that peak bone mass is under substantial genetic control [ , , , , , , , , , ]. additionally, women with a maternal history of hip fracture have lower bmd than women without a history of such fracture [ ] and are themselves twice as likely to suffer a hip fracture [ , ]. there are very few published data, however, on the heritability of bone loss. kelly et al. estimated genetic effects on changes in spine and hip bmd measured years apart from a sample of monozygotic (mz) and dizygotic (dz) twin pairs. these investigators observed a significantly higher cor- relation in spine bmd change among mz ( r = . ) compared to dz ( r = . ) twin pairs, with differences consistent with a heritability in spine bmd change as high as % [ ]. correlations in bmd changes at several hip sites were also higher among mz compared to dz twin pairs, although these differences did not achieve statistical significance in this small sample. in contrast, christian et al. reported no difference in -year changes in forearm bmd between and dz twin pairs [ ]. these results may indicate that bmd change is heritable in some sites (e.g., the spine) more than others (e.g., the forearm), or alternatively, that genetic influences on bmd changes at the forearm (and perhaps other sites) are not detectable over a -year period. in a previous study, we used a variance decomposi- tion approach to evaluate the relative contributions of genetic and environmental effects in accounting for variation in male and female differences in bmd [ ]. these analyses did not provide evidence for sex-specific genetic effects, suggesting that genes influencing varia- tion in bmd should be detectable, and in many cases common, in both men and women. in the current study, to begin to dissect genetic components of peak bone mass and bone loss, we evaluated the genetic and envi- ronmental contributions to bmd in women before and after menopause. the rationale for this approach is that genetic variation in pre-menopausal women is due pri- marily to genetic determinants of peak bone mass, while genetic variation in post-menopausal women is due to the combined genetic effects of peak bone mass and bone loss. specifically, we considered the following questions: ( ) is the magnitude of the genetic variation larger in pre-menopausal women than in post-menopausal women?; ( ) does the magnitude of the environmental variation differ between pre-menopausal women and post-menopausal women?; ( ) is there evidence for menopausal-status-specific genetic effects on bmd (i.e., is there a subset of genes that influences variation in bmd in all women and another subset of genes that influences variation in pre- and post-menopausal women separately)? our findings suggest that there are common genetic contributions to bmd in both pre- and post- menopausal women (presumably determinants of peak bone mass), but in addition a separate genetic contri- bution, albeit modest, to bmd in post-menopausal women (presumably determinants of bone loss). materials and methods subjects and measurements the amish family osteoporosis study (afos) began in with the goal of identifying the genetic determi- nants of osteoporosis. details of ascertainment, pheno- typing and clinical characteristics of afos participants were reported previously [ , ]. briefly, individuals believed to be at risk for osteoporosis by virtue of their fracture history or prior bone density measurements were recruited into the study as index cases. these individuals were recruited by word-of-mouth, a com- munity-wide mailing, advertisements in an amish newspaper or by referral from local physicians. the diagnosis of osteoporosis in these individuals was veri- fied by the measurement of bmd using dual energy x- ray absorptiometry (dxa). individuals found to have a t score of – . or less in either the hip or spine were designated as probands. we then invited the probands’ spouses and all first-degree relatives aged years and over to participate in the study. in addition, we recruited into the study the first-degree relatives of any other examined individual (e.g., spouses) having a t score of ) . or lower at the spine or hip on our bone densi- tometry test. between the initiation of recruitment in and february , a total of , individuals ( women and men) were enrolled into the afos, including probands and their relatives. complete information on dxa phenotypes and menopausal status was obtained from of the women enrolled. using the extensive genealogical records maintained by the amish [ , , ], these individuals could be combined into a single -generation pedigree. study participants were evalu- ated by qualified nurses known to the participants at the amish research clinic in strasburg, pa. a medical interview included past medical history, family history of medical problems including fractures and specific details regarding previous fractures, history of medica- tion use and menstrual and reproductive history for women. height was measured using a stadiometer, and weight was recorded with the participant in standard amish clothing, but without shoes. women were con- sidered to be post-menopausal if they reported fewer than two menstrual cycles over the previous months. thirty-three women reported a history of oophorecte- my/hysterectomy and were considered for purposes of these analyses to be post-menopausal. the mineral content at the lumbar spine and hip was measured by dual energy x-ray absorptiometry (dexa) by a registered nurse certified in bone densitometry (hologic w, hologic, inc., bedford, mass.). bmd was determined by dividing the total bone mineral content (g) by the projected area of the region scanned (cm ). for this report, we have restricted analysis of bmd to measures obtained at the spine, femoral neck and total hip. total hip bmd was defined as the sum of the bone mineral content at the femoral neck, trochanter and intertrochanter sites divided by the total area of these three sites. the protocol for the afos was approved by the institutional review board at the university of mary- land. informed consent was obtained from all subjects prior to participation. analytical methods we carried out a series of statistical analyses using a full pedigree-based variance component approach for the purpose of partitioning variation in bmd into selected components [ ]. initially, we modeled variation in bmd as a function of measured environmental covari- ates [e.g., age, age , height and body mass index (bmi)], additive genetic effects (or heritability) and a residual error component. maximum likelihood methods were used to estimate the covariate and genetic effects simultaneously. the covariates selected were included because they were each independently associated with one or more bmd measures in preliminary analyses on pre- and post-menopausal women separately. the sig- nificance of particular components can be assessed by comparing the likelihood of a model with the compo- nent of interest estimated to the likelihood of a model in which the component effect is constrained to a pre- specified value (e.g., zero). the full and restricted models are then compared by likelihood ratio test, which pro- duces a test statistic that is asymptotically distributed as a v distribution. in an initial variance component analysis, we esti- mated the proportion of the total phenotypic variation in bmd (rp ) that could be attributable to the additive genetic effects in pre- and post-menopausal women separately (rg / rp ). this effect corresponds to ‘narrow’ sense heritability since it reflects the degree of additive genetic variance only. we tested whether the heritabilities in bmd differed between pre- and post- menopausal women (i.e., h pre =h post) by comparing the difference between the heritability estimates in the two groups with the estimated variance of the difference. following the approach of blangero, [ , , ], we then expanded the basic variance component model to allow the genetic variances in pre-menopausal and post- menopausal bmd to differ. briefly, we constructed a general model that partitioned variance in bmd into the following terms: an overall mean, a coefficient cor- responding to the effect of menopausal status (bmenostat), coefficients for age and menopausal status*age (bage and bage*menostat), coefficients for age and menopausal sta- tus*age (bage and bage *menostat), coefficients for height (bheight), and bmi (bbmi), pre- and post-menopausal genetic standard deviations (rg-pre and rg-post), pre- and post-menopausal environmental standard devia- tions (re-pre and re-post) and the genetic correlation between pre- and post-menopausal women (qg). men- opausal status was coded as if post-menopausal and if not (i.e., pre- or peri-menopausal). the genetic cor- relation reflects the degree to which the genetic effect on bmd in pre-menopausal women correlates with the genetic effect of bmd in post-menopausal women [ ]. interaction terms of menopausal status with age and age were included because the relationship between age and bmd differs according to menopausal status. a more complete description of the statistical model has been previously published in a study where components of variance could vary by sex [ ]. this expanded model allowed us to test several explicit hypotheses related to menopausal status by gene interactions. first, we considered if the magnitude of the genetic effect was similar between the groups by testing whether the genetic standard deviations were similar between pre- and post-menopausal women (i.e., h : rg-pre=rg-post). rejection of this hypothesis implies that genes account for a larger proportion of the vari- ance in one menopausal status group than in the other. a second hypothesis that we tested is whether the magnitude of the genetic correlation was significantly less than one (i.e., h : qg (pre,post)= ). a genetic cor- relation between pre- and post-menopausal women that is significantly less than one implies that a different gene or suite of genes contributes to variance in bmd in pre- and post-menopausal women. as before, significance testing was conducted using the likelihood ratio test. specifically, we compared likelihoods between models in which values of rg-pre and rg-post were allowed to differ (full model) and in which they were constrained to be the same (restricted model). similarly, we compared the likelihood between a model in which q g(pre,post) was estimated (full model) to that in which its value was constrained to be one (re- stricted model). the degrees of freedom for the likeli- hood ratio test depend on whether the parameter of interest in the nested model is constrained to a boundary value (e.g., h = , where the possible range is to . ) or not [e.g., beta (covariate) = , where the possible range is -¥ to + ¥]. if the parameter constraint is not set to a boundary, then the degrees of freedom are equal to the difference in the number of parameters between the two models. if the parameter constraint is set to a boundary, then the degrees of freedom are based on a / : / mixture distribution with a point mass of zero (in which case the p -value is obtained by dividing the p -value of the one degree of freedom test by two) [ ]. results basic characteristics of the study population are shown in table . pre-menopausal women (n= ) ranged in age from to years, while the age of post-meno- pausal women (n= ) ranged from to . in addition to being older, post-menopausal women had significantly shorter height (p< . ) and higher bmi (p= . ) compared to pre-menopausal women. mean parity in the two groups was . ± . and . ± . births among pre- and post-menopausal women, respectively (p= . ). bmd measurements at the spine (l -l ), total hip and femoral neck were significantly higher in pre-menopausal women compared to post- menopausal women (p< . ). the overall (pheno- typic) variance in bmd was significantly greater in post-menopausal women than in pre-menopausal women at all three bmd sites. the numbers of pre- and post-menopausal relative pairs who were phenotyped and included in the analysis are shown in table . the sample included pre- menopausal pairs ( mother-daughter, sister-sister, aunt-niece and first cousin pairs) and post- menopausal pairs ( mother-daughter, sister-sister, aunt-niece and first cousin pairs). overall, there were , pairs of female relatives in the sample ( mother-daughter, sister-sister, aunt-niece and first cousin pairs). to gain insights into the factors contributing to variation in bmd in pre- and post-menopausal women, we partitioned the total variance in bmd into compo- nents attributable to measured covariates (e.g., age, age , height and bmi), the additive effects of genes and to unmeasured, or residual, environmental factors. re- sults of these analyses are shown in table . in pre- menopausal women, measured covariates accounted for % of the total variation in spine bmd, and from to % of the variation in hip bmd. the additive effects of genes accounted for to % of the total variation in hip bmd and % of the variation in spine bmd. thus, very little of the total variation in bmd in pre- menopausal women could not be accounted for by genes or measured covariates. since relatively little bone loss occurs in healthy adults prior to menopause, the varia- tion in bmd due to genes and environmental factors in this premenopausal group is likely to reflect the varia- tion in peak bone mass, typically achieved in the nd to rd decades of life. in post-menopausal women, the measured covariates accounted for % of the total variation in spine bmd and to % of the total variation in hip bmd. the additive effects of genes ac- counted for an additional % of the variation in spine bmd and to % of the total variation in hip bmd. an additional % of variation in spine bmd and femoral neck bmd and % of total hip bmd could not be accounted for by genes and/or measured covari- ates in the post-menopausal women. the determinants of bmd variation in post-menopausal women are likely to be genes and environmental factors that influence both peak bone mass and bone loss. another way to interpret the genetic effects described in table is in terms of the residual heritability, or the proportion of the unexplained phenotypic variance in bmd after accounting for the effects of the measured covariates age, age , height and bmi. the residual heritability of bmd ranged from . [femoral neck, computed as ( . /( . – . )] to . (total hip) in pre- menopausal women and from . (femoral neck) to . (total hip) in post-menopausal women. at each site, the estimated residual heritability in bmd was signifi- cantly larger in pre-menopausal women than in post- menopausal women (p< . at all sites) (data not shown). we then tested several additional hypotheses, including whether the magnitude of the genetic and environmental variances differed between women before table characteristics (mean ± sd) of female amish family osteoporosis study participants variable pre-menopausal women (n= ) post-menopausal women (n= ) p value equality of variance (p value) age (years) . ± . . ± . < . . height (in) . ± . . ± . < . < . weight (lb) . ± . . ± . . . bmi (kg/m ) . ± . . ± . . . parity . ± . . ± . . . bmd (g/cm ) spine (l -l ) . ± . . ± . < . < . total hip . ± . . ± . < . < . femoral neck . ± . . ± . < . . and after menopause and whether the genetic correlation in bmd differed between pre- and post-menopausal women. to accomplish this goal, we performed a more complete partitioning of bmd into its constituent genetic and environmental components. in these analy- ses, we allowed the genetic and environmental variances in bmd between pre- and post-menopausal women to differ, and also estimated the genetic correlations in bmd between pre- and post-menopausal women. results from the full model, in which all parameters were estimated, are shown in table . following esti- mation of the full set of model parameters, we per- formed a series of nested tests in which we constrained values of selected parameters, which enabled us to test, first, whether the magnitude of the genetic variance in bmd differed between pre- and post-menopausal wo- men; second, whether the magnitude of the environ- mental variance in bmd differed between pre- and post- menopausal women; third, whether the genetic correla- tion in bmd between pre- and post-menopausal relative pairs differed from one. with respect to the first hypothesis, we observed that the genetic sd did not differ significantly between pre- and post-menopausal women (rg-post vs. rg-pre: spine: . vs. . ; femoral neck: . vs. . ; total hip: . vs. . ; p > . for all). in contrast, the environmental sd was greater than three-fold higher at each site in post-menopausal com- pared to pre-menopausal women (spine: . vs. . ; total hip: . vs. ; femoral neck: . vs. . ), al- though in no case did these differences achieve statistical significance, perhaps because of the relatively small magnitude of the environmental variances in this pop- ulation. with respect to the third hypothesis, we ob- served that the genetic correlation between pre- and post-menopausal women did not differ significantly from one for the spine (qg= . , p = . ) and femoral neck (qg= . , p = . ), although the genetic corre- lation did differ significantly between the two groups for total hip (qg= . , p = . ), suggesting the possi- bility that different sets of genes may influence total hip bmd in pre- vs. post-menopausal women. in total, these analyses reveal total variance in bmd to be larger in post- compared to pre-menopausal women, with both measured and unmeasured environ- mental factors contributing to much of the excess vari- ability in the post-menopausal group. in contrast, there was little evidence for meaningful differences in the overall contribution of genetic factors to the variance in bmd between pre- and post-menopausal women, indi- cating that the magnitude of genetic influences on bmd in the two groups was approximately similar. the very high genetic correlations in bmd between pre- and post- menopausal women suggest that common genes, or sets of genes, influence bmd variation in both groups, although at the total hip there was modest evidence for unique or non-overlapping sets of genes that also influ- ence bmd in the two groups. discussion from large family samples, it has been estimated that genes account for – % of the total variation in bmd [ , , , , ]. however, this estimate incorporates genetic effects that occur at different ages. for example, a very large genetic contribution to acquisition of peak bone mass is well established [ ], although in later years table number of relative pairs included in the sample of amish female subjects relative pair class number parent-offspring (mother-daughter) pre-menopausal women post-menopausal women all pairs sibling-sibling (sister-sister) pre-menopausal women post-menopausal women all pairs avuncular (aunt-niece) pre-menopausal women post-menopausal women all pairs cousin-cousin ( st cousin only) pre-menopausal women post-menopausal women all pairs total numbers of female pairs* pre-menopausal pairs post-menopausal pairs total , *does not include grandparent-grandchild, grand avuncular, nd cousins, and more distantly related pairs table components of variance for bmd pre-menopausal women post-menopausal women (n= ) (n= ) bmd site: measured covariates genetic residual environment measured covariates genetic residual environment spine . . . . . . total hip . . . . . . femoral neck . . . . . . measured covariates include age, age , height and bmi another major source of variation, especially in women, is the rate of bone loss, much of which occurs during the peri- to post-menopausal period. the overall contribu- tion of genes to variation in bone loss is much less clear. understanding the factors influencing bone loss is very important from a therapeutic point of view since slowing the rate of bone loss presents a potentially valuable target for prevention of age-related osteoporotic fracture. the optimal approach for understanding the genetics of bone loss would be to follow a cohort of related individuals prospectively. however, only a few such studies have been published, and results have been inconclusive, with some reporting strong genetic effects on bone loss [ ] and others relatively modest effects [ ]. in the absence of more such studies, we have con- sidered an indirect approach using a cross-sectional family sample in which we compared genetic variation in bmd in pre- and post-menopausal women ranging in age from to years. the variance decomposition approach we used enabled us to address whether the same genes control variation in bmd variation in the two groups of women. one would expect there to be some overlap because bmd in older women is influ- enced by genes affecting both peak bone mass and bone loss, while bmd in younger women is influenced by genes affecting peak bone mass only. as expected, we observed significantly greater total variation in bmd in post- compared to pre-menopausal women. we further observed that after accounting for the effects of age, height and bmi on bmd, genes ac- counted for a larger proportion of the residual variation in bmd in pre- compared to post-menopausal women. these results are probably related to the fact that vari- ation in bmd in the post-menopausal group is influ- enced both by factors affecting peak bone mass and factors influencing the rate of bone loss. model parameters: l= mean bdm; b= regression coefficients (for age, age*sex, age , age *sex, height and body mass index); rg-pre= genetic sd in pre-menopausal women; rg-post= genetic sd in post-menopausal women; re-pre= environmental sd in pre-menopausal women; re-post= environmental sd in post-menopausal women; qg= genetic correlation in bmd between pre-menopausal and post- menopausal women. ll log likelihood. a maximum likelihood estimate converged at estimate at lower boundary. *p values for hypothesis based on a / : / mixture of a v and a point mass of zero table model parameters estimated from variance partitioning of bone mineral density parameter spine bmd (· ) total hip bmd (· ) femoral neck bmd (· ) l . . . b(age) ) . ) . ) . b(being post-menopausal) ) . ) . ) . b(age* post-menopausal) ) . . . b(age ) . . . b(age * post-menopausal) ) . ) . ) . b(height) . . . b(bmi) . . . rg-post . . . rg-pre . . . re-post . . . re-pre . [ ] a . qg . . . ll(full model) ) . ) . ) . hypothesis : h : genetic variance equal between pre-menopausal and post-menopausal women parameterization: rg-pre = rg-post ll (nested model): ) . ) . ) . v . . . p . . . conclusion: accept h accept h accept h hypothesis : h : environmental variance equal between pre-menopausal and post-menopausal women parameterization: re-pre = re-post ll (nested model): ) . - . - . v . . . p . . . conclusion: accept h accept h accept h hypothesis : h : genetic correlation similar between pre-menopausal and post-menopausal women parameterization: qg = ll (nested model): ) . ) . ) . v . . . p* . . . conclusion: accept h reject h accept h our partitioning of the variance revealed little dif- ference in the amount of genetic variance between pre- and post-menopausal women, but a / - to -fold higher environmental variance in post-menopausal women. although this difference did not achieve sta- tistical significance, it does nonetheless suggest that environmental factors contribute largely to the greater variability observed in the post-menopausal group. in contrast, there was very little evidence for large differ- ences in the genetic variances between the pre- and post-menopausal groups. furthermore, for spine and femoral neck bmd, the genetic correlation between pre- vs. post-menopausal women did not differ signifi- cantly from one, consistent with the view that the same genes, or sets of genes, act jointly on both groups of women. for total hip bmd, however, the genetic correlation, although high, was significantly less than one, thereby providing modest evidence for incomplete pleiotropy for genes influencing bmd in pre- and post- menopausal women at this site, or for the existence of some distinct genetic effects that do not act jointly on both groups of women. such genes might presumably influence variation in rates of bone loss in the post- menopausal group. the fact that the genetic correla- tions were substantially greater than zero across all three sites indicates that there are at least some sets of genes that influence bmd at these sites in both sets of women jointly. the unique attributes of the old order amish make this population an attractive one for attempting to dissect out the genetic contributions to phenotypic variation. amish families typically tend to be very large, so that there are a large number of sibling rel- ative pairs available for analysis. moreover, the amish have a strong interest in their genealogies, and accu- rate record-keeping dating back many generations al- lows the large amish families to be linked into a single pedigree. finally, the relatively homogenous environment of this population and their reluctance to use prescription medication may allow more clear elucidation of the genetic factors contributing to bmd. in summary, our results support the hypothesis that the same sets of genes influence bmd at the spine and femoral neck in both pre- and post-menopausal wo- men, presumably by influencing acquisition of peak bone mass. however, we also observed some evidence for additional genetic effects acting on one group independently of the other group for total hip bmd. such genes might play a role in bone loss. future studies involving longitudinal follow-up of women as they lose bone will be required to elucidate the nature of these effects. acknowledgements this work was supported by research grants r -ar , r -ag , r -hl and u -hl awarded by the national institutes of health, and the university of maryland general clinical research center, grant m rr , general clinical research centers program, national center for research resources (ncrr), nih. references . looker ac, orwoll es, johnston cc, jr et al ( ) prevalence of low femoral bone density in older u.s. adults from nhanes iii. j bone miner res : – . cummings sr, melton lj ( ) epidemiology and outcomes of osteoporotic fractures. lancet : – . cummings sr, black dm, nevitt mc et al ( ) bone density at various sites for prediction of hip fractures. the study of osteoporotic fractures research group (see comments). lancet : – . gullberg b, johnell o, kanis ja ( ) world-wide projections for hip fracture. osteoporos int : – . lindsay r, cosman f, herrington bs et al ( ) bone mass and body composition in normal women. j bone miner res : – . elders pj, netelenbos jc, lips p et al ( ) accelerated ver- tebral bone loss in relation to the menopause: a cross-sectional study on lumbar bone density in women of to years of age. bone miner : – . hunter dj, sambrook pn ( ) bone loss: epidemiology of bone loss. arthritis res : – . christiansen c, riis bj, rodbro p ( ) prediction of rapid bone loss in postmenopausal women. lancet : – . riis bj ( ) the role of bone loss. am j med : s– s . eisman ja ( ) genetics of osteoporosis. endocr rev : – . christian jc, yu pl, slemenda cw et al ( ) heritability of bone mass: a longitudinal study in aging male twins. am j hum genet : – . pocock na, eisman ja, hopper jl et al ( ) genetic determinants of bone mass in adults. a twin study. j clin in- vest : – . seeman e, hopper jl, bach la et al ( ) reduced bone mass in daughters of women with osteoporosis. n engl j med : – . jouanny p, guillemin f, kuntz c et al ( ) environmental and genetic factors affecting bone mass. similarity of bone density among members of healthy families. arthritis rheum : – . matkovic v, fontana d, tominac c et al ( ) factors that influence peak bone mass formation: a study of calcium balance and the inheritance of bone mass in adolescent females. am j clin nutr : – . ferrari s, rizzoli r, slosman d et al ( ) familial resem- blance for bone mineral mass is expressed before puberty. j clin endocrinol metab : – . lutz j ( ) bone mineral, serum calcium, and dietary intakes of mother/daughter pairs. am j clin nutr : – . krall ea, dawson-hughes b ( ) heritable and life-style determinants of bone mineral density. j bone miner res : – . prentice a ( ) the relative contribution of diet and geno- type to bone development. proc nutr soc : – . seeman e, tsalamandris c, formica c et al ( ) reduced femoral neck bone density in the daughters of women with hip fractures: the role of low peak bone density in the pathogenesis of osteoporosis. j bone miner res : – . zmuda jm, cauley ja, ferrell re ( ) recent progress in understanding the genetic susceptibility to osteoporosis. genet epidemiol : – . kelly pj, nguyen t, hopper j et al ( ) changes in axial bone density with age: a twin study. j bone miner res : – . brown lb, streeten ea, shuldiner ar et al ( ) assessment of sex-specific genetic and environmental effects on bone min- eral density. genet epidemiol : – . streeten ea, mcbride dj, lodge al et al ( ) reduced incidence of hip fracture in the old order amish. j bone miner res : – . beiler k ( ) fisher family history: descendants and history of christian fisher ( – ). ronk’s, eby’s quality print- ing, pa . agarwala r, biesecker lg, hopkins ka et al ( ) software for constructing and verifying pedigrees within large genealo- gies and an application to the old order amish of lancaster county. genome res : – . agarwala r, schäffer aa, tomlin jf ( ) towards a com- plete north american anabaptist genealogy ii: analysis of inbreeding. hum biol : – . almasy l, blangero j ( ) multipoint quantitative-trait linkage analysis in general pedigrees. am j hum genet : – . blangero j ( ) statistical genetic approaches to human adaptability. hum biol : – . martin lj, mahaney mc, almasy l et al ( ) leptin’s sexual dimorphism results from genotype by sex interactions mediated by testosterone. obes res : – . falconer ds, mackay tfc ( ) quantitative genetics. longman group, essex, england . self sg, liang ky ( ) asymptotic properties of maximum likelihood estimators and likelihood ratio tests under non- standard conditions. j am stat assoc : – . mitchell bd, kammerer cm, schneider jl et al ( ) genetic and environmental determinants of bone mineral density in mexican americans: results from the san antonio family osteoporosis study. bone : – sec sec sec sec sec tab sec tab tab tab bib cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr cr position on environmental issues and engagement in proenvironmental behaviors position on environmental issues and engagement in proenvironmental behaviors gene l. theodori department of rural sociology texas a&m university college station, texas, usa a. e. luloff department of agricultural economics and rural sociology pennsylvani a state university university park, pennsylvania , usa using data collected in a general population survey from a random sample of individuals in four communities in pennsylvania, we tested the following two hypotheses: ( ) that differences in sociodemographic characteristics exist among individuals with variant positions on environmental issues; and ( ) that individuals with different positions on environmental issues exhibit dissimilar levels of pro- environmental behaviors. both hypotheses received substantial support. the results indicate that young individuals, the more highly educated, people with higher incomes, and those with liberal political ideologies are more likely than their opposites to maintain proactive positions on environmental issues. the ®ndings also reveal that while both proactive and sympathetic persons engage more frequently in proenvironmental behaviors than do their neutral counterparts, sympathetic indivi- duals partake in these same behaviors less often than do those who expressed proactive positions on environmental issues. keywords environmentalism, environmental movement, position on environ- mental issues, proenvironmental behaviors, social movement the structure or organization of a social movement is often illustrated with con- centric rings or circles (mauss ). the innermost ring, or core, typically contains the principal leaders, along with the most zealous and committed members (mauss ; morrison ). surrounding the core are various rings or layers of the public organized, to a greater or lesser extent, around the issue at hand. each layer is comprised of actors and=or associations with differing levels of interest in and commitment to the success of the movement. received september ; accepted august . support for this research was provided by the pennsylvania department of agriculture (me ) and the pennsylvania agricultural experiment station (regional project ne- and state station project ) . address correspondence to gene l. theodori, department of rural sociology, texas a&m university, tamu, college station, tx ± , usa. e-mail: g-theodori@tamu.edu society and natural resources, : ± , copyright # taylo r & francis - / $ . + . doi: . = as evidenced by its enduring survival, large organizationa l base, and widespread public support, the environmental movement continues to be one of the more successful social movements throughou t the united states and western europe (mertig and dunlap ). despite the vast literature on environmentalism , research on the different layers of individuals involved in the environmental movement has been somewhat limited. surprisingly little empirical research has been conducted on the sociodemographi c characteristic s and=or attitudes , beliefs, and behaviors of these individuals. this article addresses these issues. two hypotheses were tested. first, it was hypothesized that there are differences in sociodemographi c char- acteristics among individuals with variant positions on environmental issues. the second hypothesi s was that individuals with different positions on environmental issues exhibit dissimilar levels of proenvironmental behaviors. background in a review of the trends in public opinion toward environmental quality from the mid s to the late s, dunlap ( ) proposed a ®ve-layer concentric pattern to depict the various segments of the public involved in the environmental move- ment. according to dunlap ( , ± ), activistsÐ``individuals intensely con- cerned about and personally active on behalf of environmental quality’’Ðare at the core of the movement. encompassing the core is a layer referred to as the attentive publicÐ``individuals interested in and informed about environmental issues . . . [who] are likely to provide occasional support for environmental causes, signing petitions, voting for proenvironmenta l issues and candidates and perhaps even contributing time and money to speci®c environmental campaigns.’’ the third and largest layer consists of the sympathetic publicÐ``individuals whoÐalthough not very attentive to environmental issuesÐexpress support for efforts to enhance and protect envir- onmenta l quality.’’ next are the neutralsÐ``persons who have little interest in and typically no opinion concerning environmental issues.’’ last, the outer layer is comprised of opponentsÐ``individuals who are opposed to some degree to the goals of the environmental movement and hold opinions that can be characterized as `anti-environmental.’’’ data from national surveys appear to support dunlap’s ( ) notion of a multilayered public organized around environmental issues. in , an abc news=washingto n post poll asked, ``in recent years, the environmental movement has been very active. do you consider yourself as: an active participant in the environment movement, sympathetic towards the movement, but not active, neutral, or unsympatheti c towards the environmental movement?’ ’ seven percent reported that they were active participants, % said they were sympathetic, but not active, % indicated that they were neutral, and % said they were unsympatheti c (abc news=washingto n post ). more recently, ®ve wirthline worldwide ( , , , , ) national quorum surveys asked respondents a very similar question [do you think of your- self as: ( ) an active environmentalist , ( ) sympathetic towards environmental con- cerns but not active, ( ) neutral, or ( ) generally unsympatheti c to environmental concerns]. the general trends over this -year period re¯ect those reported in the poll. the percentage of respondents who considered themselves active environmentalist s ranged from a low of % in to a high of % in . sympathetic individuals ranged from a low of % in to a high of % in , while neutral individuals ranged from a low of % in to a high of % g. l. theodori and a. e. luloff in . unsympatheti c individuals ranged from a low of % in to a high of % in . despite the consistent pattern of survey ®ndings over nearly two decades, few studies have been conducted on the sociodemographi c characteristics and=or atti- tudes, beliefs, and behavior s of the different layers of individuals involved in the environmental movement. the present study addresses these issues. in this article, we use data collected in a general population survey from a random sample of indivi- duals in four communities to test the following hypotheses: ( ) that differences in sociodemographi c characteristic s exist among individuals with variant positions on environmental issues; and ( ) that individuals with different positions on environ- mental issues exhibit dissimilar levels of proenvironmenta l behaviors. data and measurement the data used in this analysis were drawn from a study that focused on land-use issues at the rural±urban interface in pennsylvania (luloff et al. ; theodori and luloff ). data were collected through a general population survey from a random sample of individuals in four study sites chosen to represent a typology of increasing levels of urban presence and pressure in agricultural areas. the four areas selected were small portions of snyder, bedford, crawford, and lancaster counties. based on major issues identi®ed in key and action informant interviews in each study site, a questionnaire was developed that addressed land use, agri- cultural, development, and natural resource issues, in addition to social issues including community attachment, community participation, stress, and recreation. following a modi®ed total design method (tdm; see dillman ; luloff and ilvento ), data were gathered in the snyder, bedford, and crawford sites using mail survey techniques. data were collected via a questionnaire drop-off=pick-up procedure (melbye et al. ) in the lancaster site due to the presence of a substantial number of old order amish and mennonites. overall, a response rate of % was achieved. this resulted in completed questionnaire s across the sites. position on environmental issues following earlier work (abc news=washington post ; wirthline worldwide , , , , ), position on environmental issues was evaluate d using a single survey item. the question asked: ``which of the following best describes your position on environmental issues?’’ response categories included: ( ) active in environmental issues, ( ) sympathetic to environmental issues, ( ) neither sympathetic nor unsympathetic , ( ) unsympatheti c to environmental issues, and ( ) actively opposed to any action on environmental issues. based on the small number of cases in the latter two categories, respondents who indicated that they were either (a) unsympatheti c to environmental issues or (b) actively opposed to any action on environmental issues were combined with those who reported that they were neither sympathetic nor unsympatheti c on environmental issues. in this article, the three categories describing individuals’ position on environmental issues are referred to as ``proactive,’’ ``sympathetic,’’ and ``neutral.’’ the per- centages of respondents indicating proactive, sympathetic, and neutral positions on environmental issues were . (n = ), . (n = ), and . (n = ), respectively. position on environmental issues engagement in proenvironmental behaviors engagement in proenvironmenta l behaviors was assessed using a list of seven items. respondent s were asked if, during the previous year, they had engaged in any of the following behaviors: ( ) contribute d money or time to an environmental or wildlife conservation group; ( ) stopped buying a product because it caused envir- onmenta l problems; ( ) attended a public hearing or meeting about the environment; ( ) contacted a government agency to get information or complain about an environmental problem; ( ) read a conservation or environmental magazine; ( ) watched a television special on the environment; and ( ) voted for or against a political candidat e because of the candidate’s position on the environment. each proenvironmenta l behavior was dummy coded ( = yes). sociodemographi c variables following earlier research (dunlap and heffernan ; van liere and dunlap ; theodori, luloff, and willits ), age, education, gender, income, and political ideology were included as sociodemographi c factors. age was measured in years. education was coded as follows: ( ) less than high school; ( ) high school equivalent; ( ) some college; ( ) college degree; and ( ) training beyond college. gender was dummy coded ( = male). income was measured by categories, ranging from ( ) less than $ , to ( ) $ , or more. political ideology was measured by the categories: ( ) liberal; ( ) moderate±liberal; ( ) moderate; ( ) moderate±conservative ; and ( ) conservative. analyses differences in sociodemographi c characteristics among the proactive, sympathetic , and neutral individuals were examined by calculating mean scores for each of the ®ve variables for the three groups. the statistical signi®cance of the observed variances were tested by analysis of variance procedures (f-tests). as shown in table , there was considerable support for the proposition that differences in sociodemographi c characteristics exist among individuals with different positions on environmental issues. age, education, income, and political ideology reached statistical signi®cance at the . level and revealed linear-type patterns. of the three groups, proactive persons had the highest incomes and were the youngest, highest educated, and least politically conservative, while neutral individuals had the lowest incomes and were table means and analysis of variance results for sociodemographi c variables by environmental position variable proactive sympathetic neutral f score age . . . . b education . . . . b gender ( = male) . . . . a income . . . . b political ideology . . . . b a signi®cant at p < . . bsigni®cant at p < . . g. l. theodori and a. e. luloff the oldest, least educated, and most politically conservative. gender attained sta- tistical signi®cance at the . level, but did not manifest a linear-type pattern like the other sociodemographi c variables. the results indicated that proactive individuals were most likely to be female, followed by neutral persons. sympathetic individuals were most likely to be male. logistic regression was used to analyze the differences in the levels of engage- ment in proenvironmental behaviors among individuals with different positions on environmental issues. the analysis was conducted in two phases. table reports the bivariate and net odds ratios for the effect of position on environmental issues on engagement in proenvironmenta l behaviors when neutral was treated as the refer- ence category (phase i). phase i bivariate results at the bivariate level, as shown in table , the results indicate that individuals with a proactive orientation on environmental issues were signi®cantly ( p < . ) more likely than neutral individuals to engage in all seven of the proenvironmenta l behaviors. the odds ratios ranged from . to . . this indicated that while proactive persons were almost times more likely than the neutral individuals to stop buying a product because it caused environmental problems, they were approximately times more likely than the neutral individuals to contribute money or time to an environmental or wildlife conservation group. the bivariate results reported in table also indicate that sympathetic individuals were more likely than the neutral individuals to engage in proenvironmenta l behaviors. each of the odds ratios reached statistical signi®cance at the conventional . level, while all but two were signi®cant at the . level. multivariate results as in earlier research, controls for age, education, gender, income, and political ideology were introduced into the model. as noted in table , the results indicate that controlling for these variables had very little effect on the nature or signi®cance levels of the odds ratios for either proactive or sympathetic individuals, although one statistically signi®cant odds ratio did drop to nonsigni®cance. after introducing the control variables, sympathetic individuals did not differ signi®cantly from neutral individuals in terms of attending a public meeting of hearing about the environment. overall, based on the multivariate results reported in table , respondents who expressed either proactive or sympathetic positions on environmental issues were more likely than those who expressed neutral positions on environmental issues to engage in the majority of proenvironmenta l behaviors. the likelihood of proactive individuals who engaged in each of the behaviors was stronger than that for sym- pathetic individuals in both the bivariate and multivariate models. phase ii treating individuals who reported neutral positions on environmental issues as the reference category for the environmental position variable allowed us to test in phase i (table ) whether proactive and sympathetic individuals differed sig- ni®cantly from the neutral individuals in terms of proenvironmenta l behaviors. what we could not test in phase i was whether or not individuals with a proactive position on environmental issues t a b l e o d d s r a ti o s fo r th e e ff e ct o f e n v ir o n m e n ta l p o st io n o n p ro en v ir o n m en ta l b eh a v io r w it h `` n eu tr a l’ ’ a s th e r ef e re n ce c a te g o ry o d d s ra ti o s b iv a ri a te m u lt iv a ri a te a p ro en v ir o n m en ta l b eh a v io rs p ro a ct iv e s y m p a th et ic p ro a ct iv e s y m p a th et ic c o n tr ib u te d m o n e y o r ti m e to a n en v ir o n m en ta l o r w il d li fe co n se rv a ti o n g ro u p (n = )b . e . e . e . e s to p p ed b u y in g a p ro d u ct b e ca u se it ca u se d en v ir o n m en ta l p ro b le m s (n = ) . e . e . e . e a tt en d ed a p u b li c h ea ri n g o r m ee ti n g a b o u t th e en v ir o n m en t (n = ) . e . c . e . c o n ta ct ed a g o v er n m en t a g en c y to g et in fo rm a ti o n o r co m p la in a b o u t a n en v ir o n m en ta l p ro b le m (n = ) . e . d . e . d r ea d a co n se rv a ti o n o r en v ir o n m e n ta l m a g a zi n e (n = ) . e . e . e . e w a tc h e d a te le v is io n sp ec ia l o n th e en v ir o n m en t (n = ) . e . e . e . e v o te d fo r o r a g a in st a p o li ti ca l ca n d id a te b ec a u se o f h is = h er p o si ti o n o n th e en v ir o n m en t (n = ) . e . e . e . e a o d d s ra ti o s co m p u te d co n tr o ll in g fo r a g e , e d u ca ti o n , g en d er , in c o m e, a n d p o li ti c a l id eo lo g y . b n v a lu e s v a ry d u e to m is si n g d a ta . c s ig n i® ca n t a t p < . . d s ig n i® ca n t a t p < . . e s ig n i® ca n t a t p < . . orientation on environmental issues differed from their sympatheti c counterparts in terms of their environmental behaviors. in order to do so, we recoded the envir- onmental position variable. table reports the bivariate and net odds ratios for the effect of environmental position on proenvironmenta l behaviors when the sympathetic-to-environmental-issue s response was treated as the reference category (phase ii). while the odds ratio values for the sympathetic individuals reported in table and those for the neutral persons shown in table are different (due to treating one versus the other as the reference category), it is important to note that the odds ratios for the neutral individuals in table are merely the inverse values of the odds ratios for sympathetic respondents in table . the alpha values (or p values) for the sympathetic individuals in table and those for the neutral respondents in table are identical in both the bivariate and multivariate models. bivariate results as shown in table , the bivariate results indicate that individuals who expressed proactive positions on environmental issues were signi®cantly more likely than their sympathetic counterparts to engage in six of the seven proenvironmenta l behaviors. while proactive individuals were . times more likely than sympathetic individuals to stop buying a product because it caused environmental problems, they were . times more likely than sympathetic respondents to attend a public meeting or hearing about the environment. proactive respondent s did not differ signi®cantly from sympathetic respondents in terms of their likelihood of watching a television special on the environment, despite the fact that they were . times more likely than sympathetic individuals to do so. the results reported in table also indicated that, at the bivariate level, neutral individuals were signi®cantly less likely than sympathetic respondents to engage in each of the proenvironmenta l behaviors (the opposite of the ®ndings reported in table ). multivariate results the multivariate results indicate that controlling for age, education, gender, income, and political ideology had very little effect on the size of the odds ratios for either proactive or neutral individuals (the odds ratios reported for the neutral individuals in table are simply the inverse of the odds ratios for the sympathetic respondents in table ). in brief, the most interesting ®nding in table was that proactive respondents were signi®cantly more likely than sympathetic respondents to engage in six of the seven proenvironmenta l behaviors, net of the other variables in the model. examining the sociodemographi c variables an examination of the sociodeomgraphi c variables indicated that age consistently failed to reach statistical signi®cance (table ). education was positively and sig- ni®cantly related to ®ve of the proenvironmenta l behaviors. more highly educated respondents were signi®cantly more likely than those with lower education to con- tribute money or time to an environmental or wildlife conservation group, to contact a government agency to get information about an environmental problem, to read a conservation or environmental magazine, to watch a television special on the environment, and to vote for or against a political candidate because of his=her position on the environment. while males were signi®cantly more likely than females position on environmental issues t a b l e o d d s r a ti o s fo r th e e ff ec t o f e n v ir o n m e n ta l p o si ti o n o n p ro en v ir o n m en ta l b eh a v io r w it h `` s y m p a th e ti c’ ’ a s th e r ef er e n c e c a te g o ry o d d s ra ti o s b iv a ri a te m u lt iv a ri a te a p ro e n v ir o n m e n ta l b eh a v io rs p ro a c ti v e n eu tr a l p ro a ct iv e n eu tr a l c o n tr ib u te d m o n ey o r ti m e to a n e n v ir o n m en ta l o r w il d li fe co n se rv a ti o n g ro u p (n = )b . e . e . e . e s to p p ed b u y in g a p ro d u ct b ec a u se it ca u se d en v ir o n m en ta l p ro b le m s (n = ) . c . e . c . e a tt en d ed a p u b li c h ea ri n g o r m ee ti n g a b o u t th e en v ir o n m en t (n = ) . e . c . e . c o n ta ct ed a g o v er n m en t a g en cy to g e t in fo rm a ti o n o r co m p la in a b o u t a n e n v ir o n m en ta l p ro b le m (n = ) . e . d . e . d r e a d a co n se rv a ti o n o r en v ir o n m en ta l m a g a zi n e (n = ) . d . e . d . e w a tc h ed a te le v is io n sp ec ia l o n th e en v ir o n m en t (n = ) . . e . . e v o te d fo r o r a g a in st a p o li ti ca l ca n d id a te b ec a u se o f h is = h er p o si ti o n o n th e en v ir o n m en t (n = ) . e . e . e . e a o d d s ra ti o s co m p u te d co n tr o ll in g fo r a g e, ed u ca ti o n , g e n d er , in c o m e, a n d p o li ti c a l id e o lo g y . b n v a lu es v a ry d u e to m is si n g d a ta . c s ig n i® ca n t a t p < . . d s ig n i® c a n t a t p < . . e s ig n i® ca n t a t p < . . t a b l e o d d s r a ti o s fo r th e s o ci o d em o g ra p h ic v a ri a b le s o d d s ra ti o sa fo r so c io d em o g ra p h ic v a ri a b le s p ro en v ir o n m e n ta l b eh a v io rs a g e e d u ca ti o n g en d er in co m e p o li ti ca l id eo lo g y c o n tr ib u te d m o n e y o r ti m e to a n en v ir o n m en ta l o r w il d li fe co n se rv a ti o n g ro u p (n = )b . . d . . d . c s to p p ed b u y in g a p ro d u ct b e ca u se it ca u se d en v ir o n m en ta l p ro b le m s (n = ) . . . c . . a tt e n d ed a p u b li c h ea ri n g o r m ee ti n g a b o u t th e en v ir o n m en t (n = ) . . . d . . c o n ta ct ed a g o v e rn m en t a g e n c y to g et in fo rm a ti o n o r co m p la in a b o u t a n en v ir o n m en ta l p ro b le m (n = ) . . c . . . r ea d a co n se rv a ti o n o r en v ir o n m en ta l m a g a zi n e (n = ) . . e . . . c w a tc h e d a te le v is io n sp ec ia l o n th e en v ir o n m en t (n = ) . . e . . . c v o te d fo r o r a g a in st a p o li ti ca l ca n d id a te b ec a u se o f h is = h er p o si ti o n o n th e en v ir o n m en t (n = ) . . e . . d . a c o m p u te d c o n tr o ll in g fo r p o si ti o n o n e n v ir o n m e n ta l is su es . b n v a lu es v a ry d u e to m is si n g d a ta . c s ig n i® ca n t a t p < . . d s ig n i® ca n t a t p < . . e s ig n i® ca n t a t p < . . to stop buying a product because it caused environmental problems, females were signi®cantly more likely than males to attend a public meeting or hearing about the environment. respondents with higher incomes were signi®cantly more likely than those with lower incomes to contribute money or time to an environmental or wildlife conservation group, and signi®cantly less likely to vote for or against a political candidate because of his or her position on the environment. politically liberal respondents were signi®cantly more likely than their politically conservative counterparts to contribute money or time to an environmental or wildlife con- servation group, read a conservation or environmental magazine, and watch a tel- evision special on the environment. summary and concluding comments these data provided substantial support for our two hypotheses, namely, ( ) that differences in sociodemographi c characteristic s exist among individuals with variant positions on environmental issues, and ( ) that individuals with different positions on environmental issues exhibit dissimilar levels of proenvironmenta l behaviors. the results of the analysis of variance tests revealed that young individuals, the more highly educated, people with higher incomes, and those with liberal political ideol- ogies were more likely than their opposites to maintain proactive positions on environmental issues. while gender reached statistical signi®cance, the results were not as clear-cut. the ®ndings of the logistic regression in phase i indicated that, overall, indivi- duals who maintained either proactive or sympatheti c positions on environmental issues were more likely than those who were classi®ed as neutral to engage in proenvironmenta l behaviors. the likelihood of proactive persons to partake in each of the behaviors was stronger than that for sympatheti c respondents. the odds ratios changed only slightly when controls for a variety of sociodemographi c character- istics were added. taken together, the phase ii logistic regression analyses revealed that proactive individuals were more likely than sympathetic individuals to engage in proenvironmenta l behaviors. again, the odds ratios changed only slightly after the addition of the control variables. although both proactive and sympathetic persons participated more frequently in proenvironmenta l behaviors than did their neutral counterparts , sympathetic individuals engaged in these same behaviors less often than did those who expressed proactive environmental positions. these results have practical implications for environmental protection and natural resource management issues. for example, to the extent that behavior s often change, well-designed environmentally oriented educational program s that motivate and encourage understanding , exploration, participation, and group problem solving might lead to the adoption and facilitation of proenvironmenta l behaviors (kaplan ). moreover, informational campaigns that emphasize environmentally responsible behaviors could foster proactiv e envir- onmenta l positions. despite the statistical signi®cance of our ®ndings, several limitations of these data must be considered. one limitation involved the measurement of position on environmental issues. in this study, position on environmental issues was represented by a global measure. future research examining similar linkages might incorporate measures of domain-speci®c positions. a second limitation of this study dealt with the measurement of proenvironmenta l behaviors. individuals were asked only to indicate whether or not they engaged in any of the listed behaviors. in order to fully g. l. theodori and a. e. luloff understand the links between position on environmental issues and engagement in proenvironmental behaviors, future studies should examine the frequency of parti- cipation in such behaviors. notes . see luloff et al. ( ), theodori, luloff, and willits ( ), and theodori and luloff ( ) for a detailed description of the typology and each study site. . no statistical differences in regard to the available sociodemographic characteristics were found between the lancaster sample and those from snyder, bedford, and crawford. the percentages of old order amish and mennonites from the lancaster site totaled and , respectively. the analysis and reported ®ndings include data on both groups. removal of the amish and mennonites from the sample did not change the nature or pattern of the results reported here. . using mail survey techniques in three study sites, a response rate of about % was obtained, resulting in completed questionnaires from snyder, from bedford, and from crawford. using the drop-off=pick-up technique in lancaster, a response rate of % was achieved, resulting in completed questionnaires. . the percentages of respondents who indicated that they were unsympathetic to environmental issues and actively opposed to any action on environmental issues were . (n = ) and . (n = ), respectively. these respondents were combined with the indi- viduals who reported that they were neither sympathetic nor unsympathetic. the newly cre- ated category contained respondents and represented . % of the sample. . we chose the label ``neutral’’ for this category due to the fact that an overwhelming majority of respondents in this group, roughly % ( of ), indicated that they were neither sympathetic nor unsympathetic to environmental issues. it is important to keep in mind that the small numbers of respondents who reported being unsympathetic to environ- mental issues (n = ) and actively opposed to any action on environmental issues (n = ) are subsumed under this label. . in principal, three of the items could indicate anti- rather than proenvironmental behavior. respondents could have attended a meeting, contacted a government agency, or voted for a candidate to prevent, rather than to promote, environmental protection. however, the correlation of these variables with unambiguously proenvironmental behaviors indicated that such intentions were rare. . an odds ratio (y) is e (natural logarithm) raised to the power of b (the metric logit coef®cient); y refers to the effect of a one-unit change in x on the odds of y. it has a ``times as likely’’ interpretation. y can equal any nonnegative number. when x and y are independent, y equals . a value of generally serves as a baseline for comparison. odds ratios on either side of re¯ect certain types of associations. an odds ratio greater than ( < y < ?) indicates a positive association, while an odds ratio less than ( < y < ) denotes a negative association. values of y farther from in either direction designate stronger levels of association (agresti ; liao ). references abc news=washington post. . abc news washington post april poll. compiled by k. i. wright. interview dates ± , april . survey . abc news polling unit, new york. agresti, a. . an introduction to categorical data analysis. new york: john wiley & sons. dillman, d. a. . mail and telephone surveys: the total design method. new york: john wiley and sons. dunlap, r. e. . public opinion and environmental policy. in environmental politics and policy: theories and evidence, ed. j. p. lester, ± . durham, nc: duke university press. position on environmental issues dunlap, r. e., and r. b. heffernan. . outdoor recreation and environmental concern: an empirical examination. rural sociol. : ± . kaplan, s. . human nature and environmentally responsible behavior. j. social issues : ± . liao, t. f. . interpreting probability models: logit, probit, and other generalized linear models. thousand oaks, ca: sage. luloff, a. e., and t. w. ilvento. . respondents, nonrespondents, and population surveys. j. commun. dev. society : ± . luloff, a. e., l. bourke, s. jacob, and s. seshan. . farm and non-farm interdependencies at the rural±urban interface. final project report for the pennsylvania department of agriculture. university park, pa: pennsylvania state university. mauss, a. l. . social problems as social movements. philadelphia: lippincott. melbye, j., l. bourke, a. e. luloff, p. s. liao, g. l. theodori, and r. s. krannich. . the drop-off=pick-up method for household survey research. working paper ipre-wp- - . university park, pa: institute for policy research and evaluation, pennsylvania state university. mertig, a. g., and r. e. dunlap. . environmentalism, new social movements, and the new class: a cross-national investigation. rural sociol. : ± . morrison, d. e. . how and why environmental consciousness has trickled down. in distributional con¯icts in environmental-resource policy, ed. a. schnaiberg, n. watts, and k. zimmerman, ± . new york: st. martin’s press. theodori, g. l., and a. e. luloff. . urbanization and community attachment in rural areas. society & natural resources : ± . theodori, g. l., a. e. luloff, and f. k. willits. . the association of outdoor recreation and environmental concern: reexamining the dunlap-heffernan thesis. rural sociol. : ± . van liere, k. d., and r. e. dunlap. . the social bases of environmental concern: a review of hypotheses, explanations and empirical evidence. public opin. q. : ± . wirthlin worldwide. . research supplement: the wirthlin report. wirthlin rep. (august): ± . wirthlin worldwide. . research supplement: the wirthlin report. wirthlin rep. (october): ± . wirthlin worldwide. . research supplement: the wirthlin report. wirthlin rep. (august=september): ± . wirthlin worldwide. . research supplement: the wirthlin report. wirthlin rep. (september): ± . wirthlin worldwide. . research supplement: the wirthlin report. wirthlin rep. (november): ± . g. l. theodori and a. e. luloff http://www.greenjournal.org/cgi.pdf outcomes of intended home births in nurse-midwifery practice: a prospective descriptive study patricia aikins murphy, cnm, drph, and judith fullerton, cnm, phd objective: to describe the outcomes of intended home birth in the practices of certified nurse-midwives. methods: twenty-nine us nurse-midwifery practices were recruited for the study in . women presenting for intended home birth in these practices were enrolled in the study from late to late . outcomes for all enrolled women were ascertained. validity and reliability of submit- ted data were established. results: of enrolled women intending home births, % miscarried, terminated the pregnancy or changed plans. another . % became ineligible for home birth prior to the onset of labor at term due to the development of perinatal problems and were referred for planned hospital birth. of those women beginning labor with the intention of deliver- ing at home, ( . %) were transferred to the hospital during labor. ten mothers ( . %) were transferred to the hospital after delivery, and infants ( . %) were trans- ferred after birth. overall intrapartal fetal and neonatal mortality for women beginning labor with the intention of delivering at home was . per . for women actually delivering at home, intrapartal fetal and neonatal mortality was . per . conclusion: home birth can be accomplished with good outcomes under the care of qualified practitioners and within a system that facilitates transfer to hospital care when necessary. intrapartal mortality during intended home birth is concentrated in postdates pregnancies with evidence of meconium passage. (obstet gynecol ; : – . © by the american college of obstetricians and gynecolo- gists.) many accept the premise that because of modern tech- nology, hospitals are the safest place to give birth. since the s, most births in the united states have taken place in hospitals with physicians in attendance. none- theless, there are also more than , out-of-hospital births in the united states annually, most in birth centers, clinics, and the home. of these, nearly , are residential births. over the past years, the frequency of home births has remained stable at approximately . % of all births (table ). – home birth is a controversial issue. debates about the safety of home births focus on the risk of preventable perinatal morbidity and mortality, and on broader issues of appropriate screening and referral. questions also are raised about the ability to predict which women can safely give birth at home and about the risk of unforeseen complications that require emergency trans- port to a hospital. published studies on intended home birth have demonstrated low perinatal mortality and morbidity but have stressed the necessity of planning, risk-assessment and well-qualified attendants. – however, international studies report data from coun- tries in which medical and obstetric care systems may be dissimilar from those in this country and in which the reporting criteria for neonatal and perinatal deaths also may vary, making international comparative data less interpretable. – some us studies of home birth are limited by small size; others reflect limited geo- graphic areas or homogeneous populations. – fi- nally, many studies have inadequate methodology for addressing certain issues. studies using birth certificate data, for example, cannot identify perinatal mortality that may be attributable to planned home birth but occur after transfer to the hospital. certified nurse-midwives have attended approxi- mately home births annually ( – ) in the united states. a retrospective study by one of the authors (pam) reported outcomes of , planned home births. the intrapartum and neonatal mortality among women intending home birth at the onset of labor was two per . although a large sample, the from the department of obstetrics and gynecology, columbia uni- versity college of physicians and surgeons, new york, new york, and the department of family nursing care, university of texas health science center at san antonio, san antonio, texas. this project was supported in part by a columbia university strategic research award and by the acnm foundation. vol. , no. , september - / /$ . pii s - ( ) - findings were limited by the retrospective nature of the report. a prospective evaluation of home birth out- comes in the practices of certified nurse-midwives in the united states was then designed and implemented. this article reports the results of this prospective study. methods a community-based nurse-midwifery practice network was recruited in . nurse-midwifery practices pro- viding home birth services were identified by a mailed survey to the membership of the american college of nurse-midwives, advertisements placed in professional publications, and referral from other midwives. forty- five active nurse-midwifery home birth practices were identified in . of these, twenty-nine practices ( %) providing home birth services agreed to participate in the network. three participating practices later with- drew from full participation because they perceived continued participation to be an excessive work burden but did contribute full data on all patients who were enrolled up to a particular date determined by the investigator. solo and group practices participated, enrolling as few as two to as many as planned home births in the enrollment year; practices were located in rural and urban settings. six were located in california, and five in pennsylvania. new york and virginia were each represented by three—illinois and texas each by two. eight other states were represented by one nurse- midwife home birth practice each. the study was approved by the institutional review board of the principal investigator’s institution. eligible subjects were pregnant women age years or older who requested home birth and were eligible for home birth services according to the practice guidelines of the individual nurse-midwifery practices. the researchers made no attempt to evaluate the equivalency of these practice guidelines, nor to establish practice-related standards. uniform data collection forms were developed and pilot tested in several practices prior to initiation of the study. the forms included demographic and perinatal risk information about individual patients, as well as the outcomes of prenatal, intrapartal, and postpartum care. patients were enrolled between december and december . all new patients seeking home birth in participating practices were invited to enroll; enroll- ment generally occurred at a first or second prenatal visit. initial data were forwarded to the central study office at this time; additional data were collected and forwarded at the time of birth and the postpartum visit. any referral to another provider for care or to a planned hospital birth was recorded. hospital records were requested for all women and newborn infants who were transferred to a hospital during labor or immedi- ately after birth. data were reviewed for completeness and logical consistency by clinically experienced study personnel upon receipt in the study office. when data were called into question, practices were contacted with a request for clarification. data reliability was evaluated by comparing dupli- cate records serendipitously received during the course of the study and in a % random sample of duplicate records specifically requested from each practice. study office personnel abstracted these latter records onto study forms. intrarater and interrater reliability were calculated by simple percent agreement, comparing each item on one form to its counterpart. agreement ranged from % to % for the items compared on both duplicate and random samples. agreement for major outcome variables (such as site of birth, perinatal mortality, and primary birth outcomes) was %. accuracy of data submitted for transfers was as- sessed by examining hospital records requested for all women transferred to the hospital in late pregnancy, during labor, or after birth. the condition of mother and infant on arrival in the hospital and birth outcomes were verified. eighty percent of hospital records re- quested were received and were fully consistent with information provided by the practice. full information was obtained on all intrapartum transfers. in addition, midway through the enrollment year, surveys were sent to women who still were eligible for home birth in late pregnancy. the surveys were mailed months after the estimated date of delivery and included requests for data on the birth, as well as information about patient satisfaction. three quarters of the surveys were re- turned, and again, the data were found to be consistent with data submitted by the practice. data were analyzed primarily as descriptive statis- tics. group comparisons were assessed with � and t test procedures. the probability value for statistical significance was set at . . results one thousand four hundred four eligible women en- rolled in the study. participating practices reported table . home births in the united states, – year total births total home births % of all births , , , . , , , . , , , . , , , . , , , . , , , . murphy and fullerton home birth outcomes obstetrics & gynecology women who refused to enroll, primarily from amish communities. reasons given were cultural or privacy concerns. table describes the sample of women in- tending a home birth. socioeconomic status was de- rived from payment source, occupation of patient and partner, income (if reported by the patient), and an estimate by the nurse-midwife based on family size, reported income, and special circumstances. thirty-two percent of the women were members of amish and mennonite communities, which contributed to the ed- ucational and socioeconomic profile of the sample. there was little evidence of behavioral perinatal risk among the women in this study. few women reported the use of tobacco, alcohol, or other substances prior to or during pregnancy (table ). all but % had at least five prenatal visits. evidence of prior medical or obstet- ric risk in the sample was also minimal. among parous women in the sample, % had had a previous home birth and % a previous birth center birth; overall . % of the parous women had a previous out-of- hospital birth experience. twenty-two percent of the parous women in the sample had a history of one or more intrapartal or neonatal factors that required inter- vention, possibly indicating a higher perinatal risk potential in the current pregnancy. these included a history of pregnancy-induced hypertension ( . %), as- sisted vaginal delivery ( . %), stillborn fetus or neona- tal death ( . %), low birth weight infant ( . %), or postpartum hemorrhage ( . %). a specific question about previous shoulder dystocia was added to the instrument midway through the enrollment year. data on previous shoulder dystocia thus are available for only parous women; . % of this smaller sample had a history of previous shoulder dystocia. of the women who had a previous cesarean delivery ( . % of parous women), % also had had a subsequent suc- cessful vaginal birth following cesarean. one hundred eighty-three women left or were re- ferred out of the home birth practice during the preg- nancy and prior to labor at term. eighty-six ( . %) miscarried, terminated the pregnancy, moved away, or changed their minds about home birth. only seven of these women reported financial problems or lack of insurance coverage as the reason for deciding against home birth. of the remaining women, ( . %) were referred for hospital-based care prior to the onset of term labor. this group includes those women who developed preterm labor or preterm premature rupture of membranes. according to the protocols of the prac- tices, women were referred directly for hospital labor and birth management if labor or membrane rupture occurred prior to a designated gestational age (usually weeks). table presents specific indications for antepartum transfers, and the outcomes of these preg- nancies in known cases. women leaving the home birth service during the antepartal period were more likely to be unmarried ( % compared with %, p � . ), nonwhite ( % compared with %, p � . ), nulliparous ( % compared with %, p � . ) or to have medicaid ( . % compared with . %, p � . ) when compared with women who remained eligible for a home birth. amish and menno- nite women were less likely to be referred out of the home birth practice (p � . ). follow-up data were obtained for . % of the ante- partum referrals that occurred after weeks’ gestation for medical or obstetric risk factors; all of these women had planned hospital births due to the presence of medical or obstetric problems. there were four imme- diate neonatal deaths reported in this group: three due table . characteristics of women intending home birth characteristic initially enrolled and eligible (n � ) eligible for home birth at labor onset (n � ) married/consensual union . % . % white . % . % parity � � . % . % age mean . y (sd . y) . y (sd . y) – y . % . % – y . % . % – y . % . % – y . % . % – y . % . % primary occupation as homemaker . % . % education � y . % . % college graduate or higher . % . % payment self-pay . % . % commercial/military insurance (includes hmos) . % . % medicaid/other government . % . % other payment (barter, etc) . % . % low socioeconomic status . % . % amish/mennonite . % . % drug/substance use . % . % alcohol use: � drinks per wk . % smokes � cigarette per wk . % . % previous cesarean delivery (multiparas only) . % . % prenatal care in st trimester . % . % number of prenatal visits . . sd � standard deviation; hmo � health maintenance organization. vol. , no. , september murphy and fullerton home birth outcomes to congenital anomalies and one due to complications of prematurity. two ( %) of ten antepartum fetal demises were associated with lethal anomalies. among those in this group for whom follow-up data were available, % had cesarean deliveries. one thousand two hundred twenty-one women re- mained eligible for home birth at the time of labor onset. of these, ( . %) were transferred to the hospital during labor, and gave birth at home. ten women and neonates were transferred to the hospital after birth (tables and ). forty women ( . %) deliv- ered before the midwife arrived at the home; all infants and mothers were well after these unattended births. mean birth weight for infants born at home was g (standard deviation ). only four infants ( . %) weighed less than g at birth, infants ( %) weighed more than g at birth, and of these ( . % of all births) weighed more than g. of those low birth weight infants born at home, infants ranged from to weeks’ gestation and weights ranged from to g. no births at home were assisted with vacuum or forceps; four infants were born in breech presentation. forty-six infants ( . %) were reported as not having spontaneous respirations; of these ( . %) were reported to have had some type of resuscitation procedure (ambu bag, cardiac massage, or intubation). thirty-three of these ( . %) had minute apgar scores of less than ; only infants had minute apgars of less than ( . % of attended home births). participating midwives were asked to report on ac- tual or potential obstetric problems occurring during labor and delivery at home. these are listed in table . twenty-seven percent of nulliparous women and . % of parous women were transferred during labor (p � . ). hospital transfer during the intrapartum period was not related to preexisting obstetric risk factors. it was significantly related to a number of actual or potential intrapartum problems (see table ). gesta- tional age of weeks or more and the presence of meconium were factors that greatly increased the risk of transfer to hospital and perinatal mortality. seventeen percent of laboring women with meconium-stained fluid were transferred to the hospital during labor, compared with . % of women with clear fluid. seven- teen percent of women at weeks’ gestation or more who intended to deliver at home were transferred table . antepartal referrals for obstetric or hospital-based management* reason n % of eligible sample† known infant outcomes ptl or preterm prom . : good � wk gestation ( – wk) : hospitalized : nnd (includes also with anomalies) : unknown multiple gestation � . : good : unknown diagnosis of congenital anomalies (excluding above) . : stable : iufd : nnd antepartum fetal demise (excludes those due to anomalies above) . fetal malpresentation . : good : unknown % cesarean delivery rate vaginal bleeding/placenta previa . : good : unknown % cesarean delivery rate suspected macrosomia . : good suspected fetal growth restriction . : good : unknown other suspicion of fetal compromise . : good medical problems . : good : hospitalized : unknown prom at term � . : good pregnancy exceeding wk . : good ptl � preterm labor; prom � premature rupture of membranes; nnd � neonatal death; iufd � intrauterine fetal demise. * these women were no longer eligible for home birth. † n � . excludes from antepartal group spontaneous abortions, voluntary terminations, and those who changed their mind or moved out of the area (n � ). murphy and fullerton home birth outcomes obstetrics & gynecology during labor for hospital birth, compared with . % of women at less than weeks’ gestation. both intrapar- tum fetal deaths occurred in pregnancies of weeks’ or more gestation with meconium-stained amniotic fluid. as previously noted, full birth information was ob- tained from hospital records or managing clinicians for % of these intrapartum transfers; substantial birth information was received for all others. five-minute apgar scores were or higher for % (of those for whom the apgar was reported); all liveborn infants were well at a postpartum evaluation. thirty-two per- cent of these transfers had a cesarean delivery, and % had an assisted vaginal delivery. among those with a previous cesarean delivery who began labor with the intention of delivering at home (n � ), % were transported to the hospital during labor for care (as compared with . % transported among those with no history of cesarean delivery [not statistically significant]). the cesarean delivery rate was . % in women with a previous cesarean; there was one vacuum assisted delivery in this group ( . %). the overall cesarean rate was . %. among the women beginning labor with the intention of delivering at home, there were five perina- tal deaths. thus the total intrapartum and neonatal mortality was . per (see table ). excluding two fetal demises diagnosed at the first labor status evalu- ation by the attending midwife and referred immedi- ately for hospital birth, there were three fetal or infant deaths among women whose labor was managed in whole or in part at home. this results in a total intrapartum and neonatal mortality for planned labor and birth at home of . per . both fetal deaths were in pregnancies of weeks or more gestation with table . intrapartum/postpartum/neonatal transfers to hospital reason n eligible sample (%)* comment intrapartum transfer changed mind regarding home birth . selfreferred to hospital at labor onset midwife unable to attend home birth . transferred to birth center due to other clients in labor or environmental problems in the home no fetal heart tones . fetal demise diagnosed at the first assessment of the patient in labor nonvertex fetal presentation . woman converted to vertex in hospital and returned home for labor and birth fetal distress . one infant stillborn in the hospital after assisted delivery for meconium and fetal distress; others in good condition moderate to thick meconium . excludes the stillborn infant mentioned above; all infants well at mo vaginal bleeding . mothers and infants well prolonged labor or rupture of membranes . all infants well cord prolapse . infant born in good condition postpartum transfer perineal suturing . discharged after suturing retained placenta . discharged after placental delivery postpartum bleeding . discharged after d; all well infant transfer stillborn . resuscitation unsuccessful; meconium and postdates respiratory problems . hospitalized; all well at mo evaluation of anomalies . stable at mo, given condition evaluation for sepsis . well at mo first postpartum month evaluation for possible endometritis discharged after evaluation cholecystitis/cholecystectomy all well other (colitis, hemorrhoidectomy) all well first newborn month neonatal death at h of age; no cause of death established by medical examiner evaluation of possible anomaly all stable for condition at mo respiratory problems all well at mo infection or jaundice all well at mo other† all well at mo * n � . † circumcision, dehydration, failure to thrive, hernia repair. vol. , no. , september murphy and fullerton home birth outcomes evidence of meconium passage. one stillbirth occurred in the hospital; the mother was transferred during labor for slow progress and meconium-stained fluid. the fetal heart rate was reported as normal on arrival in the hospital, and the mother labored for several hours more before delivering the stillborn infant. meconium aspi- ration was reported as the cause of death. the second stillborn was born at home; there was no autopsy, but the reporting midwife indicated the presence of meco- nium as well. a third infant died at hours of age; postmortem studies were unable to establish a cause of death. for labors managed entirely at home, mortality was . per . there were no maternal deaths. discussion this report is one of the few studies of home birth conducted in the united states and is unique in its multisite prospective nature. although the sample has limited ability to reflect stable rates of perinatal prob- lems in home birth settings due to its relatively small size, the antepartum and perinatal transfer rates re- ported are similar to a larger retrospective study that addressed nurse-midwifery home birth practice out- comes. intrapartum and neonatal mortality rates in this study also compare favorably to rates reported in that study (two per ) and in a prospective study of outcomes of planned birth center births ( . per ). the latter study cited comparisons to two studies of uncomplicated hospital births. a study of electronic fetal monitoring published in identified , births as low risk and reported the associated intrapar- tum and neonatal mortality as one per . a report identified , uncomplicated term and post- term pregnancies for an evaluation of perinatal charac- teristics of postdates pregnancies; of these, were uncomplicated term hospital births with an intrapar- tum and neonatal mortality of . per . a number of studies of home birth also report low rates of intrapartum or neonatal mortality, although it is recog- nized that international reporting criteria for perinatal mortality may vary. when possible, raw data available in these published reports were recalculated to reflect a sample similar to that reported here (table ). a recent meta-analysis of six european and us home birth studies revealed no significant difference in perinatal mortality between home and hospital birth. this meta- analysis included data only from developed countries table . summary outcomes of transfers to hospital-based care or management timing of transfer n % of relevant sample adverse outcomes antepartum referral (includes preterm labor or rupture of membranes if no longer eligible for home birth) . (of ) iufd, nnd, information unknown for % intrapartum transfer . (of ) iufd prior to first assessment, iufd in labor (stillborn in hospital) postpartum maternal transfer . (of ) no maternal mortality postpartum infant transfer . (of ) iufd in labor (stillborn at home) total . (of ) later postpartum . (of ) no maternal mortality later newborn . (of ) nnd at home at h of age iufd � intrauterine fetal demise; nnd � neonatal death (within first week of life). table . actual or potential obstetric problems reported by midwives as occurring during labor and birth at home event n (%)* relative risk for transfer to hospital-based care ( % ci) maternal inability to cope with labor/need for analgesia ( . ) . ( . , . ) fetal heart abnormalities in the first stage of labor ( . ) . ( . , . ) fetal heart abnormalities in the second stage of labor ( . ) . ( . , . ) prolonged latent phase of labor ( . ) . ( . , . ) lack of progress in the first stage of labor ( . ) . ( . , . ) lack of progress in the second stage of labor ( . ) ( . , . ) prolonged rupture of membranes ( . ) . ( . , . ) meconium-stained amniotic fluid (any) ( . ) . ( . , . ) moderate to thick meconium ( . ) . ( . , . ) shoulder dystocia or difficulty delivering shoulders ( . ) . ( . , . ) postpartum hemorrhage or excess bleeding in the third stage of labor ( . ) . ( . , . ) ci � confidence interval. * percentages have been corrected for missing data. in some cases transfer to hospital management early in labor created missing data for some variables. murphy and fullerton home birth outcomes obstetrics & gynecology that use similar perinatal reporting criteria and defini- tions. there are several limitations to note in this report. the results reported here reflect a sample of nurse- midwifery practices willing to participate in data col- lection and to permit the resulting scrutiny of their practices. we cannot draw comparisons to nonpartici- pating nurse-midwifery practices or to the home birth practices of physician and other midwife providers. during and , an average of certified nurse-midwives–attended home births per year were reported in vital statistics data. , thus, these data reflect more than % of those births. this study presents only the outcomes of home birth practice; it makes no comment on the process of care. there was no attempt to require adherence to standard- ized guidelines for practice because the intent was to examine home birth practice as it occurs in the commu- nity. however, it may be reasonable to infer that many participating practices developed their individual pro- tocols in accord with the professional practice guide- lines for home birth practice developed by the ameri- can college of nurse-midwives (acnm home birth committee. guidelines for home birth. washington dc: american college of nurse-midwives, ). the equivalency of clinical protocols in the individual prac- tices was not examined, but participating midwives were asked brief questions about their determination of ineligibility for home birth. for example, % of the midwives considered twin pregnancy a contraindica- tion for home birth, and % considered a breech presentation a contraindication. preterm labor was a contraindication as well; for % of practices, labor before weeks’ gestation conferred ineligibility for home birth; two practices held weeks as a minimum gestational age (data on file). seventy-three percent of the midwives accepted women for home birth if they had a previous cesarean delivery; in most cases a previous successful vaginal birth after the cesarean delivery also was required to confer eligibility for home birth. antenatal screening practices were not evaluated per se. however, the observation that referrals to hospital- based care were made upon diagnosis of obstetric complications such as gestational diabetes, multiple gestation, or congenital anomalies suggests that stan- dard obstetric evaluation protocols were followed. variations in skill and experience of participating midwives could affect findings, but these aspects of practice were not evaluated directly. participants aver- aged more than years of experience as midwives and more than in home birth practice, with a range from a few months to years. practices also varied in the number of intended home births enrolled in the study over the course of year. this number ranged from two to . no attempt was made to analyze outcomes according to the experience of the clinician or practice. as noted above, the purpose was to examine home birth outcomes as they occur, given the mix of practice experience and protocol. the absence of a comparison group may be seen as a limitation of this study, creating difficulty in determin- ing whether the intrapartal and neonatal morbidity and mortality seen here are higher than what would be table . perinatal deaths in other studies of home birth*† author site n perinatal or neonatal mortality comment van alten et al wormerveer, – . per those remaining eligible for home birth at labor burnett et al north carolina, – per neonatal mortality only mehl et al us, . per excludes deaths due to prematurity and anomalies schramm et al missouri, – . per neonatal mortality among physician, nurse-midwife, and mma midwife–attended births only campbell et al britain, . per those booked for home birth woodcock et al australia, – home birth . per uncorrected for birth weight and gestational age sullivan and beeman arizona, . per excludes anomalies tyson canada, – per neonatal mortality only hinds et al kentucky, . per neonatal mortality only durand the farm, . per excludes deaths due to anomalies and premature births nrpmsc group britain, . per planned home birth mma � missouri midwife association; nrpmsc � northern region perinatal mortality survey coordinating group. * recalculated from original data where possible to remove twin births, congenital anomalies, and premature births (by standard study participants referred these complications for hospital birth). † only studies with at least births are recorded. vol. , no. , september murphy and fullerton home birth outcomes expected in a similar group of planned hospital births. however the series of risk screening filters through which women interested in home birth passed in these participating practices (at first inquiry, at first visit, and throughout the antepartal and perinatal period) makes it difficult to choose an equivalent comparison popula- tion from other data sources. in addition, bias due to self-selection would remain a threat despite careful matching of risk status. in consideration of these fac- tors, the prospective data are presented without a direct comparison; the low incidence of mortality allows indi- vidual examination of each case. only a randomized clinical trial would remove the issue of selection bias; however, this would be ex- tremely difficult to carry out. researchers in great britain assessed the feasibility of doing a randomized trial comparing home to hospital birth. they found that of women booking for obstetric care, were deemed of low enough risk for a home birth, and of these only ( . % of the original sample) agreed to be randomized. in addition, the authors noted that four of six women randomized to hospital birth were “dis- appointed,” although all randomized to home birth were pleased; those who declined to participate had strong preferences about the place of birth. wiegers et al further suggest that choice in childbirth may have a positive influence on levels of anxiety and apprehen- sion, which in turn could influence outcomes. elimina- tion of choice, as would be necessary with randomiza- tion, could theoretically have a negative impact on the course of childbirth and thus on outcomes. thus the debate over home birth is not likely to be settled with a randomized trial. questions about the relative safety of different birth settings are legitimate but often are answered in terms of ideologies rather than systematic research. the debate usually is framed as one of hospital compared with home. in most situations, and certainly in the practices described here, however, the circumstances are more planned hospital birth compared with in- tended home birth within a system that facilitates transfer to hospital birth when problems arise. thus, issues related to appropriate risk screening and predic- tion of perinatal problems are important when consid- ering out-of-hospital birth settings. the two factors most strongly associated with perinatal mortality and morbidity are congenital anomalies and low birth weight. neither condition is preventable by choice of birth site, although adverse sequelae may be modulated by the availability of emergency medical care. how- ever, in these practices, premature birth and pregnan- cies known to be complicated by fetal anomalies were referred routinely for planned hospital birth. the ability to identify other perinatal problems then becomes more important in out-of-hospital birth. recognizing that risk screening always will be an imperfect science and that some perinatal events cannot be predicted in any event, this report nonetheless underscores the ability of home birth practicing nurse-midwives to select an initial eligible sample at low risk of adverse perinatal out- comes. subsequently developing problems associated with increased perinatal risk, such as multiple gesta- tion, abnormal fetal lie, or concurrent medical illnesses also are referred appropriately for perinatal manage- ment or hospital delivery. although the outcomes of women referred for hospital birth prior to the onset of labor do not reflect on managed home birth, it is of interest to note the concentration of perinatal morbidity and cesarean delivery among women referred for hos- pital birth during the antepartum period. the apparent success of certified nurse-midwives in identifying higher risk pregnancies and appropriately referring these to perinatal care prior to labor is consistent with other reports. , during labor, events associated with increased need for interventions best delivered in hos- pital settings also are identified by nurse-midwives during home birth management, and the mothers or infants are transferred appropriately. one area that might require reassessment is the postdates pregnancy, especially if accompanied by meconium passage. these data and those from another recently published study suggest that eligibility for home birth should be consid- ered carefully in this circumstance; although hospital birth is no guarantee of a good outcome, specialty care is available more readily in that setting for infants with meconium aspiration. when intrapartum, postpartum, and neonatal emer- gencies occur, prompt transport and intervention is critical. perinatal emergencies were rare in this sample. participating midwives were asked at the beginning of this study about routine preparations for emergencies. all carry oxygen, oral suction equipment, intravenous setups, oxytocin, and methylergonovine to the home. all but one midwife carry a doppler device for moni- toring the fetal heart; the remaining midwife uses a fetoscope. all but one carry an ambu bag for resusci- tation and reported having formal certification in neo- natal resuscitation. sixty-eight percent bring a laryngo- scope and endotracheal tubes to home births; twenty percent also bring mechanical suction (data on file). in addition, most home birth practices in this study had eligibility requirements that the birth site be within minutes of a hospital providing obstetric services. ex- amination of hospital transfer records indicated that in the vast majority of cases, the mother arrived in the hospital with ample time prior to delivery to evaluate maternal-fetal status and make perinatal management decisions. in those cases in which birth occurred imme- murphy and fullerton home birth outcomes obstetrics & gynecology diately upon arrival, infants were born in good condi- tion with pediatricians in attendance. obviously, suc- cessful management of such transfers is also contingent on a close collaborating relationship between the mid- wife, the consulting obstetrician, and the hospital staff, especially given that only % of these participating midwives had hospital privileges. this evaluation of planned home birth points to the possibility that home birth can be accomplished, with good outcomes, within a structured system that allows for collaboration with physicians and referral to hospi- tal-based care where necessary. presentation of these data is not intended to posit home birth as a solution for all or most women. demand for home birth is admit- tedly minimal in the contemporary american health care system, but it has been a stable demand, resulting in , births a year. the outcomes, risks, and benefits of home care for childbirth should be assessed to make appropriate decisions regarding the circumstances in which home birth could occur, for those women who are determined to pursue this choice in childbirth. this report is intended to be a step in this direction. references . pearse wh. trends in out of hospital births. obstet gynecol ; : – . . clarke s, martin j, taffel s. trends and characteristics of births attended by midwives. stat bull metrop insur co ; ( ): – . . national center for health statistics. advance report of final natality statistics, . monthly vital statistics reports; vol. , no. , suppl. hyattsville, maryland: national center for health statis- tics, . . ventura sj, martin ja. advance report of final natality statistics, . monthly vital statistics report; vol. , no. , suppl. hyatts- ville, maryland: national center for health statistics, . . ventura sj, martin ja, taffel sm, mathews tj, clarke sc. advance report of final natality statistics, . monthly vital statistics report; vol. , no. , suppl. hyattsville, maryland: national center for health statistics, . . ventura sj, martin ja, taffel sm, mathews tj, clarke sc. advance report of final natality statistics, . monthly vital statistics report; vol. , no. , suppl. hyattsville, maryland: national center for health statistics, . . ventura sj, martin ja, mathews tj, clarke sc. advance report of final natality statistics, . monthly vital statistics report; vol. , no. , suppl. hyattsville, maryland: national center for health statistics, . . ventura sj, martin ja, curtin sc, mathews tj. report of final natality statistics, . monthly vital statistics report; vol. , no. , suppl. hyattsville, maryland: national center for health statistics, . . barron sl, thomson am, philips pr. home and hospital confine- ment in newcastle upon tyne – . br j obstet gynaecol ; : – . . campbell r, davies im, macfarlane a, beral v. home births in england and wales, : perinatal mortality according to in- tended place of delivery. bmj ; : – . . shearer jml. five year prospective survey of risk of booking for home birth in essex. bmj ; : – . . van alten d, eskes m, treffers pe. midwifery in the netherlands. the wormerveer study; selection, mode of delivery, perinatal mortality, and infant morbidity. br j obstet gynaecol ; : – . . crotty m, ramsay at, smart r, chan a. planned homebirths for southern australia – . med j aust ; : – . . woodcock hc, read aw, moore dj, stanley fj, bower c. planned homebirths in western australia – : a descriptive study. med j aust ; : – . . ford c, iliffe s, franklin o. outcome of planned home births in an inner city practice. bmj ; : – . . tyson h. outcomes of midwife-attended home births in toronto, – . birth ; : – . . ackermann-liebrich u, voegeli t, gunter-witt k, kunz i, zullig m, schindler c, et al. home vs. hospital deliveries : follow-up of matched pairs for procedures and outcomes. bmj ; : – . . davies j, reid w, young g, for the home birth study steering group. prospective regional study of planned home births. bmj ; : – . . northern region perinatal mortality survey coordinating group. collaborative survey of perinatal loss in planned and unplanned home births. bmj ; : – . . weigers ta, keirse mjnc, van der zee j, berghs gah. outcome of planned home and planned hospital births in low risk pregnan- cies: prospective study in midwifery practices in the netherlands. bmj ; : – . . mehl le, peterson gh, whitt m, hawes we. outcomes of elective home births: a series of cases. j reprod med ; : – . . burnett ca, jones ja, rooks j, chen ch, tyler cw, miller a. home delivery and neonatal mortality in north carolina. jama ; : – . . shy kk, frost f, ullom j. out of hospital delivery in washington state: – . am j obstet gynecol ; : – . . sullivan da, beeman r. four years’ experience with home birth by licensed midwives in arizona. am j public health ; : – . . hinds mw, bergeison gh, allen dt. neonatal outcome in planned v unplanned out of hospital births in kentucky. jama ; : – . . schramm wf, barnes de, bakewell jm. neonatal mortality in missouri home births, – . am j public health ; : – . . anderson r, greener d. a descriptive analysis of home births attended by cnms in two nurse-midwifery services. j nurse midwifery ; : – . . durand am. the safety of home birth: the farm study. am j public health ; : – . . janssen pa, holt vl, myers sj. licensed midwife-attended, out of hospital births in washington state: are they safe? birth ; : – . . anderson re, murphy pa. outcomes of , planned home births attended by certified nurse-midwives: a retrospective de- scriptive study. j nurse midwifery ; : – . . rooks jp, weatherby nl, ernst ekm, stapleton s, rosen d, rosenfield a. outcomes of care in birth centers. n engl j med ; : – . . leveno kj, cunningham fg, nelson s, roark m, williams ml, guzick d, et al. a prospective comparison of selective and univer- sal electronic fetal monitoring in , pregnancies. n engl j med ; : – . . eden rd, seifert ls, winegar a, spellacy wn. perinatal charac- teristics of uncomplicated postdate pregnancies. obstet gynecol ; : – . . olsen o. meta-analysis of the safety of home birth. birth ; : – . vol. , no. , september murphy and fullerton home birth outcomes . dowswell, thornton jg, hewison j, lilfford rjl. should there be a trial of home vs. hospital delivery in the united kingdom? bmj ; : – . . declercq er, paine ll, winter mr. home birth in the united states, – : a longitudinal descriptive report of national birth certificate data. j nurse midwifery ; : – . . campbell r, macfarlane a. place of delivery: a review. br j obstet gynaecol. ; : – . . garite t, snell bj, walker d, darrow v. development and experi- ence of a university-based, freestanding birth center. obstet gy- necol ; : – . . austin d. the process of obstetric triage: management by certified nurse-midwives. j perinat neonatal nurs ; : – . . mehl-madrona l, mehl madrona m. physician- and midwife- attended home births: effects of breech, twin, and post-dates outcome data on mortality rates. j nurse midwifery ; : – . address reprint requests to: patricia aikins murphy, cnm, drph department of obstetrics and gynecology columbia university college of physicians and surgeons west th street new york, ny e-mail: pam @columbia.edu received december , . received in revised form march , . accepted march , . copyright © by the american college of obstetricians and gynecologists. published by elsevier science inc. intrapartum controversies december – , the american college of obstetricians and gynecologists is sponsoring a course offering clinical presentations on a variety of difficult challenges the obstetrician encounters in the delivery room. the meeting is to be held at the sheraton new york hotel and towers, new york, new york. the american college of obstetricians and gynecologists has approved up to credit hours in category (formal learning) for this course. for further information, contact the registrar, the american college of obstetricians and gynecologists, th street sw, po box , washington dc, - , ( ) - . murphy and fullerton home birth outcomes obstetrics & gynecology [pdf] primary prevention of airway allergy | semantic scholar skip to search formskip to main content> semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. doi: . /s - - - corpus id: primary prevention of airway allergy @article{wikstn primarypo, title={primary prevention of airway allergy}, author={j. wikst{\'e}n and s. toppila-salmi and m. m{\"a}kel{\"a}}, journal={current treatment options in allergy}, year={ }, volume={ }, pages={ - } } j. wikstén, s. toppila-salmi, m. mäkelä published medicine current treatment options in allergy purpose of reviewthe aim of this paper is to review and summarize the current knowledge of prevention of airway allergy.recent findingsallergic rhinitis and asthma are allergic airway diseases. due to their increasing incidence and socioeconomic burden, allergic airway diseases have recently gained attention worldwide. the primary prevention of allergic airway diseases focuses on offspring’s gestational and childhood environment, such as maternal smoking and diet during pregnancy and… expand view on springer link.springer.com save to library create alert cite launch research feed share this paper citationsbackground citations view all topics from this paper drug allergy allergic rhinitis (disorder) smoke irritants hypersensitivity citations citation type citation type all types cites results cites methods cites background has pdf publication type author more filters more filters filters sort by relevance sort by most influenced papers sort by citation count sort by recency genomics of asthma, allergy and chronic rhinosinusitis: novel concepts and relevance in airway mucosa a. laulajainen-hongisto, a. lyly, + authors s. toppila‐salmi medicine clinical and translational allergy pdf save alert research feed can an otorhinolaryngological visit induce the suspect of allergic rhinitis in children? f. ameli, m. tosca, a. licari, f. gallo, g. ciprandi medicine european annals of allergy and clinical immunology pdf save alert research feed the pragmatic role of fef - in asymptomatic subjects, allergic rhinitis, asthma, and in military setting g. ciprandi, i. cirillo medicine expert review of respiratory medicine view excerpt, cites background save alert research feed airway epithelial dynamics in allergy and related chronic inflammatory airway diseases a. laulajainen-hongisto, s. k. toppila-salmi, a. luukkainen, r. kern medicine frontiers in cell and developmental biology view excerpts, cites background save alert research feed current strategies to inhibit high affinity fcεri-mediated signaling for the treatment of allergic disease g. gomez chemistry, medicine front. immunol. view excerpts, cites background save alert research feed the immunomodulatory potentials of interleukin‐ in airway allergies a. jafarzadeh, m. nemati, sara jafarzadeh, p. chauhan, b. saha medicine scandinavian journal of immunology save alert research feed comparison of fluticasone furoate nasal spray versus combined oral anti-histamine and anti-leukotriene therapy in allergic rhinitis junaid shahzad, s. chaudhry, mohammad aslam, a. akbar, maidah hanif medicine pdf view excerpt, cites background save alert research feed exposure to extreme heat events is associated with increased hay fever prevalence among nationally representative sample of us adults: - . c. r. upperman, j. parker, + authors a. sapkota medicine the journal of allergy and clinical immunology. in practice pdf save alert research feed allergy as a disease of dysbiosis: is it time to shift the treatment paradigm? ian a. myles medicine front. cell. infect. microbiol. view excerpt, cites background save alert research feed references showing - of references sort byrelevance most influenced papers recency allergen avoidance in allergic asthma f. cipriani, e. calamelli, g. ricci medicine front. pediatr. view excerpt, references background save alert research feed the skin as a target for prevention of the atopic march. a. lowe, d. leung, m. tang, j. su, k. allen medicine annals of allergy, asthma & immunology : official publication of the american college of allergy, asthma, & immunology save alert research feed allergic airway diseases in childhood: an update s. hofmaier medicine pediatric allergy and immunology : official publication of the european society of pediatric allergy and immunology save alert research feed probiotics: myths or facts about their role in allergy prevention. e. krzych-fałta, k. furmanczyk, a. tomaszewska, d. olejniczak, b. samoliński, urszula samolińska-zawisza medicine advances in clinical and experimental medicine : official organ wroclaw medical university pdf save alert research feed strategies to alter the natural history of childhood asthma k.a. lee-sarwar, l.b. bacharier, a. litonjua medicine current opinion in allergy and clinical immunology view excerpt, references background save alert research feed probiotics in asthma and allergy prevention m. mennini, l. dahdah, m. c. artesani, a. fiocchi, a. martelli medicine front. pediatr. save alert research feed prevention of asthma during the first years of life: a randomized controlled trial. g. marks, s. mihrshahi, + authors s. leeder medicine the journal of allergy and clinical immunology view excerpts, references background save alert research feed multifaceted allergen avoidance during infancy reduces asthma during childhood with the effect persisting until age years m. scott, g. roberts, r. kurukulaaratchy, s. matthews, andrea nove, s. h. arshad medicine thorax pdf view excerpt, references background save alert research feed early prescriptions of antibiotics and the risk of allergic disease in adults: a cohort study. p. cullinan, j. harris, + authors a. n. newman taylor medicine thorax pdf save alert research feed results from the ‐year sq grass sublingual immunotherapy tablet asthma prevention (gap) trial in children with grass pollen allergy e. valovirta, t. h. petersen, + authors r. klink medicine the journal of allergy and clinical immunology pdf save alert research feed ... ... related papers abstract topics citations references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue inside this issue may , volume , no. journal of the american college of cardiology inside this issue state-of-the-art papers state-of-the-art papers pre-eclampsia and heart disease raheel ahmed, joseph dunford, roxana mehran, stephen robson, vijay kunadian pre-eclampsia is a multisystem placentally mediated disease that classically presents with hypertension and proteinuria. women with a history of pre-eclampsia are at increased risk of future cardiovascular complications. this state-of-the-art paper reviews the available evidence that supports the association of pre-eclampsia with future cardiovascular risk and explores potential management options for these high-risk patients. state-of-the-art papers digoxin in worsening heart failure andrew p. ambrosy, javed butler, ali ahmed, muthiah vaduganathan, dirk j. van veldhuisen, wilson s. colucci, mihai gheorghiade the dig (digitalis investigation group) trial revealed that digoxin therapy reduced all-cause and heart failure (hf)–specific hospitalization but had no effect on survival. as a result, the role of digoxin in the management of hf patients remains controversial. this review evaluates the available data on the role of digoxin in the contemporary management of hf and provides a framework for further research. (continued on page a- ) http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - may , (continued) clinical research a- interventional cardiology radial artery catheterization and allen’s test marco valgimigli, gianluca campo, carlo penzo, matteo tebaldi, simone biscaglia, roberto ferrari, for the radar investigators this study investigates the safety and feasibility of transradial catheterization across the whole spectrum of allen’s test (at) results. a total of patients were recruited, of whom , , and presented a normal, intermediate, and abnormal at results, respectively. lactate did not differ among the study groups after the procedure and there were no hand ischemic complications. plethysmography readings and ulnar frame count suggested enhanced ulnar flow in abnormal at patients after transradial access (tra). these results suggest the safety and feasibility of tra across the whole spectrum of at results. editorial comment: olivier f. bertrand, patrick c. carey, ian c. gilchrist, p. interventional cardiology coronary calcification and percutaneous coronary intervention philippe généreux, mahesh v. madhavan, gary s. mintz, akiko maehara, tullio palmerini, laura lasalle, ke xu, tom mcandrew, ajay kirtane, alexandra j. lansky, sorin j. brener, roxana mehran, gregg w. stone the investigators sought to determine the impact of coronary calcification on outcomes after percutaneous coronary intervention (pci) for patients presenting with non–st-segment elevation and st-segment elevation acute coronary syndrome (acs). data from , patients from large randomized trials was pooled. the presence of moderate/severe target lesion calcification was an independent predictor of -year definite stent thrombosis (hazard ratio [hr]: . ) and ischemic target lesion revascularization (hr: . ). the authors conclude that moderate/severe lesion calcification is relatively frequent in patients with non–st-segment elevation acs syndromes and st-segment elevation myocardial infarction, and is strongly predictive of stent thrombosis and ischemic target lesion revascularization at year. editorial comment: david d. waters, rabih r. azar, p. (continued on page a- ) http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) -x http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - may , (continued) a- acute coronary syndromes hypothermia for stemi david erlinge, matthias götberg, irene lang, michael holzer, marko noc, peter clemmensen, ulf jensen, bernhard metzler, stefan james, hans erik bötker, elmir omerovic, henrik engblom, marcus carlsson, håkan arheden, ollie Östlund, lars wallentin, jan harnek, göran k. olivecrona in this investigation, the authors attempted to confirm the cardioprotective effects of hypothermia using a combination of cold saline and endovascular cooling in patients with st-segment elevation myocardial infarction (stemi). a total of patients with stemi (< h) were randomized, and the primary endpoint was infarct size as a percent of myocardium at risk (is/mar). is/mar was not significantly reduced by hypothermia, but the incidence of heart failure was lower. analysis of early anterior infarction ( to h) found a reduction in is/mar of %. the authors conclude that hypothermia did not lower the primary endpoint of is/mar; however, the lower incidence of heart failure and a possible effect among early anterior stemi need confirmation. acute coronary syndromes prognostic value of barc bleeding in stemi wouter j. kikkert, nan van geloven, mariet h. van der laan, marije m. vis, jan baan, jr, karel t. koch, ron j. peters, robbert j. de winter, jan j. piek, jan g. p. tijssen, josé p. s. henriques the aim of this analysis was to compare -year mortality predictions of bleeding academic research consortium (barc)–defined bleeding complications with existing bleeding definitions in patients with st-segment elevation myocardial infarction (stemi) and to investigate the prognostic value of individual data elements of the bleeding classifications. gusto (global utilization of streptokinase and tissue plasminogen activator for occluded arteries) and international society of thrombosis and haemostasis–defined bleeding were not associated with -year mortality, whereas timi (thrombolysis in myocardial infarction) major and barc type b or c bleeding conferred a -fold higher risk of -year mortality. the data elements most strongly associated with mortality were a hemoglobin drop � g/dl, the use of vasoactive agent for bleeding, cardiac tamponade, and intracranial hemorrhage. both the barc and timi bleeding classifications identify stemi patients at risk of -year mortality. editorial comment: harold l. dauerman, p. (continued on page a- ) http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - may , (continued) a- heart rhythm disorders scd risk stratification in nidcm jeffrey j. goldberger, haris suba�cius, taral patel, ryan cunnane, alan h. kadish in this study, the authors evaluated the performance of commonly reported risk stratification tests as predictors of arrhythmic events in patients with nonischemic dilated cardiomyopathy (nidcm). a meta-analysis of studies (n ¼ , ) evaluating the association between arrhythmic events and predictive tests (baroreflex sensitivity, heart rate turbulence, heart rate variability, left ventricular end-diastolic dimension, left ventricular ejection fraction, electrophysiology study, nonsustained ventricular tachycardia, left bundle branch block, signal-averaged electrocardiogram, fragmented qrs, qrs-t angle, and t-wave alternans [twa]) was conducted. the odds ratio (or) was highest for fragmented qrs and twa (or: . and . , respectively) and lowest for qrs duration (or: . ). no autonomic test was a significant predictor of arrhythmic outcomes. the study concludes that the parameters studied provided only modest risk stratification for sudden cardiac death in patients with nidcm. editorial comment: james p. daubert, robert k. lewis, p. heart rhythm disorders ethanol-induced regional left atrial denervation josé l. báez-escudero, takehiko keida, amish s. dave, kaoru okishige, miguel valderrábano the objective of this study was to determine whether ethanol infusion in the vein of marshall (vom) can ablate intrinsic cardiac nerves (icn). patients undergoing catheter atrial fibrillation (af) ablation additionally underwent high-frequency stimulation (hfs) using a multipolar catheter introduced in the vom. parasympathetic activity and af inducibility was assessed before and after vom ethanol infusion. using burst hfs, parasympathetic activity was found in all patients undergoing de novo af ablation and % of patients undergoing repeat ablation. after vom ethanol infusion, the parasympathetic response was abolished in all patients. the results reveal that the vom contains icn that connect with the atrioventricular node and can trigger af. retrograde ethanol infusion in the vom reliably eliminates local icn responses. editorial comment: pradeep s. rajendran, eric buch, kalyanam shivkumar, p. (continued on page a- ) http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - may , (continued) a- cardiac imaging combined ct techniques to assess invasive ffr dennis t. l. wong, brian s. ko, james d. cameron, darryl p. leong, michael c. h. leung, yuvaraj malaiapan, nitesh nerlekar, marcus crossett, john troupis, ian t. meredith, sujith k. seneviratne this study compares the diagnostic accuracy of combined adenosine stress computed tomography myocardial perfusion (ctp) þ computed tomography coronary angiography (cta), transluminal attenuation gradient (tag ) + cta, and ctp + tag + cta (multidetector computed tomography integrated protocol [mdct-ip]) assessment in predicting significant fractional flow reserve (ffr) vessels in patients undergoing coronary angiograms. in vessels, cta predicted ffr-significant stenosis with % sensitivity and % specificity, and mdct-ip showed % sensitivity and % specificity. tag + cta and ctp + cta provided comparable per-vessel diagnostic accuracy, and mdct-ip was superior to both. the authors conclude that mdct-ip may provide the best diagnostic accuracy for functional assessment of coronary artery stenosis. editorial comment: daniel s. berman, richard a. stoebner, damini dey, p. hypertension remodeling after renal denervation independent of hr and bp stephan h. schirmer, marwa m. y. a. sayed, jan-christian reil, christian ukena, dominik linz, michael kindermann, ulrich laufs, felix mahfoud, michael böhm this study investigates the interaction between blood pressure (bp) and heart rate (hr) reduction and changes in left ventricular (lv) structure and function following renal sympathetic denervation (rdn). lv size, mass, and diastolic function were evaluated in patients before and months after rdn. there was a decrease in systolic/diastolic bp ( . � . mm hg/ . � . mm hg to . � . mm hg/ . � . mm hg) and reduction in lv mass index ( . � . g/m . to . � . g/m . ). there was also an improvement of diastolic function as well as an increase in vascular compliance. structural and cardiac changes were not exclusively related to bp or hr changes, suggesting a direct role of the sympathetic nervous system activity on cardiac morphology and function. editorial comment: george bakris, sandeep nathan, p. http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - http://linkinghub.elsevier.com/retrieve/pii/s - ( ) - inside this issue state-of-the-art papers state-of-the-art papers pre-eclampsia and heart disease state-of-the-art papers digoxin in worsening heart failure clinical research interventional cardiology radial artery catheterization and allen's test interventional cardiology coronary calcification and percutaneous coronary intervention acute coronary syndromes hypothermia for stemi acute coronary syndromes prognostic value of barc bleeding in stemi heart rhythm disorders scd risk stratification in nidcm heart rhythm disorders ethanol-induced regional left atrial denervation cardiac imaging combined ct techniques to assess invasive ffr hypertension remodeling after renal denervation independent of hr and bp men_ .. rad sequencing yields a high success rate for westslope cutthroat and rainbow trout species-diagnostic snp assays s t e p h e n j . a m i s h , * p a u l a . h o h e n l o h e , † s a l l y p a i n t e r , * r o b b f . l e a r y , ‡ c l i n t m u h l f e l d , §¶ f r e d w . a l l e n d o r f * a n d g o r d o n l u i k a r t * ¶* * *fish and wildlife genomics group, division of biological sciences, university of montana, missoula, mt , usa, †department of biological sciences, university of idaho, moscow, id - , usa, ‡montana fish, wildlife & parks, university of montana, missoula, mt , usa, §u.s. geological survey, northern rocky mountain science center, glacier national park, west glacier, mt , usa, ¶flathead lake biological station, university of montana, polson, mt , usa, **cibio, centro de investigação em biodiversidade e recursos genéticos, universidade do porto, campus agrário de vairão, - vairão, portugal abstract hybridization with introduced rainbow trout threatens most native westslope cutthroat trout populations. understanding the genetic effects of hybridization and introgression requires a large set of high-throughput, diagnostic genetic markers to inform conservation and management. recently, we identified several thousand candidate single-nucleotide polymor- phism (snp) markers based on rad sequencing of westslope cutthroat trout and rainbow trout individuals. here, we used flanking sequence for of these candidate snp markers to design high-throughput genotyping assays. we vali- dated the assays on a total of individuals from populations and seven hatchery strains. forty-six assays ( %) ampli- fied consistently and allowed easy identification of westslope cutthroat and rainbow trout alleles as well as heterozygote controls. the snps will provide high power for early detection of population admixture and improved identification of hybrid and nonhybridized individuals. this technique shows promise as a very low-cost, reliable and relatively rapid method for developing and testing snp markers for nonmodel organisms with limited genomic resources. keywords: conservation genomics, hybridization, introgression, invasive species, microfluidic pcr, salmonids, snp, trout species identification received november ; revision received february ; accepted february introduction rainbow trout (rbt; oncorhynchus mykiss), the most widely introduced salmonid in the world (lever ), produce fertile offspring when crossed with cutthroat trout (o. clarkii), and introgression often continues until a hybrid swarm is formed and the native cutthroat genomes are lost (allendorf & leary ). a major consequence of such interspecific hybridization may be outbreeding depression because of the break-up of co-adapted gene complexes and disruption of local adap- tations (allendorf et al. ; muhlfeld et al. ). introgression poses a serious threat to all subspecies of cutthroat trout in western north america owing to wide- spread stocking of rainbow trout and invasion by rainbow trout and hybrids into historical cutthroat trout habitats. currently, range-wide estimates of hybridization in many of the cutthroat trout subspecies and popula- tions are incomplete. westslope cutthroat trout (wct; oncorhynchus clarkii lewisi), the most widely distributed subspecies of cutthroat trout, historically occupied aqua- tic habitats throughout the columbia, fraser, missouri and hudson bay drainages of the united states and can- ada (behnke ). however, nonhybridized populations are estimated to persist in < % of their historical range (shepard et al. ). while over half of the population genetic samples in shepard et al. ( ) found no evi- dence of admixture, only % had enough individuals sampled to detect % admixture at the % level of confi- dence. as a result, only % of the population genetic samples showed no evidence of admixture (< %) with a high degree of confidence. markers detecting low amounts of admixture in popu- lations and individuals will provide an understanding of the mechanisms causing the spread of hybridization, help protect nonhybridized populations from invasion, and aid in identifying nonhybridized populations suitable as sources for hatchery brood stocks or other conservation actions (allendorf et al. ). besides estimates of correspondence: steve amish, fax: - - ; e-mail: stephen.amish@umontana.edu � blackwell publishing ltd molecular ecology resources ( ) , – doi: . /j. - . . .x individual or population levels of admixture, the distri- bution and the frequency of introgressed genotypes within a population or sample can illuminate the dura- tion and extent of hybridization (jiggins & mallet ). for example, a bimodal distribution is thought to result from selection against intermediate genotypes or assorta- tive mating between the species (jiggins & mallet ; weigel et al. ). currently, the number of available species-diagnostic loci for addressing these questions in native cutthroat trout and rainbow trout is limited. the development of additional species-diagnostic genotyping assays and high-throughput snp genotyping systems will provide increased power for detecting hybridization at the individual level and more precisely estimating the structure of hybrid zones. currently, – diagnostic microsatellite markers are often used to detect cutthroat and rainbow trout hybridization at the population level. if we assume that each marker sorts independently, there is no linkage disequilibrium affect- ing the markers, and if genotypes are distributed accord- ing to hardy–weinberg ratios (i.e. the samples are representative of a breeding aggregation or population), then we can calculate the likelihood of failing to detect a single rbt allele in any given fish or in a sample of unre- lated fish using binomial probability (rasmussen et al. ). the probability of detecting % hybridization in a population with % certainty and individual samples requires only eight independent diagnostic markers. in contrast, to detect % admixture in an individual with % certainty will require independent diagnostic markers (table ). similarly, an increase in the number of diagnostic markers will also improve our ability to differ- entiate between parental back-crosses and later genera- tion hybrid crosses. recently, we identified a large set of candidate diag- nostic snps using restriction-site-associated dna (rad) sequencing (hohenlohe et al. ). briefly, we sequenced a single rad library (baird et al. ; etter et al. a) created from fish [ wct, coastal rain- bow trout (o. m. mykiss, crt), and inland or redband rainbow trout (o. m. gairdneri, irt)] and applied strict fil- tering based on observed heterozygosity and deviations from hardy–weinberg equilibrium to remove homeolo- gous loci (paralogs resulting from the ancestral salmonid whole-genome duplication; lie et al. ). that analysis produced a total of rad markers at which there was a single candidate snp fixed between the two spe- cies, and no other polymorphism, within the informative -bp rad tag sequence (hohenlohe et al. ). here, we expand the list of candidate snp markers, and we use microfluidic pcr assays to verify a subset of them for high-throughput estimates of hybridization in trout. we chose to develop a bioinformatics pipeline for this pur- pose because of its cost-effectiveness and because the rainbow trout genome would subsequently be available for the development of additional markers. materials and methods in addition to the single-snp candidate markers from the study by hohenlohe et al. ( ), we identified candidate diagnostic snps in rad tags containing two putative fixed snps in the -bp sequence (an additional markers) and those containing one putative fixed snp and one additional site polymorphic within one of the taxa (an additional markers). we aligned the total set of rad tag sequences against a published database of rainbow trout sequence contigs (sanchez et al. ) using the program bowtie (langmead et al. ). we allowed up to three mismatches between the wct or the crt and the reference sequence. the data set from the study by sanchez et al. ( ) contained contigs ranging in size from to bp, produced by sequencing of a reduced representation genomic library in rainbow trout. a total of ( . %) of our candi- date rad tags aligned against one or more of the contigs from the study by sanchez et al. ( ) with at least bp of flanking sequence on either side of the diagnostic snp. ten of these loci were dropped after preliminary data suggested one of the primers or probes was not amplify- ing. sequences for the remaining candidate markers were submitted to kbioscience for the design of kaspar snp genotyping assays. a total of individuals from populations and seven hatchery strains plus two heterozygous positive controls (f s) were then used to validate the assays on fluidigm . microfluidic pcr chips. the individuals included two cutthroat trout species, wct and yct (yel- lowstone cutthroat trout, o. c. bouvieri), as well as irt and crt (table ). all samples came from putatively nonhybridized populations, based on a current panel of seven diagnostic microsatellite loci and seven indel loci, table the likelihood of detecting a single rbt allele in any given fish or in a population of unrelated fish using binomial probability for a number of independent species-diagnostic loci, samples and percent hybridization number of markers number of samples %hybridization probability of detection . . . . . . . . . . � blackwell publishing ltd s . j . a m i s h e t a l . except for fish from lake koocanusa, which appear to have both a crt and irt genetic component (r. leary, personal communication), and the south fork of the jocko river, which appear to have a crt component. wct samples included two year classes from the washoe park state trout hatchery, anaconda montana, and samples from wild populations, including three populations from the missouri river basin east of the continental divide. yct samples were from the yellow- stone river state trout hatchery, big timber, montana, and a population in slough creek. irt samples were from two populations in the kootenai river drainage in montana. crt were taken from hatchery stock from across the country to account for the multitude of poten- tial sources used currently and historically for stocking. results forty-six of fifty-six assays ( %) were diagnostic for the identification wct, rbt and hybrids (table ). an assay was considered diagnostic if both heterozygous positive controls showed separation from the homozygous genotype clusters and > % of samples had concordant genotypes (i.e. genotype agreed with expectation estab- lished by earlier microsatellite ⁄ indel data). eight of ten assay failures were attributed to the design process, including poor quality or inadequate sequence data being used to design the assay (e.g. using sequence from a paralogous region or sequence containing errors) or errors in the primer or probe design and manufacture process. these failures included three assays where one or both probes did not amplify, and one assay appears to have amplified a homeolog. in fact, this locus had an elevated depth of sequence reads in the original rad sequencing run, in the th percentile among the fixed single-snp candidate markers (hohenlohe et al. ), consistent with the interpretation that it represents two incorrectly assembled homeologs. given a total of assays for detecting rbt and wct hybridization and four samples from a population, we have a . % probability of detecting % introgression in a hybrid swarm. in an individual fish, we have a % probability of detecting > . % introgression with the same number of assays (table ). however, very low table location name, species, whether the fish is of wild or hatchery origin, and the number of samples, basin and subbasin information for the screening panel used to validate species-diagnostic assays. species are labelled as westslope cutthroat trout (wct), yellowstone cutthroat trout (yct), inland or redband rainbow trout (irt), and coastal rainbow trout (crt) location name species wild ⁄ hatchery n basin subbasin anaconda, mt wct h na* na big foot creek wct w columbia upper kootenai copper creek wct w columbia flint-rock cottonwood creek wct w columbia lower flathead davis creek wct w columbia bitterroot flat creek wct w columbia upper kootenai gillispie creek wct w columbia flint-rock hawk creek wct w columbia n. f. flathead humbug creek wct w columbia blackfoot mcginnis creek wct w columbia lower clark fork morrison creek wct w columbia middle flathead ringeye creek wct w columbia blackfoot runt creek wct w columbia yaak s. fork jocko wct w columbia lower flathead six mile creek wct w columbia middle clark fork werner creek wct w columbia n. f. flathead bear creek wct w missouri red rock mcclellan creek wct w missouri upper missouri mcvey creek wct w missouri big hole big timber, mt yct h na na slough creek yct w missouri yellowstone lake koocanusa, bc irt w columbia yaak yahk river, bc irt w columbia yaak abbot creek crt w columbia middle flathead arlee, mt crt h na na eagle lake, ca crt h na na mcconaughy, ne crt h na na fish lake, ut crt h na na erwin ⁄ arlee cross, tn crt h na na *basin and subbasin designations were not made for hatchery stocks. � blackwell publishing ltd t r o u t s p e c i e s - d i a g n o s t i c s n p s f r o m r a d s e q u e n c i n g t a b le s e q u e n ce in fo rm a ti o n fo r th e v a li d a te d a ss a y s. t h e n u m b e r o f a d d it io n a l v a ri a b le si te s in th e r a d ta g a n d th e re fe re n ce se q u e n ce a re li st e d , a lo n g w it h th e ca ll ra te (% o f sa m p le s a ss ig n e d to a g e n o ty p e cl u st e r) a n d th e ca ll co n co rd a n ce (% o f sa m p le s a ss ig n e d to th e co rr e ct cl u st e r) . s e q u e n ce s g iv e n a re fo r th e k b io sc ie n ce s k a s p a ss a y fo rm a t. r b t se q u e n ce n a m e is th e ra in b o w tr o u t re fe re n ce se q u e n ce (s a n ch e z et al . ) fr o m th e r a d lo ci a li g n m e n ts u se d fo r fl a n k in g se q u e n ce in th e s n p a ss a y d e si g n a ss a y n a m e a d d it io n a l v a ri a b le s it e s s n p n % c a ll ra te % c o n co r- d a n ce s e q u e n ce ( ¢- ¢) r a d g e n b a n k a cc e ss io n n o . r b t r e f s e q u e n ce g e n b a n k t ra ce a rc h iv e n o . r a d t a g r e f s e q p ri m e r f a m a ll e le p ri m e r v ic a ll e le c o m m o n p ri m e r r b t w c t o m y _ r a d _ _ a ⁄c . . g t c a g t a g g a g g t g c t a t t g a g a t c a g t a g g a g g t g c t a t t g a g c g c c t g c a g g c t g t c c a g t a g t t jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄a . . t g g g c t g t g t g a g a g a c a g a g a t g g g c t g t g t g a g a g a c a g a g t a c a c c t g c a g g g c c t g t c t g a a jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄c . . t t c c t g t g t a a a g c a g t g g t g g a c t t c c t g t g t a a a g c a g t g g t g a g t g c t c g t a c c a t c c a c c g t c a a jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄g . . g g a g c a a a g c a t t a a a a g t g t g c t g a t g g a g c a a a g c a t t a a a a g t g t g c t t g t t g t t g a t g a g c c a g g g t c t g t t t jq jq g n l| ti | _ o m y _ r a d _ _ a ⁄t . . t t a a t a a t c a c t a c a t t t c a c a t a g a a t t g c t t t t a a t a a t c a c t a c a t t t c a c a t a g a a t t g c t a g c t t a g a t t g t a t a t t c t g c t g c t a g g t t jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄t . . g c t g c t c t g c t g a c g g t t c c t g c t c t g c t g a c g g t t a g g t t g a a c t g g a c g a g c c g g a a jq jq g n l| ti | _ o m y _ r a d _ _ a ⁄g . . c t g t t c a g g g t g a t g a t g c t g t c t g t t c a g g g t g a t g a t g c t g c c a g g a t g a g g g t t g - c c t g g t c a t jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄g . . g a a c t t t g c t g g g c a t g t g g g g a a c t t t g c t g g g c a t g t g g t t g c a c g g a t a a c a t g g t c t t t g a t a a c t t jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . c c c a c g g g a t a c t g g g t g c c c c a c g g g a t a c t g g g t a c c t g c a g g a g c t g g t c a g c t a t jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . t c c t g c a g g g t g t c g g c g c t c c t g c a g g g t g t c g g c a c g c t t t a a a c a g c t g g t g g a c a g t a jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄a . . a t g c a c a c c a c t g c a t c c a g a t a t g c a c a c c a c t g c a t c c a g a c c t a c t g t t a c a a c c t g c a g g a g c t a jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . g g t a g a t t t c c g a c g t a a a t a c g g g g t a g a t t t c c g a c g t a a a t a c g a g a g g c c c t g c a g g a a a t a a c g a t t jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄a . . g a t g t g t g g c t g t t g g t c a a c c a a t g t g t g g c t g t t g g t c a a c c g g c a a g a c c c t c a g a a t c c t c t t c a a jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄t . . g t c g t t c t t c t g g c c c a g g a c t g t c g t t c t t c t g g c c c a g g a a g t c a g g c t c t g a c g g c c t a c t t jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . c c c g c c a g a t g g c c a g g c c c c g c c a g a t g g c c a g a c a t g g a g g a c c t g a g t g c t c t a a a jq jq g n l| ti | _ o m y _ r a d _ _ a ⁄c . . g g t c t g t c c c c c t g t c c g t t c t g t c c c c c t g t c c g g g c a g t g t g a c c c t g c a g g a c a jq jq g n l| ti | _ � blackwell publishing ltd s . j . a m i s h e t a l . t a b le (c o n ti n u e d ) a ss a y n a m e a d d it io n a l v a ri a b le s it e s s n p n % c a ll ra te % c o n co r- d a n ce s e q u e n ce ( ¢- ¢) r a d g e n b a n k a cc e ss io n n o . r b t r e f s e q u e n ce g e n b a n k t ra ce a rc h iv e n o . r a d t a g r e f s e q p ri m e r f a m a ll e le p ri m e r v ic a ll e le c o m m o n p ri m e r r b t w c t o m y _ r a d _ _ c ⁄t . . a t t c t a g a t t c t a g a c a c a t g a c t c c a t t c t a g a t t c t a g a c a c a t g a c t c t t a a t t c a a c t a g c g g t g t g t t g t g t t g t a jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄c . . a t a a t a a g a t c a t g c a a c a g t a a g t g t t t g a t a a t a a g a t c a t g c a a c a g t a a g t g t t t c a t g c c c c t g c a g g c a a g c c a t t jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄c . . g a a c c c a c c c a t t t c a g t g g a c g a a c c c a c c c a t t t c a g t g g a t t t c c t g g g t g a a g t a g g g g a t t g a a jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄c . . a a c c c t c c a t t c g t c a c a t t t a a c c c a a c c c t c c a t t c g t c a c a t t t a a t c t c t t c t a t c t t g t t g a c g t c g a c c t t jq jq g n l| ti | _ o m y _ r a d _ _ a ⁄c . . t g g g t a a t c a c g a g g g t a c a t c t g g t a a t c a c g a g g g t a c a t c g c g t c c a g a g g a g c c a a t g g c a t jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄t . . t c a c a g t a g t c a a c a c t g t g c a g a c t c a c a g t a g t c a a c a c t g t t g t c c t g t t t g t t c a t c t g g t c t c c a a jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄c . . g g t g a a a g t a c a g g t a g c g c t t g a g g t g a a a g t a c a g g t a g c g c t t a a a c a g c t t a c a c c c a g a g c t g c t t jq jq g n l| ti | _ o m y _ r a d _ _ a ⁄g . . a t c t g t t g a c t c c c t c t c c t c t a t c t g t t g a c t c c c t c t c c t c c t t t a c c a g g c g g t g c g g c a g t t jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄c . . t g a a g a a g c c g g a t g t g g a g g t g a a g a a g c c g g a t g t g g a g a c t c a c a a g c g c a g t t c g c a t g t a a jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄a . . g c a g g a t t c a g t c a a g a g c c c t c a g g a t t c a g t c a a g a g c c c c t g t g g a c a a g a t c a g g a c a c g t g t t jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . t g a a g a a g c c g g a t g t g g a g g t g a a g a a g c c g g a t g t g g a g a c t c a c a a g c g c a g t t c g c a t g t a a jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . a g g t c c a t c a a g t c a a a g g c g c c a g g t c c a t c a a g t c a a a g g c a g t g g a t g a c c a c c t g c a g g a c a a jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄g . . a g g g a t g a g a c t c c t c t g a a c c a g g g a t g a g a c t c c t c t g a a g t c t t c c t g c t g c t g a t g t t g c t g t t jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄c . . t c t g c c a g t c t g t c a g g t c g c t c t g c c a g t c t g t c a g g t c a g a t g c t g t g t g g - g a t g c a g g a g a t jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄t . . g t c t t t g t t g g a a t t t a t t g c c a t a t t c t c t t t g t t g g a a t t t a t t g c c a t a t t a a t a t c t c a c c t g c a g g t t t a a g t a c c a a a jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄g . . t a t c g g g t a c c t g c a g g t g a c t a t c g g g t a c c t g c a g g t g a g g c c t t g a c a g t a c a a c a g g c a c t t t jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄t . . a a c t c c a c a a g g t c a g a g g t a a c a a c t c c a c a a g g t c a g a g g t a a a c t a c t c t g c c g a c a t c c t a t c a g a a jq jq g n l| ti | _ � blackwell publishing ltd t r o u t s p e c i e s - d i a g n o s t i c s n p s f r o m r a d s e q u e n c i n g t a b le (c o n ti n u e d ) a ss a y n a m e a d d it io n a l v a ri a b le s it e s s n p n % c a ll ra te % c o n co r- d a n ce s e q u e n ce ( ¢- ¢) r a d g e n b a n k a cc e ss io n n o . r b t r e f s e q u e n ce g e n b a n k t ra ce a rc h iv e n o . r a d t a g r e f s e q p ri m e r f a m a ll e le p ri m e r v ic a ll e le c o m m o n p ri m e r r b t w c t o m y _ r a d _ _ c ⁄t . . g g t g a a t t c g g t g t t g t c t g c c g g t g a a t t c g g t g t t g t c t g t g a g t c t c a t c c c t g c a g g g c t t jq jq g n l| ti | _ o m y _ r a d _ _ a ⁄c . . a a c a c c g a t a t a c a t a a a t g t g c t g t a a c a c c g a t a t a c a t a a a t g t g c t g g g a c t c a g c c t g c a g g g g t c a t a jq jq g n l| ti | _ o m y _ r a d _ _ t ⁄c . . t g g t c a a t g c c a t t a t c a a c a g c c t g g t c a a t g c c a t t a t c a a c a g t c t c a c a g t a c c a g c a c g a c c a a t a jq jq g n l| ti | _ o m y _ r a d _ _ a ⁄t . . t g g a c t c a a a c a g a t c c a a t a a c t a c t g g a c t c a a a c a g a t c c a a t a a c a g g t a c t t c t g t g a a a a c c a t t t g t g t g a a jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄a . . g t a c c t g c a g g g a a a g c t a c t c t t a c c t g c a g g g a a a g c t a c t c g g g a t c c a c c a g t g t g t a t g t g t a g t t jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . g t c a g t t t t c c t t g t c a g g c t c c t t g t c a g t t t t c c t t g t c a g g c t c t g t c g a a g t c t g c c t c a a c c a c a a t a jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄a . . g a g g c c t t a c a g a t t g a t t g c a c a a g g c c t t a c a g a t t g a t t g c a c g g g c a c a g c a g a a g a c c a a t t t c c a t jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄g . . g g a g g a a c c t g c a g g t g g c g a g g a a c c t g c a g g t g g g a a a g t c a g t t a a c t a c a c t a c a g a c c a a t t jq jq g n l| ti | _ o m y _ r a d _ _ a ⁄g . . c c a c a g c g a c c c c a t c g a a c c a c a g c g a c c c c a t c g a g g g t c a a a t g t c a g g g t t a a t c a g a a g t a jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . t c t t a c c a c g a g c t c a g g g a c t c t t a c c a c g a g c t c a g g g a t g c t g g a t c t c a t g g t g g t c c a g a t jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄t . . a g g t g g t g c c a g g a c a g g g c a a g g t g g t g c c a g g a c a g g t c c a g a t c c a g g c c t g c a g g t a a jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . t t g g a g c g g t a c t c t t t c a g g c t t g g a g c g g t a c t c t t t c a g a g g a g t c c c t g c a g g c c a a t g t a jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄a . . t g t g c t g c a g c c c a c a t c a g a a t g c t g c a g c c c a c a t c a g a g t t a a c c t g c a g g a t g a g g a a g g c t t jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄a . . g t c t g t a g c a t a t a c t a t g t t g t c c t t c t g t a g c a t a t a c t a t g t t g t c c c c c t g t c t g g g a a t a a c a g c c g t a t a jq jq g n l| ti | _ o m y _ r a d _ _ c ⁄t . . a c c t c g t c c t g c a g g t c t g c c a c c t c g t c c t g c a g g t c t a c c c t g c t c g a c c c g t g t c t a jq jq g n l| ti | _ o m y _ r a d _ _ a ⁄c . . t g t g t t a c a g c t g c g g g t c c t t t g t t a c a g c t g c g g g t c c t g g g t c a g g c t g c a g t g g a g g a a a jq jq g n l| ti | _ o m y _ r a d _ _ g ⁄t . . g a g c c g t c c t t c a g g a a t c g c a g a g c c g t c c t t c a g g a a t c g a c t g c a g g a g a g g g a g g g g c t t jq jq g n l| ti | _ � blackwell publishing ltd s . j . a m i s h e t a l . levels of introgression will still be difficult to detect at the individual level. our probability of detecting % intro- gression in a fish using markers is only %. because our preliminary screening panel was com- posed of a few individuals from many populations instead of many individuals from a few populations, we have little power to detect alleles at low frequency in these populations. thus, we cannot exclude the possibil- ity that some of the diagnostic markers may share a low-level polymorphism between wct and rbt. in species-diagnostic assays, individuals with genotypes indicative of low-level polymorphisms or rbt hybridiza- tion were detected. the snp from rad_ was not diagnostic in our screening panel. one individual was homozygous for the ‘rbt allele’ at this locus, and others were heterozygotes. these individuals, however, did not possess any other genotypes at the other loci analysed indicative of hybridization. thus, this locus appears to be polymorphic in wct. wct from north- western montana or south-eastern british columbia were heterozygous in five additional assays, and the level of introgression in these populations is uncertain due in part to the potential presence of irt alleles (table s ). fish from lake koocanusa may have low levels of intro- gression from crt or wct. in the fish from yaak, bc and runt creek, these polymorphisms may represent natural levels of introgression between the sympatric wct and irt populations. in five of the remaining six assays, the heterozygous fish came from hatchery popu- lations. because hatchery brood stock samples have been extensively screened for admixture using indels and mi- crosatellites, it is most likely that these alleles represent shared low-level polymorphisms between wct and rbt. testing of additional samples will be required to determine their frequency and the usefulness of the assays for species identification and admixture analysis. discussion our conversion rate of % for diagnostic assays suggests that rad sequencing offers a reliable and relatively quick and inexpensive way to generate large numbers of snp markers that does not require a large screening panel (e.g. seeb et al. ). conversion rates can vary widely and depend on the variability and divergence of the tar- get species, the number of samples sequenced before designing the assays, whether the snp is in a conserved or highly variable region (e.g. diagnostic between species or polymorphic within species) and on the number and extent of samples used to validate the assay. new sample library protocols and next-generation sequencing tech- niques like rads promise to make very low-cost marker development available for most organisms (pennisi ) even when no genomic resources are available. the development of additional species-diagnostic genotyping assays provides increased power for detecting hybridization at the individual level and more precisely estimating the structure of hybrid zones. with the addi- tion of our assays to the previously available snps (finger et al. ; mcglauflin et al. , harwood & phillips ; kalinowski et al. ), the number of cur- rently available diagnostic snps between wct and rbt has increased to . with diagnostic snps, we can detect . % introgression with % certainty at the indi- vidual level. our probability of detecting % introgression in a fish using markers is only %, reaching % with markers (table ). the ability to detect low levels of hybridization at the individual level increases sampling scheme flexibility, removing the requirement that aggre- gations of - samples be considered a population. we developed a bioinformatic pipeline using publicly available reads (sanchez et al. ) for identifying flanking sequence required for assay design that will be eas- ily applied to the rainbow trout genome sequence when it is published (miller et al. ). this reduced our set of candi- date loci from to ( . %). at the time of this experi- ment, using sequencing to produce reads > -nt reads required for snp assay development was beyond our bud- get. the reference genome sequence will allow assay design for most of the snps identified in our rad loci. an alternative approach to using published long read sequence data is to generate longer contiguous sequence reads at each rad tag using over-lapping paired-end sequencing (etter et al. b). this technique holds great promise for allowing assay design on the full set of candi- date snp markers for any species. in addition, this approach should have a higher validation rate, because snp detection and flanking sequence would come from the same individuals and populations. rad sequencing is one of a family of approaches applying high-throughput sequencing to a reduced rep- resentation of a genome to identify and genotype large numbers of snp markers in organisms without substan- tial genetic resources (cosart et al. ; davey et al. ). next-generation sequencing approaches require slightly more bioinformatic effort compared with tradi- tional marker discovery, but a number of publicly avail- able tools are being developed to handle these types of data (catchen et al. ; davey et al. ). one advan- tage of rad over related restriction-enzyme-reduced representation sequencing techniques in taxa with com- plex, repetitive genomes is that the set of markers does not depend on a fragment size selection step, so that it is more consistent across libraries (davey et al. ). this helps reduce variation between runs and allows the com- pilation and re-analysis of large sequence databases across related species, populations and individuals gen- erated using the same rad library technique. we con- � blackwell publishing ltd t r o u t s p e c i e s - d i a g n o s t i c s n p s f r o m r a d s e q u e n c i n g clude that the emerging techniques for the generation and analysis of rad sequencing data provide a relatively quick and cost-effective method for the identification of large numbers of species-diagnostic snps. acknowledgements pah was supported by nih cobre grant p rr (l. forney, pi). funding was provided in part by the great northern landscape conservation cooperative (us department of interior). any use of trade, product or firm names is for descriptive purposes only and does not imply endorsement by the u.s. government. this research was conducted in accordance with the animal welfare act and its subsequent amendments. gl & fwa were supported by nsf deb . references allendorf fw, leary rf ( ) conservation and distribution of genetic variation in a polytypic species, the cutthroat trout. conservation biol- ogy, , – . allendorf fw, leary rf, spruell p, wenburg jk ( ) the problems with hybrids: setting conservation guidelines. trends in ecology and evolu- tion, , – . allendorf fw, leary rf, hitt np, knudsen kl, lundquist ll, spruell p ( ) intercrosses and the u.s. endangered species act: should hybridized populations be included as westslope cutthroat trout? conservation biology, , – . baird na, etter pd, atwood ts et al. ( ) rapid snp discovery and genetic mapping using sequenced rad markers. plos one, , e . behnke rj ( ) trout and salmon of north america. simon and schuster, new york. catchen jm, amores a, hohenlohe pa, cresko wa, postlethwait jh ( ) stacks: building and genotyping loci de novo from short-read sequences. g genes genomes genetics, , – . cosart t, beja-pereira a, chen s, ng sb, shendure j, luikart g ( ) exome-wide dna capture and next generation sequencing in domestic and wild species. bmc genomics, , . davey jw, hohenlohe pa, etter pd, boone jq, catchen jm, blaxter ml ( ) genome-wide genetic marker discovery and genotyping using next-generation sequencing. nature reviews genetics, , – . etter pd, bassham s, hohenlohe pa, johnson ea, cresko wa ( a) snp discovery and genotyping for evolutionary genetics using rad sequencing. in: molecular methods for evolutionary genetics (eds orgog- ozo v & rockman mv), pp. – . humana press, new york. etter pd, preston jl, bassham s, cresko wa, johnson ea ( b) local de novo assembly of rad paired-end contigs using short sequencing reads. plos one, , e . finger aj, stephens mr, clipperton nw, may b ( ) six diagnostic sin- gle nucleotide polymorphism markers for detecting introgression between cutthroat and rainbow trout. molecular ecology resources, , – . harwood as, phillips rb ( ) a suite of twelve single nucleotide poly- morphism markers for detecting introgression between cutthroat and rainbow trout. molecular ecology resources, , – . hohenlohe p, amish sj, catchen jm, allendorf fw, luikart g ( ) rad sequencing identifies thousands of snps for assessing hybridiza- tion in rainbow and westslope cutthroat trout. molecular ecology resources, , – . jiggins cd, mallet j ( ) bimodal hybrid zones and speciation. trends in ecology and evolution, , – . kalinowski st, novak bj, drinan dp, jennings r, vu nv ( ) diagnos- tic single nucleotide polymorphisms for identifying westslope cutthroat trout (oncorhynchus clarki lewisi), yellowstone cutthroat trout (oncorhynchus clarkii bouvieri) and rainbow trout (oncorhynchus mykiss). molecular ecology resources, , – . langmead b, trapnell c, pop m, salzberg sl ( ) ultrafast and mem- ory-efficient alignment of short dna sequences to the human genome. genome biology, , r . lever c ( ) naturalized fishes of the world. academic press, san diego, california, usa. lie Ø, slettan a, lingaas f, olsaker i, hordvik i, refstie t ( ) haploid gynogenesis: a powerful strategy for linkage analysis in fish. animal biotechnology, , – . mcglauflin mt, smith mj, wang jt et al. ( ) high-resolution melting analysis for the discovery of novel single-nucleotide polymorphisms in rainbow and cutthroat trout for species identification. transactions of the american fisheries society, , – . miller mr, brunelli jp, wheeler pa et al. ( ) a conserved haplotype controls parallel adaptation in geographically distant salmonid popula- tions. molecular ecology, , – . muhlfeld cc, kalinowski st, mcmahon te et al. ( ) hybridization rapidly reduces reproductive success of a native trout in the wild. biol- ogy letters, , – . pennisi e ( ) using dna to reveal a mosquito’s history. science, , – . rasmussen jb, robinson md, heath dd ( ) ecological consequences of hybridization between native westslope cutthroat (oncorhynchus clarkii lewisi) and introduced rainbow (oncorhynchus mykiss) trout: effects on life history and habitat use. canadian journal of fisheries and aquatic sciences, , – . sanchez cc, smith tpl, wiedmann rt et al. ( ) single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library. bmc genomics, , – . seeb je, carvalho gr, hauser l, naish ka, roberts sb, seeb lw ( ) single-nucleotide polymorphism (snp) discovery and applications of snp genotyping in nonmodel organisms. molecular ecology resources, , – . shepard bb, may be, urie w ( ) status and conservation of westslope cutthroat trout within the western united states. north american journal of fisheries management, , – . weigel de, peterson jt, spruell p ( ) the distribution of introgressive hybridization between westslope cutthroat trout and rainbow trout in the clearwater basin, idaho. ecological applications, , – . sja, pah, rfl, gl conceived and designed the project. rfl, cm supplied the samples. sja, sp, pah analyzed the data. sja, pah, rfl, cm, fwa, gl wrote the paper. data accessibility snp genotypes have been deposited at dryad: doi: . /dryad.b s . supporting information additional supporting information may be found in the online version of this article. table s the sample location and number, rad locus, species and number of heterozygous genotypes (hets) are reported from the validated assays. please note: wiley-blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. any queries (other than missing material) should be directed to the corresponding author for the article. � blackwell publishing ltd s . j . a m i s h e t a l . book reviews breeding. however, in a final chapter (chapter ), these aspects of gamete and embryo manipulation are briefly considered in the frame of 'the future of micromanip- ulation and assisted reproduction' and this i consider to be a mistake. it seems unwise to give cursory coverage of such important issues without the proper sensitivity towards the dangers of the manipulation of human eggs and embryos and the social and ethical implications. for example, a page is given to transgenesis in the human and a paragraph to describe the approach to possible injection of genes into human egg nuclei without any consideration of the need or practicality of such genetic interference or the dangers inherent in this approach (inappropriate temporal and spatial expression, insertional mutation, disturbed patterns of inheritance, and the permanence of unforseeable conse- quences). to present gene transfer in the human simply as a technical possibility i think is misleading. it is true that scientists are not trained in ethics (although i consider it is time for ethics to be a compulsory part of scientific training and vice versa). however, i do think that scientists when reporting their work must make every effort to be sensitive to its social and ethical implications and to cover these aspects adequately. overall, i enjoyed reading this book. it is very nicely produced by raven press. i do not think it is of great interest to a general audience but it is a must for the library of every ivf laboratory and assisted concep- tion unit and for all those engaged in micro- manipulation in development with an inter- est in human reproduction. marilyn monk genetic diversity among jews: dis- eases and markers at the dna level. edited b bonne-tamir, a adam. (pp ; ,c .) oxford: oxford university press. . isbn - - - . for social, geographical, or religious reasons population isolates occur, and within these there can be an accumulation of deleterious genes. this has been well documented in the finns, the amish, and the jews. the study of these populations has taught us much about demographic influences on gene frequencies as well as the symptomatology and molecular pathology of a number of rare diseases. this well edited and comprehensive volume addresses such matters in regard to various jewish populations. demographic changes in world jewry are reviewed in a most fascinating opening chapter. from the time of claudius in the th century, when it has been estimated there were between five and eight million jews, the numbers have fluctuated considerably but with a progressive increase over the last years. moreover, the tendency for jews to marry within a community (so called beni- ni's index) has been progressively falling in recent years. furthermore, apart from israel, there has also been an increasing tendency for jews to marry non-jews who do not convert to judaism. the result of all these changes, if continued, will be to have a dilut- ing effect on the gene pool. the present volume is therefore welcome before these changes might possibly have any significant effect. the first part of the volume is concerned with polymorphisms (nuclear and mitochon- drial dna, hla, g pd). the next deals with mendelian disorders particularly preva- lent among ashkenazim (for example, various lipid storage disorders, dysautono- mia, adrenal hyperplasia iii) and non-ash- kenazim (for example, familial mediter- ranean fever). the final part addresses multifactorial diseases which may be particu- larly common in certain jewish communities, including coronary artery disease and idio- pathic inflammatory bowel diseases. this volume is dedicated to richard goodman md ( - ) who was profes- sor of human genetics at tel-aviv univer- sity and who contributed so much in various ways to medical genetics, but particularly to the study of genetic disorders among jews. richard was a personal friend of mine for nearly years and i know he would have been very proud to be associated with such a valuable work of scholarship. alan emery mendelian inheritance in man. th edition, volumes. victor a mckusick. ($ . .) baltimore: johns hopkins univer- sity press. . for a book to go through editions over a year period with the same author must be a rare event. for it to be increasingly valu- able with successive editions is even more unusual. mendelian inheritance in man has become such an essential part of both clinical practice and research in medical genetics that it must seem ungrateful, even disloyal, to criticise it, yet this tenth edition has shown up weaknesses that must be corrected if its future is to remain assured. these were already noted in reviewing the th edition, but are now even more prominent. the edition is produced for the first time in two volumes (a total of around pages compared with rather under for the previous edition). the preliminary section contains, as before, much interesting and valuable material, including citation indices, a table of numbers of genes mapped, a list of molecular defects in mendelian disorders, and detailed tables of mapped genes by chro- mosome, along with the renowned chromo- some maps of 'morbid anatomy' of the human genome. the detailed entries (auto- somal recessive and x linked disorders now occupy volume ) are remarkably up to date, and form a collection of notes and references on rare mendelian disorders that is quite unparalleled in its scope. so what is my criticism? quite simply it lies in what has not been removed in success- ive editions. the entries read increasingly as a series of geological strata, showing accre- tion but very little erosion. this has now reached the stage where it is difficult to find the statements and references that are either new, or old but standing the test of time, among a large mass of material that has become dated and, inevitably in some cases, incorrect. checking a number of entries shows that very little has in fact been removed, and it is this, rather than true growth in knowledge, that accounts for most of the increase in bulk. what can be done to remedy the situation? the answer is simple in principle, but will represent an onerous task for dr mckusick - perhaps even more so for his two assistants. they need to go through the text ruthlessly with a red pencil (or its computer equivalent) and firmly delete all the material that is irrelevant - i would judge about half of the total. if this can be done it will make the book (and its on line version) much more valuable, especially for students who can easily be confused by older material which has since been shown to be wrong. i suspect that a radical pruning may take two years' hard work, but i look forward then to seeing a slimmer and reinvigorated th edition - perhaps again in a single volume! peter s harper o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n a p ril . d o w n lo a d e d fro m http://jmg.bmj.com/ wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ practical consensus recommendations on duration of adjuvant hormonal therapy in breast cancer | semantic scholar skip to search formskip to main content> semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. doi: . /sajc.sajc_ _ corpus id: practical consensus recommendations on duration of adjuvant hormonal therapy in breast cancer @article{gupta practicalcr, title={practical consensus recommendations on duration of adjuvant hormonal therapy in breast cancer}, author={s. gupta and m. singh and a. vora and g. babu and m. walia and v. nautial and r. saha and b. smruti and j. sharma and r. koul and p. parikh and s. aggarwal}, journal={south asian journal of cancer}, year={ }, volume={ }, pages={ - } } s. gupta, m. singh, + authors s. aggarwal published medicine south asian journal of cancer optimization of adjuvant systemic therapy in women with early-stage hormone receptor-positive breast cancer includes the consideration of chemotherapy and duration of hormone therapy. adjuvant hormonal therapy significantly improves long-term survival of breast cancer patients with hormone receptor-positive disease. despite the proven clinical efficacy of tamoxifen and aromatase inhibitors, many breast cancer survivors either fail to take the correct dosage at the prescribed frequency… expand view on wolters kluwer ncbi.nlm.nih.gov save to library create alert cite launch research feed share this paper citations view all tables and topics from this paper table table table mammary neoplasms tamoxifen hormone therapy pharmaceutical adjuvants systemic therapy american society of clinical oncology conflict (psychology) aromatase inhibitors scientific publication one citation citation type citation type all types cites results cites methods cites background has pdf publication type author more filters more filters filters sort by relevance sort by most influenced papers sort by citation count sort by recency breast cancer demographics, types and management pathways: can western algorithms be optimally used in eastern countries? s. chakraborty, t. wadasadawala, r. ahmed, c. coles, s. chatterjee medicine clinical oncology (royal college of radiologists (great britain)) save alert research feed references showing - of references sort byrelevance most influenced papers recency duration of adjuvant tamoxifen therapy. j. bryant, b. fisher, j. dignam medicine journal of the national cancer institute. monographs pdf save alert research feed american society of clinical oncology technology assessment on the use of aromatase inhibitors as adjuvant therapy for postmenopausal women with hormone receptor-positive breast cancer: status report . e. winer, c. hudis, + authors m. somerfield medicine journal of clinical oncology : official journal of the american society of clinical oncology save alert research feed adherence to endocrine therapy for breast cancer r. chlebowski, michelle l geller medicine oncology save alert research feed switching to anastrozole versus continued tamoxifen treatment of early breast cancer: preliminary results of the italian tamoxifen anastrozole trial. f. boccardo, a. rubagotti, + authors p. sismondi medicine journal of clinical oncology : official journal of the american society of clinical oncology pdf save alert research feed five versus more than five years of tamoxifen therapy for breast cancer patients with negative lymph nodes and estrogen receptor-positive tumors. b. fisher, j. dignam, + authors h. l. lickley medicine journal of the national cancer institute pdf save alert research feed adherence to adjuvant endocrine therapy in postmenopausal women with breast cancer. v. ziller, m. kalder, + authors p. hadji medicine annals of oncology : official journal of the european society for medical oncology save alert research feed use of tamoxifen for breast cancer: twenty-eight years later. i. jaiyesimi, a. buzdar, d. decker, g. hortobagyi medicine journal of clinical oncology : official journal of the american society of clinical oncology save alert research feed switching of postmenopausal women with endocrine-responsive early breast cancer to anastrozole after years' adjuvant tamoxifen: combined results of abcsg trial and arno trial r. jakesz, w. jonat, + authors m. kaufmann medicine the lancet save alert research feed randomized trial of two versus five years of adjuvant tamoxifen for postmenopausal early stage breast cancer. swedish breast cancer cooperative group. medicine journal of the national cancer institute save alert research feed effects of chemotherapy and hormonal therapy for early breast cancer on recurrence and -year survival: an overview of the randomised trials early breast cancer trialists' collaborative group medicine the lancet , pdf save alert research feed ... ... related papers abstract tables and topics citations references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue with program directors in nigms to determine the most appropriate support mechanism for their collaborative work. term/amount: nigms intends to commit up $ - million in total costs in fy to fund both phase i and phase ii awards. nigms anticipates funding up to ten phase i awards; each phase i award will be for $ , in direct costs. two to three phase ii grants will be awarded. because the nature and scope of the proposed research will vary, it is anticipated that the size of the phase ii awards also will vary, and the upper limit for a phase ii award will be $ million per year in annual direct costs. applications of different scales and scope are encouraged. although the financial plans of nigms provide support for this pro- gram, awards pursuant to this rfa are contingent upon the availability of funds and the receipt of a sufficient number of meritorious applications contact: the rfa label available in the phs (rev. / ) application form must be affixed to the bottom of the face page of the application. type the rfa number on the label. failure to use this label could result in delayed processing of the application such that it may not reach the review committee in time for review. in addition, the rfa title and number must be typed on line of the face page of the application form and the yes box must be marked. the sample rfa label available at: http://grants.nih.gov/ grants/funding/phs /label-bk.pdf has been modified to allow for this change. please note this is in pdf format. submit a signed, typewritten original of the application (phase i or phase ii), including the checklist, and three signed, photocopies, in one package to: center for scientific review national institutes of health rockledge drive, room , msc bethesda, md - bethesda, md (for express/courier service). direct inquiries regarding programmatic issues to: dr. michael e. rogers division of pharmacology, physiology and biological chemistry national institute of general medical sciences center drive, msc bethesda, md - telephone: ( ) - fax: ( ) - email: rogersm@nigms.nih.gov deadline: phase i application receipt date: june , . phase ii application receipt date: january , . errata in abstract , “back to basics: utility of peripheral smears in residency training,” on page a of the january issue of jim, the name of the first author, amish desai, was inadvertently left out. the authors apologize for the omission. in the january issue of jim, seven abstracts from the southern society of general internal medicine were inadvertantly left out. these abstracts are printed in this issue of jim on the following pages. the publisher regrets the error. journal of investigative medicine • vol. , no. , may o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jim .b m j.co m / j in ve stig m e d : first p u b lish e d a s . / . . o n d e ce m b e r . d o w n lo a d e d fro m http://jim.bmj.com/ cxcr /cxcl mediate autocrine cell- cycle progression in nf -associated malignant peripheral nerve sheath tumors cxcr /cxcl mediate autocrine cell- cycle progression in nf -associated malignant peripheral nerve sheath tumors wei mo, jian chen, amish patel, liang zhang, vincent chau, , yanjiao li, woosung cho, kyun lim, jing xu, alexander j. lazar, chad j. creighton, svetlana bolshakov, renée m. mckay, dina lev, lu q. le, ,* and luis f. parada ,* department of developmental biology department of dermatology department of cell biology university of texas southwestern medical center, dallas, tx - , usa department of pathology department of cancer biology university of texas md anderson cancer center, houston, tx , usa division of biostatistics, dan l. duncan cancer center, baylor college of medicine, houston, tx , usa *correspondence: lu.le@utsouthwestern.edu (l.q.l.), luis.parada@utsouthwestern.edu (l.f.p.) http://dx.doi.org/ . /j.cell. . . summary malignant peripheral nerve sheath tumors (mpnsts) are soft tissue sarcomas that arise in connective tissue surrounding peripheral nerves. they occur sporadically in a subset of patients with neurofibro- matosis type (nf ). mpnsts are highly aggressive, therapeutically resistant, and typically fatal. using comparative transcriptome analysis, we identified cxcr , a g-protein-coupled receptor, as highly ex- pressed in mouse models of nf -deficient mpnsts, but not in nontransformed precursor cells. the che- mokine receptor cxcr and its ligand, cxcl , promote mpnst growth by stimulating cyclin d expression and cell-cycle progression through pi - kinase (pi k) and b-catenin signaling. suppression of cxcr activity either by shrna or pharmacolog- ical inhibition decreases mpnst cell growth in culture and inhibits tumorigenesis in allografts and in sponta- neous genetic mouse models of mpnst. we further demonstrate conservation of these activated molec- ular pathways in human mpnsts. our findings indi- cate a role for cxcr in nf -associated mpnst development and identify a therapeutic target. introduction the tumor predisposition disorder von recklinghausen’s neuro- fibromatosis type i (nf ) is one of the most common genetic disorders of the nervous system, affecting one in , individ- uals worldwide (zhu and parada, ). a cardinal feature of nf is the growth of benign tumors called neurofibromas, cate- gorized into plexiform and dermal subtypes (le and parada, ). plexiform neurofibromas can undergo malignant transfor- mation into neurofibrosarcomas, known as malignant peripheral nerve sheath tumors (mpnsts), which represent a major source of morbidity for nf patients (ferner, ). despite continued progress in understanding nf biology, mpnst treatment remains limited to surgery, and prognosis remains unchanged (tonsgard, ). the development of murine models has provided an opportu- nity to gain insight into nf -deficient tumor natural history (cichowski et al., ; joseph et al., ; vogel et al., ; zheng et al., ; zhu et al., ). nf and tp , or cdkn a, are the most frequently mutated cancer-related genes in human mpnsts (mantripragada et al., ; rubin and gutmann, ). our genetically engineered mouse models (gemms) reca- pitulate tumors that arise in nf patients, and we and others have shown that genetic ablation of the nf and p tumor suppressors results in spontaneous development of mpnsts (cichowski et al., ; vogel et al., ). benign and malignant nf -deficient tumors can also be induced by subcutaneous implantation of nf - or nf ;p -deficient skin-derived precur- sor (skps), respectively, and are histologically indistinguishable from human counterparts (le et al., ); l.q.l., t. shipman, and l.f.p., unpublished data). here, we examine the chemokine receptor cxcr , which we find enriched in nf -deficient cells and particularly in nf -defi- cient mpnsts. expression of cxcr and its ligand, cxcl , has been reported in solid tumors, (kijima et al., ; koshiba et al., ; laverdiere et al., ; müller et al., ; oh et al., ; righi et al., ; schrader et al., ; sehgal et al., ; sengupta et al., ; taichman et al., ; zeelenberg et al., ; zhou et al., ) as well as non-hodgkin’s lymphoma (bertolini et al., ) and chronic lymphocytic leukemia (burger et al., ). clinical data indicate that high cxcr correlates with poor clinical outcome (bian et al., ; li et al., ; wang et al., ). the proposed paracrine roles for cxcr /cxcl in a variety of tumorigenic processes include cell growth (schrader et al., ; zhou et al., ), cell , – , february , ª elsevier inc. mailto:lu.le@utsouthwestern.edu mailto:luis.parada@utsouthwestern.edu http://dx.doi.org/ . /j.cell. . . http://crossmark.dyndns.org/dialog/?doi= . /j.cell. . . &domain=pdf metastasis (li et al., ), and angiogenesis (sengupta et al., ). a potential role for cxcr in sarcoma pathogenesis has not been examined. here, we provide evidence that the cxcr / cxcl axis is essential for mpnst tumor progression. specif- ically, the autocrine activation of cxcr by cxcl triggers intracellular pi -kinase (pi k) and b-catenin signals to promote g to s phase transition in mpnst cells. the cxcr antagonist, amd , has growth-inhibitory effects on primary cultured mouse and human mpnst cells, tumor allografts, and sponta- neous gemms. moreover, analysis of human primary and cultured mpnst cells, as well as human tissue microarray anal- ysis, reveals conserved pathway activation. thus, cxcr inhibi- tion may represent a therapeutic strategy to treat mpnst. results cxcr in nf -deficient mpnst tumors previously, we demonstrated that nf -deficient skps can give rise to either dermal or plexiform neurofibromas depending on their local microenvironment (dermis versus sciatic nerve) (le et al., ). in addition, dual mutation of the nf and p tumor suppressors in these cells results in mpnsts that exhibit cellular and molecular features of human mpnsts (l.q.l., t. shipman, and l.f.p., unpublished data). these tumors are indistinguish- able from a spontaneous mpnst gemm also based on loss of nf and p (cisnp; cichowski et al., ; vogel et al., ). to gain insight into the molecular and cellular mechanisms underlying development of nf -deficient mpnsts, we used microarray analysis to compare the transcriptomes of mpnsts with those of normal skps (wt), as well as pretumorigenic skps with either nf deletion (nf�/�) or nf and p (np�/�) deletion, as shown in figure a. the comparative array data pre- sented a complex picture of up- and downregulated transcripts for diverse genes (data not shown). however, our attention was drawn to the elevated expression of the chemokine receptor cxcr that exhibited a -fold elevation in both pretumor cell types (nf�/�; np�/�) and a -fold increase in the malignant form of skp mpnst (smpnst). quantitative rt-pcr and western blot analysis (figures b and c) confirmed these array data. we also measured low cxcr levels in schwann cells, which belong to the embryonic lineage of origin of nf -deficient tumors (le et al., ; serra et al., ; zhu et al., ), and high levels in tumor cells from the spontaneous cisnp mouse model of mpnst by western blot (figure s a available online; [vogel et al., ]) and immunohistochemistry (ihc). we further performed ihc on tumor samples from the smpnst-allograft, cisnp, and smpnst-autograft models and a human mpnst sample (figures d and s b). together, these data confirmed elevated cxcr protein in the different sources of nf -deficient malignant tissues compared to controls and, further, provided evidence that cxcr expression is sustained in human nf - associated mpnst. cxcr knockdown impairs cell proliferation and attenuates tumorigenesis to evaluate the functional role of cxcr in mpnst pathogen- esis, we used short hairpin rna (shrna) for knockdown in cell , – , february , ª elsevier inc. smpnst cells. cells were infected with lentivirus containing cxcr shrna or a control scrambled shrna (plko ctrl), and stable cell lines were established using puromycin selection. two different shrna sequences, targeting either the coding region (plko-mcxcr ) or the utr (plko-mcxcr -utr) reduced cxcr messenger rna (mrna) levels by � % (figures s a and s b). to address whether cxcr influences smpnst cell metabolism, we measured atp levels using a luminescence assay and found that tumor cells with depleted cxcr were less metabolically active. introduction of exoge- nous cxcr complementary dna (cdna) lacking the utr sequences (so that it is not targeted by the shrna) re-estab- lished cxcr protein levels and overcame the cell growth inhi- bition (figures a and s b). we turned to a doxycycline (dox)-inducible mir -based shrna system to enable acute knockdown of cxcr . using this system, murine and human cxcr mrna levels were decreased to % and % of the origin level, respectively (figures s c–s f). in contrast, induction with dox had no effect on cxcr expression in mpnst-tripz-scrambled control cells (figures s c–s f). similar to the plko knockdown results, we observed cell growth arrest in cxcr -depleted smpnst and human mpnst (s ) cells upon dox treatment (figure b). together, these results confirm that cxcr plays a role in murine- and human-derived mpnst cell proliferation. we next investigated the growth properties of tumor cells in vivo after cxcr knockdown. or plko-mcxcr or plko-ctrl smpnst cells were injected subcutaneously into nude mice and monitored for tumor growth (smpnst-allografts). the mice were sacrificed and tumors were dissected month after injection (figure s g). quantification of tumor size and weight showed that mpnst cells with cxcr knockdown generated smaller tumors than control cells (figure s h), and additionally, time to tumor appearance was significantly in- creased (figure s i). we also analyzed cell proliferation in excised tumors and found the average percentage of ki - positive, proliferating cells was . % ± . % in cxcr - depleted mpnsts versus . % ± . % in controls (figures s j and s k). similar results were obtained when the inducible shrna tumor cells were implanted and subjected to dox-mediated cxcr knockdown after the tumor cells had successfully seeded in the allograft. this approach eliminated the possibility that cxcr knockdown in culture impeded subsequent tumor cell implantation. or mpnst-tripz-cxcr cells were in- jected subcutaneously into nude mice, and one group received dox ( mg/ml) in the drinking water (figure c). compared to controls, tumor appearance in the dox-treated group was de- layed by week, and tumor progression was impaired (figures c and d). all mice were sacrificed on day , and tumors were excised. western blot analysis showed an � . % deple- tion of cxcr protein in the tumors harvested from dox-treated mice (figure e). when cells were injected, / control mice bore tumors ( ± mm in size and . ± . g in weight), and / dox-treated mice developed tumors that were smaller both in size ( ± mm ) and weight ( . ± . g) (figures f and g). notably, when cells were injected, no dox-treated mice developed tumors, whereas control group a b c d figure . cxcr is overexpressed in mpnsts (a) schema of the microarray analyses. (b) qrt-pcr analysis of cxcr mrna levels in wt, nf�/�, and np�/� (nf�/�;p �/�) skps, as well as mpnst skp model tumors and the cells derived from the tumor. (c) western blot analysis of cxcr protein levels in nf�/� and np�/� skps and smpnst cancer cells. (d) quantification of cxcr -positive cells in tumor tissues from different mouse models of mpnst and an mpnst from an nf patient (smpnst = smpnst autograft; athymic model = smpnst allograft). all statistics represent mean ±sd. see also figure s . cell , – , february , ª elsevier inc. a b c d e f g figure . knockdown of cxcr expression in mpnst cells decreased proliferation in vitro and tumorigenesis in vivo (a and b) atp luminescence assays were used to measure growth of indicated cells. (c and d) representative pictures of the tumors from nude mice injected with smpnst-tripz- mcxcr cells. mice – : without dox treatment; mice – : dox treatment. (e) cxcr protein level is downregulated in dox- treated mpnsts. (f) kinetic curve of tumor growth as measured by tumor volume. (g) quantification of tumor weight. all statistics represent mean ±sd. see also figure s . mice developed tumors (figure d). thus, both chronic and acute suppression of cxcr in vivo substantially decreased the tumorigenic capacity of mpnst cells. cxcr depletion alters the mpnst cell cycle we investigated possible mechanisms of cxcr function in pro- moting mpnst progression. shrna depletion caused growth arrest of smpnsts (figure ) rather than apoptosis (figures cell , – , february , ª elsevier inc. s a and s b) or senescence (figures s c and s d). bromodeoxyuridine (brdu) incorporation and fluorescence- activated cell sorting (facs) analysis showed significant reduction in brdu incorporation in cxcr -depleted cells ( . % ± . % versus . % ± . %; figure a). when cxcr protein level was restored, the percentage of brdu- positive cells was also restored to that of cxcr -wt cells (figure a). addi- tional cell-cycle analysis revealed that the percentage of cells in g phase was � % in cxcr -depleted smpnst cells versus � % in cxcr -wt cells; by contrast, the number of cells in g /m phase was only slightly changed (figures b and s e). these data suggest that cxcr -depleted mpnst cells undergo g /s arrest. we also performed brdu incorporation studies in vivo. tumor- bearing mice were injected with brdu hr before sacrifice. brdu ihc revealed % ± % brdu-positive cells in the tumor samples from mice injected with control smpnst cells. in contrast, the brdu-positive cell number decreased to % ± % in the tumor samples from mice injected with cxcr -depleted smpnst cells (figures c and d). similar to the mpnst cell culture results, there was no obvious apoptosis in either tumor group (figures s f and s g). in summary, knockdown of cxcr expression, in culture and in vivo, led to cell-cycle arrest manifested by reduced s phase and brdu incorporation, rather than cell death or senescence. cyclin d expression is regulated by cxcr we next investigated whether cxcr perturbation impacts the expression of cell-cycle-regulatory genes (johnson and walker, ; lee and yang, ; obaya and sedivy, ). although quantitative rt-pcr (qrt-pcr) analysis indicated that ex- pression of most genes examined was unchanged in cxcr - depleted smpnst cells and tumors, cyclin d mrna levels decreased � % (figures e and s h). a slight reduction in cdk / and cyclin e mrna levels was also observed (figures e and s h). quantification of western blots confirmed the cyclin d protein level decrease in cxcr -depleted mpnst cells and tumors (smpnst allografts) (figures f and s i). both cyclin d mrna and protein levels were fully restored in cxcr -depleted mpnst cells with exogenous cxcr expression (figures e and f). moreover, reintroduction of cyclin d cdna restored protein levels and counteracted the cxcr depletion effect, allowing cells to resume progression through the cell cycle (figures g and h). these data demonstrate that, in smpnst cells, cell-cycle progression mediated by cyclin d is dependent on cxcr function. cxcr activates the akt/gsk- b/b-catenin network signaling pathways known to regulate cyclin d include the nfkb, ras, erk, wnt/b-catenin, and jak/stat pathways (sherr, ). to determine whether any of these candidate pathways mediate cxcr regulation of cyclin d in neurofibro- sarcomas, fractionated nuclear and cytoplasmic extracts of smpnst cells were immunoblotted with the indicated anti- bodies to examine changes following cxcr depletion. we observed that both cyclin d and b-catenin levels decreased . % and . %, respectively, in the nuclear fraction of cxcr -depleted mpnst cells (figure a). no changes were seen in other pathways examined (figure a). transcriptional activation assays using a luciferase reporter linked to the t cell factor (tcf) promoter—a physiological target of b-catenin— showed a % reduction in luciferase activity in cxcr - depleted smpnst cells compared to controls, which is con- sistent with the model that suppression of cxcr attenuated b-catenin activity (figure b). to test whether nuclear b-catenin is required for cyclin d expression, we directly blocked tcf function (hoppler and kavanagh, ). expression of domi- nant-negative tcf (dntcf) dramatically decreased cyclin d mrna and protein levels in cxcr -wt-mpnst cells (figures c and d), whereas overexpression of b-catenin in cxcr - depleted mpnst cells restored cyclin d expression (figure e) and, further, rescued the cell growth arrest caused by cxcr knockdown (figure f). functionally, downregulation of the b-catenin pathway by dntcf resulted in cell growth arrest in mpnst cells (figure s a). we also examined tumors for b-cate- nin expression. ihc on mpnst tumor tissues from smpnsts (smpnst allografts) (figure s b) and one human patient sample (figure s c) showed robust nuclear immunoreactivity consistent with activation of b-catenin signaling in these tumors. the above data demonstrate a role for b-catenin downstream of cxcr and upstream of tcf and cyclin d in stimulating mpnst growth. b-catenin stabilization is required for its role as a transcription factor. in the inactive state, b-catenin is destabi- lized by phosphorylation at ser , ser , and thr by gsk- b or at ser by ck a (liu et al., ). western blot analysis showed that cxcr depletion increased b-catenin serine phos- phorylation at sites / , but not (figure g), suggesting that cxcr suppression resulted in gsk- b kinase activation. we also examined gsk- b serine inactivating phosphorylation and observed a reduction in cxcr -depleted mpnst cells (figure g). thus, in mpnst, cxcr activity maintains gsk- b in the inactive state. gsk- b is in turn a downstream element of the pi k/akt signaling pathway (cross et al., ) whose kinase activity is inhibited by akt-mediated phosphorylation at ser (srivastava and pandey, ). we reasoned that the decreased phosphoser -gsk- b level in cxcr -depleted mpnst cells might result from attenuated akt kinase activity and confirmed this by western blot analysis with pakt (ser ) antibody (figure g). we also found reduced levels of activated b-catenin, pgsk- b (ser ), and pakt (ser ) in cxcr - depleted mpnst tumor samples compared to control tumors (smpnst allografts) (figure h). these data support the model that cxcr promotes mpnst growth by activating the pi k/ akt and the gsk- b/b-catenin pathways. previous in vitro studies using human and murine mpnst cell lines, as well as in vivo studies using the cisnp mouse model, demonstrated that the mtor pathway can regulate mpnst growth by posttranscriptional regulation of cyclin d (johannessen et al., ). we observed modest reduction in phospho-mtor upon cxcr knockdown, but this was not accompanied by obvious change in the levels of phosphorylated-s ribosomal protein (figure s d). collectively, our data indicate that cxcr regu- lates the activity of b-catenin via the akt/gsk- b cascade, which ultimately controls cyclin d transcription and protein levels. cxcl activates cxcr in an autocrine loop we sequenced cxcr cdnas from two independent murine mpnsts, one derived from the smpnst-allograft model and one from the cisnp model, and found no missense or nonsense mutations (data not shown). moreover, cxcr -activating muta- tions have not been identified in mpnst cell lines or primary cells derived from human patients (see below and figure s a). there- fore, in these tumors, receptor activity must rely on the presence of ligand—cxcl . qpcr analysis showed that cxcl mrna was indeed elevated in pretumorigenic skps (np�/�) and was even more highly expressed in smpnst tumor cells (figure s b). to test the role of cxcl in mpnst cell growth, we treated cultured mpnst cells with recombinant cxcl protein and found that it promoted cell growth, generating a . -fold increase in cell number at a concentration of ng/ml by day , when compared to nontreated cells (figure a). in contrast, cell number decreased by % and % at days and , respec- tively, when cells were cultured with anti-cxcl antibody compared to igg or pbs control (figure b). these data suggest that cxcl is critical for mpnst cell proliferation. to verify the autocrine source of cxcl ligand in the mpnst cell culture, we performed an elisa on the medium conditioned by mpnst cells using an anti-cxcl antibody. we observed no detectable cxcl protein in control media (with no cells) compared to the conditioned media, indicating that the in vitro source of cxcl protein is the mpnst cells (figure c). consistent with the elisa showing that conditioned media from cxcl - overexpressing mpnst cells (pbabe-cxcl ) and knockdown cells (plko-cxcl ) contained elevated and reduced cytokine, respectively (figures c and s c), cxcl -overexpressing cell , – , february , ª elsevier inc. a b c d e f g h figure . cxcr alters the cell cycle in smpnst cells by regulating cyclin d expression smpnst cells were incubated with brdu for min and then stained with propidium iodide. (a and b) facs analysis showed that cxcr depletion in smpnst cells decreased the percentage of brdu-positive cells (plko-mcxcr and plko-mcxcr - utr compared to control plko-ctrl) (a) and altered the proportion of cells in g and s phases (b). expression of cxcr in the knockdown cells (plko-mcxcr - utr + ub-cxcr ) restored the cells to the control state. (legend continued on next page) cell , – , february , ª elsevier inc. cells had a significant growth advantage (figure a), whereas cxcl knockdown cells exhibited a significant reduction in growth at days and (figure d). importantly, the cell growth inhibition could be rescued by addition of cxcl protein (figure e). therefore, mpnst cells synthesize and secrete cxcl protein, causing increased cell growth that corre- sponded with cxcl levels. to confirm that the effect of cxcl on mpnst growth is dependent on cxcr , we added cxcl protein to cultured cxcr -depleted mpnst cells. we found no detectable change in cell proliferation after ligand stim- ulation compared to control cxcr -depleted mpnst cells (fig- ure e). additionally, cxcl modulation in the presence of receptor induced the same signaling pathway changes brought about by cxcr modulation (figure f). taken together, these data demonstrate that cxcl , secreted by mpnst cells, is sufficient to sustain autocrine activation of its receptor, cxcr , and triggers specific downstream signaling pathways, leading to mpnst cell-cycle progression and proliferation. given the important roles of cxcr /cxcl in tumor angiogenesis, we also investigated whether cxcr depletion in mpnst cells altered the microvasculature. both control and cxcr -depleted tumors exhibit strong cd staining (fig- ure s d) and similar vessel densities (figure s e), indicating that the tumor growth arrest induced by cxcr depletion is cell autonomous and not secondary to effects on the microvasculature. pharmacological inhibition of cxcr arrests mpnst proliferation and tumor growth we next tested a clinically validated, highly specific cxcr antagonist, amd , in our system. we performed a dose- response analysis of amd on primary murine mpnst cells (smpnsts and cisnp), one primary human mpnst cell line, three established human mpnst cell lines (s ; snf . ; snf . ), and pretumor cells (nf ;p null skps) (figures a and b). four of six cell lines were potently inhibited by low doses of amd (ic values & . um; figure c). one human mpnst cell line, snf . , and the pretumor cells were less sensitive (ic values of – um; figure c). only one human mpnst cell line, snf . , showed no response, which is consis- tent with its low endogenous cxcr levels relative to the other mpnst cells (figure s a). of note, we were unable to seed xeno- graft tumors using snf . cells, suggesting that this cell line has drifted significantly from the original tumor of derivation (data not shown). in contrast, the cell viability of wild-type (wt) schwann cells and skps was unaffected by amd (fig- ure a). inhibition of cxcr by amd also reduced cyclin d levels via the akt/gsk- b/b-catenin pathway (figure d). to assess the therapeutic potential of amd in vivo, we first tested subcutaneous allografts of primary smpnsts. trans- (c) paraffin sections of mpnsts (harvested from smpnst-allograft mice injecte cells) were stained with antibody against brdu and counterstained with hematox (d) the percentage of smpnst cells that were brdu positive was determined fo (e and f) analysis of the expression levels of various cell-cycle genes/proteins in (g) cell growth curves of indicated cells as measured with an atp luminescence (h) cxcr and cyclin d protein levels were examined by western blotting in ind scale bar, mm. all statistics represent mean ±sd (*p < . and **p < . ). s plant recipient animals with palpable tumors were treated with amd and, after weeks of treatment, were sacrificed for analysis (figure e). amd treatment potently suppressed mpnst growth, resulting in reduced tumor size and weight that was % and %, respectively, of the control group (fig- ure s b). this was accompanied by commensurate reduction in brdu incorporation and ki staining (figures s c and s d). consistent with the in vitro data, amd -treated tumors showed decreased levels of cyclin d , activated b-catenin, phospho-akt, and phospho-ser -gsk- b (figure s e). to further validate the role of cxcr signaling in mpnst growth and the potent cytostatic effect of amd on tumor growth, we turned to a spontaneous endogenous gemm. a mouse strain in which null p and nf alleles are configured in cis on the same chromosome spontaneously develop mpnst via loss of heterozygosity (loh) of both tumor suppressor alleles (cisnf/p ; vogel et al., ). although a majority of the sponta- neous tumors are sarcomas, these cisnf/p mice are also prone to other nf -initiated tumors such as lymphomas and gliomas, as well as to spontaneous p -based tumors (cichow- ski et al., ; vogel et al., ). based on kaplan-meier curve data that indicate spontaneous neurofibrosarcoma appearance with % mortality at about weeks of age and percent mortality at weeks (n = ; vogel et al., ), we com- menced the amd drug trial on cisnf/p mice at weeks of age. as shown in figure f, at months posttreatment ( weeks of age), / control mice ( %) had perished, whereas, in the amd group, only / ( %) had perished. all perished mice had large tumors, and histopathological anal- ysis of the tumor tissues revealed that one mouse from the control group and one from the experimental group had clear evidence of a primary tumor of hematopoietic origin (figures s f and s g). therefore, these mice were removed from the study, resulting in a total of nine control mice and amd -treated mice (figure g). six out of nine control mice developed lethal sarcomas. five developed mpnst, as evidenced by histopathological analysis and s b and gap immunoreactivity (figure f, c , c , and c –c ; fig- ure s h). a sixth control mouse died with a malignant triton tumor (mtt), which is an nf -associated sarcomatous tumor having high myoglobin expression (figure f, c ; and fig- ure s i). all six tumors displayed cxcr expression (figure f). in contrast to the high mortality rate in the control group, at months posttreatment, only two out of mice from the amd treatment group had perished with a solid tumor (fig- ure f, amd and amd ; figure g). by histological analysis, we determined that one of the tumors was a rhabdomyosarcoma (rms) with very low levels of cxcr expression (figure f, amd , and figures s j and s k). the second treated mouse developed a leiomyosarcoma (lms) with cxcr expression d with either control plko-ctrl or cxcr -depleted plko-mcxcr smpnst ylin (blue). r each tumor. the indicated cells as measured by qpcr (e) and western blotting (f). assay. icated cells. ee also figure s . cell , – , february , ª elsevier inc. a b c d e f g h figure . cxcr regulates cyclin d expression through the akt/gsk- b/b-catenin network (a) immunoblot of nuclear and cytoplasmic extracts from smpnst cells with indicated antibodies. (legend continued on next page) cell , – , february , ª elsevier inc. a b c d e f figure . an autocrine mechanism involving cxcl and cxcr maintains growth of mpnst cells (a and b) growth curve of smpnst cells treated with recombinant cxcl protein (a) or cxcl /cxcr antibodies (b). (c) elisa to measure cxcl protein level in pbs, % fetal bovine serum (fbs) dulbecco’s modified eagle’s medium (dmem) media, and conditioned media from smpnst cells or smpnst cells expressing pbabe-cxcl (overexpression) or plko-cxcl (knockdown). (d) growth curve of control smpnst cells (plko ctrl) and cxcl -depleted smpnst cells (plko-cxcl ). (e) growth curve of smpnst cells, cxcr -or cxcl -depleted smpnst cells, and cxcr -or cxcl -depleted smpnst cells treated with recombinant cxcl protein. (f) immunoblot of cell lysates from smpnst cells and smpnst cells expressing plko-cxcl or pbabe-cxcl with indicated antibodies. all statistics represent mean ±sd (**p < . ). see also figure s . (figure f, amd , and figures s l and s m), suggesting that this tumor escaped amd treatment. whether this outlier reflects failed drug delivery or, alternatively, an independent mechanism of tumor promotion will require additional studies. in summary, the allograft and genetic tumor model data demonstrate that in vivo pharmacological blockade of cxcr can potently inhibit spontaneous mpnst tumor development in a gemm by blocking the same signaling pathways as ob- served in primary tumor cultures. (b) luciferase reporter assay to measure tcf activation in control smpnst ce mcxcr -utr), cxcr -depleted smpnst cells rescued by cxcr overexp dominant-negative tcf (plko-ctrl+ub-dntcf). (c and d) the mrna and protein levels of cyclin d in smpnst cells (ctrl) or smpn by western blotting (d). (e) immunoblot of cell lysates from smpnst cells, cxcr -depleted smpnst b-catenin with indicated antibodies (abc: antibody against activated b-catenin). (f) atp luminescence assay to measure growth of indicated cells. (g) immunoblot of cell lysates from smpnst cells and cxcr -depleted smpns (h) graph showing fold change versus control of tumor tissue lysates from con indicated antibodies. all statistics represent mean ±sd (**p < . ). see also figure s . conserved signaling pathway activation in human mpnst the above studies reflect analyses of genetic mouse models extended to a single human tumor and primary mpnst line plus three established human mpnst lines. to further assess the relevance of our findings to human mpnst, we examined cxcr in mpnsts from patients with nf . we sequenced coding exons and (see experimental procedures) of cxcr from a series of nf -associated human mpnst lls (plko-ctrl), cxcr -depleted smpnst cells (plko-mcxcr and plko- ression (plko-mcxcr -utr+ub-cxcr ), and smpnst cells expressing st cells expressing dntcf (dntcf) were determined either by qpcr assay (c) or cells, and cxcr -depleted smpnst cells ectopically expressing cxcr or t cells with indicated antibodies. trol smpnsts (ctrl) or smpnsts from cxcr -depleted cells (mcxcr ) with cell , – , february , ª elsevier inc. a b c d e f g figure . amd specifically inhibits the proliferation of smpnst cells and suppresses the growth of mpnsts in vivo (a and b) dose curve showing effect of amd on proliferation of murine (primary cells from mpnst skp model and cisnp model) and human (snf . , snf . , s , and primary cells from a human nf patient) mpnst cells, pretumor skp np�/� cells, and wt murine schwann cells and skps. (c) experimentally derived amd ic values. (d) immunoblot with the indicated antibodies of cell lysates from murine cells in the absence or presence of amd . (e) representative picture of the smpnst-allograft tumors (from nude mice injected with smpnst cells) during the treatment study with tumor histopathology and immunohistochemistry. (f) list of control (c-) and amd -treated (amd-) mice that died during the treatment study, with tumor histopathology and immunohistochemistry. (g) kaplan-meier survival curve of mice in the amd treatment study (control group, n = ; amd -treated group, n = ; p = . by mantel-cox test). other statistics represent mean ±sd. see also figure s . samples and cell lines (figure s a), including s , which requires cxcr function for growth (figure b); all cxcr coding regions analyzed had wt sequence (figure s a). thus, similar to the murine mpnsts, human mpnst cxcr activity must depend on ligand presence. we next examined cxcr protein expression using a human tissue microarray (tma) that included plexiform neurofibromas (from nf patients har- boring mpnsts) and mpnst samples ( from nf patients and sporadic) (ghadimi et al., ; zou et al., ). the data showed that % of neurofibromas and % of nf - deficient mpnsts displayed cxcr immunoreactivity (figures cell , – , february , ª elsevier inc. a and b), whereas only % of sporadic mpnsts tissues showed cxcr immunoreactivity. similarly, % of neuro- fibromas and % of nf -associated mpnsts exhibited cxcr expression in > % of tumor cells, as compared to % of sporadic mpnst tissues (figure a). spearman correla- tion analysis showed a statistically significant difference in cxcr intensity and distribution when comparing nf -associ- ated tumors to sporadic tumors (two-sided p = . and . , respectively) (figure b). we also assessed p-akt, b-catenin, and cyclin d expression and observed a direct con- cordance between their levels and those of cxcr (p = . , a b c d figure . analysis of cxcr expression and downstream pathway signaling reveals conservation in human mpnsts (a) quantification of the intensity and distri- bution of cxcr immunoreactive cells in all mpnst tmas. (b) schema of the cxcr distribution in tmas. spearman correlation identified a statistically sig- nificant difference between nf -associated and sporadic tumors (p = . ). (c) spearman correlation coefficient analyses between cxcr , pakt, b-catenin, and cyclin d in nf -mpnst. (d) quantification of pakt, b-catenin, and cyclin d expression levels in mpnst-nf tma and categorization based on cxcr expression level. staining distribution of positively staining cells: ( ) = < %, ( ) = % – %, ( ) > %, and intensity: ( ) = negative, ( ) = low, and ( ) = intermediate to high. spearman’s correlation coefficient analyses were used to determine the concordance between cxcr expression and nf status and between cxcr and other biomarkers. . , and . � , respectively) (figures c and d). thus, tma data confirm that akt/gsk- b//b-catenin pathway activation is conserved in human nf -associated mpnsts. extension of our functional data in murine and human mpnst cells, coupled with the tma studies, indicate that cxcr and cyclin d are closely associated with clinical nf -associated pathogenesis. discussion we exploited the unique properties of gemms for nf -associ- ated mpnst that permitted isolation and direct comparison with tumor cells of origin and precursor nontumor cells. the progressively elevated expression of the chemokine receptor cxcr along the increasingly tumorigenic series from premalig- cell , – , f nant nf null and nf/p double null tumor progenitors to nf null benign tumors (neurofibromas) and, finally, to nf/p double null mpnsts drew our attention and motivated the present study. cxcr /cxcl : an mpnst autocrine loop we also found increased cxcr expres- sion in human nf patient tumor samples and primary cells. cxcr is commonly found in human and experimental murine cancers. protumorigenic paracrine func- tions attributed to this g-protein-coupled receptor/ligand include cell homing, migration, and induction of neovasculari- zation (li et al., ; sengupta et al., ; singh et al., ). in the present study, we identify an autocrine loop in cells that sustains activated cxcr . mpnst cells with cxcr depletion exhibit proliferative arrest rather than cell death, with fewer cells in s phase. consistent with this, we found that the g /s phase transition protein cyclin d responded to altered cxcr expression. cxcr signaling differs in normal and cancer cells both at the functional and molecular signaling levels. for example, cxcl treatment of wt primary neonatal astrocytes induced apoptosis, whereas it promoted enhanced survival in astrocy- toma cultures (warrington et al., ). in our study, cxcr suppression inhibited mpnst cell progression from g to s phase in the cell cycle and resulted in potent inhibition of mpnst cell growth in vitro and also in vivo tumor growth in several exper- imental paradigms. mpnst cells with either chronic or acute cxcr knockdown were deficient in allograft transplantations. ebruary , ª elsevier inc. administration of the cxcr inhibitor, amd , also impeded efficient tumor allotransplantation of murine mpnsts. in perhaps the most stringent assay, spontaneous mpnst devel- opment was dramatically inhibited in a cisnf/p gemm. this result illustrates the potential power of spontaneous genetically relevant malignant tumor mouse models as experimental tools for cancer treatment discovery. our data point to a cell-autonomous pathway of activation but do not rule out potential ligand contribution from other tumor- associated sources. however, mpnst cells themselves provide sufficient ligand to sustain autocrine cell growth in culture. we make note that, although our cxcr shrna experiments provide similar allograft growth inhibition to that of amd , our studies do not address the possibility that pharmacological inhibition of cxcr may extend to additional targets such as bone-marrow-derived cells that may result in additional tumor inhibitory effects. cxcr promotes mpnst proliferation via pi k and gsk- b the function of the nf protein neurofibromin as a ras-gtpase- activating protein has traditionally focused attention on the two main ras effector pathways: raf/erk and pi k/mtor. inhibi- tion of the erk pathway can impact and even lead to reversal of certain nf mutation-based phenotypes (cui et al., ; wang et al., ). other studies have reported that hyperactiva- tion of the mtor pathway underlies a growth advantage in nf - deficient mpnst cells and that rapamycin-mediated inhibition of mtor blunts mpnst growth in vivo (johannessen et al., ; johansson et al., ). we saw modest downmodulation of p-mtor but saw no effects on p-s signaling in our smpnst system. in our study, nf loss specifically caused upregulation of akt/pi kinase, but not of erk. by recent accounting, more than positive and negative effectors of akt signaling have been described (http://www.proteinlounge.com). how specific pathways are selected for activity in a given cellular context may depend in part on the akt isoform, intracellular localization of the active intermediates, and other factors not yet understood. the association of cxcr with various cancers has implicated activation of several signaling effectors, including plcg/ca +, pi k/akt/nfkb, and erk/p , leading to chemotaxis, sur- vival, angiogenesis, etc. (balkwill, ). in mpnsts, however, cxcr depletion deactivated akt, but not erk or plcg, thus revealing cell context-specific pathway regulation. mtorc and gsk- b are important downstream effectors of phospho- akt, and our results show that, in mpnsts, cxcr depletion more strongly impacts gsk- b rather than mtor through pi k and that gsk- b mediates cyclin d expression. thus, we propose that the pi k/gsk- b branch downstream of cxcr is sufficient to promote mpnst proliferation. these studies, however, do not rule out that additional signaling path- ways and effectors of akt, b-catenin, and tcf may have contributory functions in mpnst progression. soft tissue sarcomas are among the most therapy-resistant and life-threatening forms of cancer. our data indicate that correction of abnormal cxcr signaling may be a promising therapeutic target for nf -associated mpnsts. in addition, a subset of sporadic mpnsts may also co-opt this signaling cell , – , february , ª elsevier inc. mechanism, in which case cxcr attenuation could poten- tially benefit this patient population. clinically-relevant cxcr inhibitors were initially developed for the treatment of hiv (peled et al., ). these include compounds of four different classes: small-molecule inhibitors (e.g., amd ), small modified pep- tides (e.g., btk ), antibodies (e.g., alx- ), and modified cxcl antagonists (e.g., ctce- ). given the accumulating evidence for the important role of this paracrine axis in cancer, such compounds are currently being tested in early-phase clin- ical trials (http://www.clinicaltrials.gov). our preclinical observa- tions supplemented by strong evidence that the cxcr axis activity is sustained in human samples support the inclusion of mpnst patients in such studies. notably, effects of cxcr blockade are cytostatic rather than cytotoxic. however, taking into account that surgery is the mainstay of mpnst treatment, therapeutic approaches such as cxcr inhibition may improve local growth control and enhance resectability. in addition, sustained blockade of tumor development may provide an opportunity for endogenous inflammatory and immune anti- tumor responses to gain a foothold. moreover, the identification of additional pathways that can be targeted in combination with cxcr will hopefully result in synthetic lethality and superior anti-mpnst effects. further studies will resolve this important question. experimental procedures all experimental procedures are described in detail in the extended experi- mental procedures. mpnst mouse models skp mpnst model skps were isolated as previously reported (le et al., ) from nf f/f; p f/f;rosa -lacz mice. np�/� skps were implanted subcutane- ously into the same mouse from which the skps were originally isolated (smpnst autograft). the autologously transplanted skps gave rise to mpnsts within months after implantation % of the time. the tumors ex- hibited all the characteristics of human mpnst, including fascicular patterns of tightly packed spindle cells with hyperchromatic nuclei and frequent mitoses, as well as s b expression (l.q.l., t. shipman, and l.f.p., unpub- lished data). smpnst allograft model smpnst cells were subcutaneously injected into the backs of - to -week- old athymic nude mice. cisnp mpnst model a spontaneous endogenous gemm for mpnsts. we utilized a mouse strain in which null p and nf alleles are configured in cis on the same chromosome and spontaneously develop mpnst via loss of heterozygosity of both tumor suppressor alleles (vogel et al., ). amd and doxycycline treatment in vivo; measurement of tumor volume amd treatment of mpnst allograft model mpnst cells were subcutaneously injected into the backs of - to -week-old female athymic nude mice. the cxcr inhibitor amd was administered subcutaneously daily at mg/kg of body weight, beginning at the time of tumor detection. amd treatment of gemm amd ( mg/d) or saline was administered using subcutaneously im- planted osmotic minipumps (durect corporation). two month treatment began when the mice were weeks old. doxycycline was delivered in % sucrose-containing drinking water at mg/ml. tumor size was calculated by measuring length and width of the http://www.proteinlounge.com http://www.clinicaltrials.gov lesion with the formula (length) (width) ( . ). all statistical analyses were done with student’s t test. supplemental information supplemental information includes extended experimental procedures and six figures and can be found with this article online at http://dx.doi.org/ . /j.cell. . . . acknowledgments we thank karen cichowski for the generous gift of the human mpnst cell lines. this work was partially supported by funding from the national cancer institute (grant r ca to l.q.l.), department of defense (grant w xwh- - - to l.q.l. and postdoctoral fellowship award grant w xwh- - - to w.m.), and the national institutes of health (grant p ns to l.f.p.). l.q.l. is a disease-oriented clinical scholar and holds a career award for medical scientists from the burroughs wellcome fund. l.f.p. is an american cancer society research professor. received: june , revised: november , accepted: january , published: february , references balkwill, f. ( ). the significance of cancer cell expression of the chemokine receptor cxcr . semin. cancer biol. , – . bertolini, f., dell’agnola, c., mancuso, p., rabascio, c., burlini, a., monestir- oli, s., gobbi, a., pruneri, g., and martinelli, g. ( ). cxcr neutralization, a novel therapeutic approach for non-hodgkin’s lymphoma. cancer res. , – . bian, x.w., yang, s.x., chen, j.h., ping, y.f., zhou, x.d., wang, q.l., jiang, x.f., gong, w., xiao, h.l., du, l.l., et al. ( ). preferential expression of chemokine receptor cxcr by highly malignant human gliomas and its association with poor patient survival. neurosurgery , – , discussion – . burger, j.a., burger, m., and kipps, t.j. ( ). chronic lymphocytic leukemia b cells express functional cxcr chemokine receptors that mediate spontaneous migration beneath bone marrow stromal cells. blood , – . cichowski, k., shih, t.s., schmitt, e., santiago, s., reilly, k., mclaughlin, m.e., bronson, r.t., and jacks, t. ( ). mouse models of tumor develop- ment in neurofibromatosis type . science , – . cross, d.a., alessi, d.r., cohen, p., andjelkovich, m., and hemmings, b.a. ( ). inhibition of glycogen synthase kinase- by insulin mediated by protein kinase b. nature , – . cui, y., costa, r.m., murphy, g.g., elgersma, y., zhu, y., gutmann, d.h., par- ada, l.f., mody, i., and silva, a.j. ( ). neurofibromin regulation of erk signaling modulates gaba release and learning. cell , – . ferner, r.e. ( ). neurofibromatosis . eur. j. hum. genet. , – . ghadimi, m.p., young, e.d., belousov, r., zhang, y., lopez, g., lusby, k., kiv- lin, c., demicco, e.g., creighton, c.j., lazar, a.j., et al. ( ). survivin is a viable target for the treatment of malignant peripheral nerve sheath tumors. clin. cancer res. , – . hoppler, s., and kavanagh, c.l. ( ). wnt signalling: variety at the core. j. cell sci. , – . johannessen, c.m., johnson, b.w., williams, s.m., chan, a.w., reczek, e.e., lynch, r.c., rioth, m.j., mcclatchey, a., ryeom, s., and cichowski, k. ( ). torc is essential for nf -associated malignancies. curr. biol. , – . johansson, g., mahller, y.y., collins, m.h., kim, m.o., nobukuni, t., perent- esis, j., cripe, t.p., lane, h.a., kozma, s.c., thomas, g., and ratner, n. ( ). effective in vivo targeting of the mammalian target of rapamycin pathway in malignant peripheral nerve sheath tumors. mol. cancer ther. , – . johnson, d.g., and walker, c.l. ( ). cyclins and cell cycle checkpoints. annu. rev. pharmacol. toxicol. , – . joseph, n.m., mosher, j.t., buchstaller, j., snider, p., mckeever, p.e., lim, m., conway, s.j., parada, l.f., zhu, y., and morrison, s.j. ( ). the loss of nf transiently promotes self-renewal but not tumorigenesis by neural crest stem cells. cancer cell , – . kijima, t., maulik, g., ma, p.c., tibaldi, e.v., turner, r.e., rollins, b., sattler, m., johnson, b.e., and salgia, r. ( ). regulation of cellular proliferation, cytoskeletal function, and signal transduction through cxcr and c-kit in small cell lung cancer cells. cancer res. , – . koshiba, t., hosotani, r., miyamoto, y., ida, j., tsuji, s., nakajima, s., kawa- guchi, m., kobayashi, h., doi, r., hori, t., et al. ( ). expression of stromal cell-derived factor and cxcr ligand receptor system in pancreatic cancer: a possible role for tumor progression. clin. cancer res. , – . laverdiere, c., hoang, b.h., yang, r., sowers, r., qin, j., meyers, p.a., hu- vos, a.g., healey, j.h., and gorlick, r. ( ). messenger rna expression levels of cxcr correlate with metastatic behavior and outcome in patients with osteosarcoma. clin. cancer res. , – . le, l.q., and parada, l.f. ( ). tumor microenvironment and neurofibroma- tosis type i: connecting the gaps. oncogene , – . le, l.q., shipman, t., burns, d.k., and parada, l.f. ( ). cell of origin and microenvironment contribution for nf -associated dermal neurofibromas. cell stem cell , – . le, l.q., liu, c., shipman, t., chen, z., suter, u., and parada, l.f. ( ). susceptible stages in schwann cells for nf -associated plexiform neurofi- broma development. cancer res. , – . lee, m.h., and yang, h.y. ( ). regulators of g cyclin-dependent kinases and cancers. cancer metastasis rev. , – . li, y.m., pan, y., wei, y., cheng, x., zhou, b.p., tan, m., zhou, x., xia, w., hor- tobagyi, g.n., yu, d., and hung, m.c. ( ). upregulation of cxcr is essen- tial for her -mediated tumor metastasis. cancer cell , – . liu, c., li, y., semenov, m., han, c., baeg, g.h., tan, y., zhang, z., lin, x., and he, x. ( ). control of beta-catenin phosphorylation/degradation by a dual- kinase mechanism. cell , – . mantripragada, k.k., spurlock, g., kluwe, l., chuzhanova, n., ferner, r.e., frayling, i.m., dumanski, j.p., guha, a., mautner, v., and upadhyaya, m. ( ). high-resolution dna copy number profiling of malignant peripheral nerve sheath tumors using targeted microarray-based comparative genomic hybridization. clin. cancer res. , – . müller, a., homey, b., soto, h., ge, n., catron, d., buchanan, m.e., mcclana- han, t., murphy, e., yuan, w., wagner, s.n., et al. ( ). involvement of che- mokine receptors in breast cancer metastasis. nature , – . obaya, a.j., and sedivy, j.m. ( ). regulation of cyclin-cdk activity in mammalian cells. cell. mol. life sci. , – . oh, j.w., drabik, k., kutsch, o., choi, c., tousson, a., and benveniste, e.n. ( ). cxc chemokine receptor expression and function in human astro- glioma cells. j. immunol. , – . peled, a., wald, o., and burger, j. ( ). development of novel cxcr - based therapeutics. expert opin. investig. drugs , – . righi, e., kashiwagi, s., yuan, j., santosuosso, m., leblanc, p., ingraham, r., forbes, b., edelblute, b., collette, b., xing, d., et al. ( ). cxcl /cxcr blockade induces multimodal antitumor effects that prolong survival in an immunocompetent mouse model of ovarian cancer. cancer res. , – . rubin, j.b., and gutmann, d.h. ( ). neurofibromatosis type - a model for nervous system tumour formation? nat. rev. cancer , – . schrader, a.j., lechner, o., templin, m., dittmar, k.e., machtens, s., mengel, m., probst-kepper, m., franzke, a., wollensak, t., gatzlaff, p., et al. ( ). cxcr /cxcl expression and signalling in kidney cancer. br. j. cancer , – . cell , – , february , ª elsevier inc. http://dx.doi.org/ . /j.cell. . . http://dx.doi.org/ . /j.cell. . . sehgal, a., keener, c., boynton, a.l., warrick, j., and murphy, g.p. ( ). cxcr- , a chemokine receptor, is overexpressed in and required for prolifer- ation of glioblastoma tumor cells. j. surg. oncol. , – . sengupta, r., dubuc, a., ward, s., yang, l., northcott, p., woerner, b.m., kroll, k., luo, j., taylor, m.d., wechsler-reya, r.j., and rubin, j.b. ( ). cxcr activation defines a new subgroup of sonic hedgehog-driven medul- loblastoma. cancer res. , – . serra, e., rosenbaum, t., winner, u., aledo, r., ars, e., estivill, x., lenard, h.g., and lázaro, c. ( ). schwann cells harbor the somatic nf mutation in neurofibromas: evidence of two different schwann cell subpopulations. hum. mol. genet. , – . sherr, c.j. ( ). d-type cyclins. trends biochem. sci. , – . singh, s., singh, u.p., grizzle, w.e., and lillard, j.w., jr. ( ). cxcl - cxcr interactions modulate prostate cancer cell migration, metalloprotei- nase expression and invasion. lab. invest. , – . srivastava, a.k., and pandey, s.k. ( ). potential mechanism(s) involved in the regulation of glycogen synthesis by insulin. mol. cell. biochem. , – . taichman, r.s., cooper, c., keller, e.t., pienta, k.j., taichman, n.s., and mccauley, l.k. ( ). use of the stromal cell-derived factor- /cxcr pathway in prostate cancer metastasis to bone. cancer res. , – . tonsgard, j.h. ( ). clinical manifestations and management of neurofibro- matosis type . semin. pediatr. neurol. , – . vogel, k.s., klesse, l.j., velasco-miguel, s., meyers, k., rushing, e.j., and parada, l.f. ( ). mouse tumor model for neurofibromatosis type . science , – . wang, z., ma, q., liu, q., yu, h., zhao, l., shen, s., and yao, j. ( ). blockade of sdf- /cxcr signalling inhibits pancreatic cancer progression in vitro via inactivation of canonical wnt pathway. br. j. cancer , – . cell , – , february , ª elsevier inc. wang, y., kim, e., wang, x., novitch, b.g., yoshikawa, k., chang, l.s., and zhu, y. ( ). erk inhibition rescues defects in fate specification of nf -defi- cient neural progenitors and brain abnormalities. cell , – . warrington, n.m., woerner, b.m., daginakatte, g.c., dasgupta, b., perry, a., gutmann, d.h., and rubin, j.b. ( ). spatiotemporal differences in cxcl expression and cyclic amp underlie the unique pattern of optic glioma growth in neurofibromatosis type . cancer res. , – . zeelenberg, i.s., ruuls-van stalle, l., and roos, e. ( ). the chemokine receptor cxcr is required for outgrowth of colon carcinoma micrometasta- ses. cancer res. , – . zheng, h., chang, l., patel, n., yang, j., lowe, l., burns, d.k., and zhu, y. ( ). induction of abnormal proliferation by nonmyelinating schwann cells triggers neurofibroma formation. cancer cell , – . zhou, y., larsen, p.h., hao, c., and yong, v.w. ( ). cxcr is a major che- mokine receptor on glioma cells and mediates their survival. j. biol. chem. , – . zhu, y., and parada, l.f. ( ). neurofibromin, a tumor suppressor in the nervous system. exp. cell res. , – . zhu, y., ghosh, p., charnay, p., burns, d.k., and parada, l.f. ( ). neuro- fibromas in nf : schwann cell origin and role of tumor environment. science , – . zou, c.y., smith, k.d., zhu, q.s., liu, j., mccutcheon, i.e., slopis, j.m., meric-bernstam, f., peng, z., bornmann, w.g., mills, g.b., et al. ( ). dual targeting of akt and mammalian target of rapamycin: a potential thera- peutic approach for malignant peripheral nerve sheath tumor. mol. cancer ther. , – . cxcr /cxcl mediate autocrine cell- cycle progression in nf -associated malignant peripheral nerve sheath tumors introduction results cxcr in nf -deficient mpnst tumors cxcr knockdown impairs cell proliferation and attenuates tumorigenesis cxcr depletion alters the mpnst cell cycle cyclin d expression is regulated by cxcr cxcr activates the akt/gsk- β/β-catenin network cxcl activates cxcr in an autocrine loop pharmacological inhibition of cxcr arrests mpnst proliferation and tumor growth conserved signaling pathway activation in human mpnst discussion cxcr /cxcl : an mpnst autocrine loop cxcr promotes mpnst proliferation via pi k and gsk- β experimental procedures mpnst mouse models skp mpnst model smpnst allograft model cisnp mpnst model amd and doxycycline treatment in vivo; measurement of tumor volume amd treatment of mpnst allograft model amd treatment of gemm supplemental information acknowledgments references wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ microsoft word - hhe bf.rtf further section hum. hered. ; : - subject index abo groups, andhra pradesh , --, himachal pradesh abortions and tfc subtypes achromatopsia, congenital acp groups, andhra pradesh --, belgium --, pyreneans --, west bengal ada groups, belgium --, pyreneans affective disorders and blood groups afghanistan, properdin factor b ag groups, belgium - -‚ south african negroes and indians ak groups, affective disorders --, andhra pradesh --, belgium --, pyreneans albumin variants in south india alpha- -antitrypsin levels in pim subtypes types in newborns sweden ‚ see pi types - - thalassaemia and hb new york am groups in siberia amish mennonites, dermatoglyphics andhra pradesh, blood and serum groups , ‚ arabs, ina antigen bantu-speaking negroids, ag groups basques, blood and serum groups belgians, protein and enzyme groups bengal, west, acp groups beta-thalassaemia and gpt -- intermedia --, turkey bf groups, afghanistan - -‚ parentage testing brachydactyly breast cancer and hp groups cameroon, sickle cell trait and g- -pd deficiency -‚ hbs, g- -pd deficiency and malaria canada, pi types , cancer of breast and hp groups c esterase in pyreneans chile, haemophilia a cholinesterase, serum, in affective disorders chromosome no. , regional duplication -- ptrisomy consanguinity and mortality -‚ england c in norwegian lapps c deficiency, familial, and lipodystrophy - groups, uremia --, belgium c groups in graves’ disease denmark, galt groups dental disease and salivary proteins dermatoglyphics, absent d triradius in sibs -‚ amish mennonites -‚ bilateral assymmetry -‚ genetics -‚ hypospadias -‚ maharashtra - of sole, linkage study diabetes, association with glo groups esd groups, andhra pradesh --, belgium --, france --, west bengal fertility and consanguinity finland, glo groups france, esd and glo groups galactose- -phosphate uridyl transferase types in denmark gamma-gct groups gc groups, andhra pradesh --, belgium - -‚ himachal pradesh --, iceland gene frequency estimation genotype probabilities in pedigrees, calculation glo groups, associations with graves’ disease and diabetes --, finland --, france subject index --, iceland --, iraq gm groups, belgium --, siberia - -‚ singapore and sri lanka gpt groups, belgium --, italy --, japan --, pyreneans graves’ disease, c groups --, glo groups greece, serum protein and enzyme groups gsh-px activity in israeli populations g- -pd, affective disorders -‚ afro-americans -.cameroon -‚ pyreneans -‚ south vietnamese -‚ turkey - interactions with sickle cell trait and malaria , : haemophilia a in chile hb new york and alpha-thalassaemia s in cameroon types in turkey heritability estimates himachal pradesh, abo groups hp groups, affective disorders --, andhra pradesh , --, belgium - -‚ breast cancer --‚ himachal pradesh --.turkey - levels, africans -o‚mali hypospadias, dermatoglyphics iceland, gc groups -‚ glo groups immunoglobulins, ige twin study ina antigen in iranians and arabs india, andhra pradesh, albumin, blood and serum groups , , , himachal pradesh, abo groups maharashtra, dermatoglyphics -mem groups punjabis, gm and km groups west bengal, enzyme groups iranians, ina antigen iraq, glo groups israeli populations, gsh-px activity italy, gpt groups japan, gpt groups km groups, belgium --, siberia - -‚ singapore and sri lanka lap in affective disorders lapps, norwegians, c types ldh groups, affective disorders --, andhra pradesh --, west bengal linkage, beta-thalassaemia and gpt locus - dermatoglyphics of soles and blood groups lipodystrophy and c deficiency lung disease and pi types mdh, pyreneans -‚ west bengal mem groups in india mn groups in andhra pradesh monoamine oxidase activity, twin study nadh diaphorase in pyreneans norway, c types in lapps pgd groups, belgium pgmi groups, andhra pradesh --.belgium --.pyreneans --‚ west bengal phi groups in andhra pradesh pi m, subtypes and alpha- -antitrypsin levels -.variant - groups, canada --, lung disease placental alkaline phosphatase variants properdin factor b in afghanistan punjabis, gm and km groups pyreneans, blood, serum and enzyme groups rh groups, andhra pradesh , - -‚ himachal pradesh salivary proteins and dental disease schizophrenia, genetic model subject index serum cholinesterase, pyreneans siberia, am, gm and km groups sickle cell trait and g- -pd deficiency in cameroon , singapore, gm and km groups -pgd, affective disorders -‚ andhra pradesh -‚ pyreneans sjögren-larsson syndrome sod groups in pyreneans somatotype components, family study south africa, ag groups sri lanka, gm and km groups sweden, achromatopsia -‚ pi types jung disease tf c groups, andhra pradesh , --, belgium --, himachal pradesh subtypes, abortions -‚ us black and whites tgp in pyreneans triradius d, see dermatoglyphics trisomy p turkey, beta-thalassaemia, g- -pd, hb variants and hp groups twin studies, ige levels --, mao activity - zygosity diagnosis uremia and c groups vietnamese, south, g- -pd deficiency wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ original article linkage analysis of circulating levels of adiponectin in hispanic children me tejero , g cai , hhh göring , v diego , sa cole , ca bacino , nf butte and ag comuzzie department of genetics, southwest foundation for biomedical research, san antonio, tx, usa and department of pediatrics, usda/ars children’s nutrition research center, baylor college of medicine, houston, tx , usa introduction: adiponectin, a hormone produced exclusively by adipose tissue, is inversely associated with insulin resistance and proinflammatory conditions. the aim of this study was to find quantitative trait loci (qtls) that affect circulating levels of adiponectin in hispanic children participating in the viva la familia study by use of a systematic genome scan. methods: the present study included extended families with at least one overweight child between and years old. overweight was defined as body mass index (bmi) th percentile. fasting blood was collected from children from families. adiponectin was assayed by radioimmunoassay (ria) technique in fasting serum. a genome-wide scan on circulating levels of adiponectin as a quantitative phenotype was conducted using the variance decomposition approach. results: the highest logarithm of odds (lod) score ( . ) was found on chromosome q . – q . , and a second significant signal (lod score ¼ . ) was found on chromosome q . – q . . in addition, a signal suggestive of linkage (lod score ¼ . ) was found between q . and q . . after adjustment for bmi-z score, the lod score on chromosome remained unchanged, but the signals on chromosomes and dropped to . and . , respectively. two other signals suggestive of linkage were found on chromosome (lod score ¼ . ) and (lod score ¼ . ). although the region on chromosome has been associated with obesity and diabetes-related traits in adult populations, this is the first observation of linkage in this region for adiponectin levels. our suggestive linkages on chromosomes and replicate results for adiponectin seen in other populations. the influence of loci on chromosomes and on circulating adiponectin seemed to be mediated by bmi in the present study. conclusion: our genome scan in children has identified a novel qtl and replicated qtls in chromosomal regions previously shown to be linked with obesity and type diabetes (t d)-related phenotypes in adults. the genetic contribution of loci to adiponectin levels may vary across different populations and age groups. the strong linkage signal on chromosome is most likely underlain by a gene(s) that may contribute to the high susceptibility of these hispanic children to obesity and t d. international journal of obesity ( ) , – . doi: . /sj.ijo. ; published online august keywords: adiponectin; genetics; linkage; childhood obesity; qtl; genome scan introduction the hormone adiponectin is produced exclusively by adipose tissue and has insulin-sensitizing and anti-inflam- matory properties. as opposed to other adipose tissue products, low circulating levels of this protein are associated with obesity, type diabetes (t d) and the metabolic syndrome. , consistent negative correlations between adi- ponectin, insulin resistance and inflammatory states have been reported. these latter two conditions improve after weight loss with concomitant increase of adiponectin levels. adiponectin structure is similar to tumor necrosis factor-a and seems to have a counter-regulatory activity with respect to this proinflammatory cytokine. as observed in adults, obese children and adolescents have lower adipo- nectin levels than their normal weight counterparts, and serum adiponectin is positively correlated with insulin sensitivity and high-density lipoprotein, and negatively to fasting proinsulin and proinsulin/insulin ratio. a study by reinehr et al. found that weight loss in children is associated with a significant increase of circulating adipo- nectin and a decrease of insulin resistance. a significant heritability for adiponectin levels in hispanic children has been previously reported by our group. heritability (h ) of serum adiponectin was . . received november ; revised may ; accepted june ; published online august correspondence: dr anthony comuzzie, department of genetics, southwest foundation for biomedical research, nw loop , po box , san antonio, tx - , usa. e-mail: agcom@darwin.sfbr.org international journal of obesity ( ) , – & nature publishing group all rights reserved - / $ . www.nature.com/ijo (p ¼ . � � ). adiponectin differed by age (p ¼ . ), sex (p ¼ . ) and weight (p ¼ . ). numerous investigations have analyzed the genetic component of obesity and t d- related phenotypes in humans and other species. kissebah et al. conducted linkage analyses on phenotypes of the metabolic syndrome, including body weight, hip and waist circumference, insulin and leptin levels. the multipoint linkage analyses of these phenotypes identified significant logarithm of odds (lod) scores on chromosome at – cm. vasseur et al. reported association between some single nucleotide polymorphisms (snps) and circulating levels of this adipose tissue protein. four studies have conducted linkage analysis using adiponectin levels as a phenotype. comuzzie et al. identified regions on chromo- somes and , and secondary signals on chromosomes and in caucasian adults. a study by pollin et al. in old order amish found linkage of adiponectin levels to chromo- some p , and an investigation in pima indians, a population characterized by a high prevalence of obesity and diabetes, found significant linkage to chromosome p and suggestive evidence of linkage on chromosomes , and . a fourth study by chuang et al. found suggestive linkage of adiponectin on chromosome at cm for chinese (lod ¼ . ) and on chromosome at cm for japanese adults. some of these regions have been previously reported in association with obesity and diabetes-related phenotypes. the present study is the first linkage analysis on circulating levels of adiponectin in children. the aim of the present investigation was to find quantitative trait loci (qtls) that affect circulating levels of adiponectin in hispanic children participating in the viva la familia study by use of a systematic genome scan. materials and methods study design and subjects genetic and environmental factors influencing fasting serum adiponectin were investigated in a subsample of children from the enrolled in the viva la familia study, which was designed to genetically map childhood obesity in the hispanic population. each family was ascertained on an overweight proband between the ages and years using a bivariate ascertainment scheme (i.e., th percentile for body mass index (bmi) and th percentile for fat mass. once identified, the overweight proband and all siblings, – years of age, and their parents were invited to the children’s nutrition research center for a tour and full explanation of the study. all children and their parents gave written informed consent. the protocol was approved by the institutional review board for human subject research for baylor college of medicine and affiliated hospitals. the overweight proband and all siblings were then characterized for body size, and endophenotypes associated with the development of obesity. here, we report our findings on the linkage analysis using adiponectin levels as a phenotype. phenotyping body weight was measured with a digital balance and registered to the nearest . kg. and height to the nearest mm was measured with a stadiometer. fasting serum adiponectin levels were measured by radioimmunoassay (ria) (linco research inc., st charles, mo, usa). genotyping the participants (children and their parents) were genotyped in the present study. dna was isolated from whole blood using the wizard genomic dna purification kit (promega, madison, wi, usa). to genotype each participant, we used the autosomal markers from the abi prism linkage mapping set-md version . (applied biosystems, foster city, ca, usa). this mapping set consists of fluorescently labeled polymerase chain reaction (pcr) primers that amplify dinucleotide single tandem repeats (strs) selected from the genethon human linkage map. the set is designed to create a map with markers spaced an average of cm apart (range . – . cm). dna from study participants was arrayed on -well pcr plates using the robbins hydra- microdispenser (sunnyvale, ca, usa). each marker was amplified in a separate pcr reaction to avoid the preferential amplification that can occur in combined reactions. pcr reactions used the true allele pcr premix (applied biosystems), and amplification oc- curred in applied biosystems thermocyclers, according to the manufacturer’s specifications. after pcr, the products of separate pcr reactions, for each individual, were pooled using the robbins hydra- microdispenser, and a labeled size standard was added to each pool. the pooled pcr products were loaded into an abi prism genetic analyzer for laser-based automated genotyping. the strs were detected and quantified by fluorescent emissions, their sizes were estimated by comparison with the labeled size standard and genotypes were scored using the genotyper software package (applied biosystems). pedigree errors were detected using prest (pedigree relationship statistical tests), which employs likelihood- based inference statistics for genome-wide identity-by- descent (ibd) allele sharing. pedigree errors were resolved by making changes to the existing pedigree structure that required the fewest assumptions and that were consistent with the genetic data. using simwalk genotypes that resulted in mendelian inconsistencies and spurious double recombinants were blanked if not resolved by the laboratory. we used loki to compute the ibd matrix needed for our linkage analyses. all three programs, prest, simwalk and loki, require information on the relative distances between linkage analysis of circulating levels me tejero et al international journal of obesity markers. we used the sex-averaged chromosomal maps obtained at the marshfield center for medical genetics. analysis using a variance component model, we tested the null hypothesis that the additive genetic variance owing to a qtl (sq ) equals zero or absence of linkage by comparing the likelihood of this restricted model with that of a model in which sq is estimated. the difference between the two log likelihoods produces a lod score that is the equivalent of the classical lod score of linkage analysis. twice the difference in loge likelihoods of these models yields a test statistic that is asymptotically distributed as a mixture of a w variable with df and a point mass at zero. a genome scan was conducted in solar using adiponec- tin levels as a phenotype and sex, age, age and their interactions as covariates. empirical lod score adjustment was conducted by the method described by blangero et al. the effect of bmi-z score was tested by including it as a covariate and repeating the genome scan. the chromosomal region investigated for positional candidate genes was defined as the lod score unit support interval. the selection of positional candidate genes was conducted using the ncbi map viewer database. results the present study included a total of children from families, with approximately % each of boys and girls in the sample. descriptive data of the cohort are shown in table . table includes information on the relative pairs in this study. the average age of the children was . years. the distribution across the tanner stages of development was as follows: for the genital/breast criteria children corresponded to tanner stages i, to ii, to stage iii, to stage iv and to tanner stage v. for the pubic hair criteria, children were classified as tanner stage i, as ii, as iii, as iv and as v. the analysis of the effect of age, sex, tanner stage and body composition on adiponectin levels in these children showed a significant difference between children classified as tanner stage i and ii–v. in the present study, the effect of this variable was not significant after adjustment for sex, age and bmi-z score. mean fasting serum levels of adiponectin was . mg/ml in boys and . mg/ml in girls with a significant heritability of . . (p ¼ . � � ). results of the linkage analysis are shown in figure . the highest lod score was observed on chromosome q – between markers d s and d s , with an lod support interval from to cm (lod ¼ . ). a second signal was identified on table anthropometry of the non-overweight and overweight hispanic children n boys, girls, n ¼ n ¼ age (years) . . . . weight (kg) . . . . height (m) . . . . bmi (kg/m ) . . . . bmi-z score . . . . abbreviations: bmi, body mass index. mean s.d. table relative pairs in the analyzed cohort of hispanic children in the viva la familia study relationship n siblings half-siblings half-avuncular first cousins half-first cousins half-siblings and half-cousins identical sibpair cm cm lod lod lod figure string plot of fasting serum adiponectin in hispanic children using sex, age and age as covariates. lod scores were empirically adjusted using simulations. linkage analysis of circulating levels me tejero et al international journal of obesity chromosome , between markers d s and d s ( – cm, lod ¼ . ), and finally a signal suggestive of linkage was observed on the region d s –d s on chromosome (lod ¼ . ). after adjustment for bmi-z score (figure ), the signal on chromosome remained unchanged; however, the signal dropped on chromosomes and to lod scores of . and . , respectively. two other regions suggestive of linkage were found on chromosomes and . on chromosome , suggestive linkage was found between markers d and d s ( – cm) with an lod score of . , and on chromosome a signal was detected between d s and d s ( . – . cm) with a lod score of . . figure shows the marker distribution and second genome scan on chromosome . other regions showing lod scores . were found on chromosomes q ( . ), q ( . ) and q ( . ). discussion few linkage studies on childhood obesity and related phenotypes have been conducted until now. the present study represents the first genome-wide search for adiponec- tin levels in children. this population is at high risk for the development of obesity-related comorbidities, such as t d. the children in this investigation showed significant meta- bolic abnormalities in association with excessive adiposity, as reported previously. given the high heritability of fasting serum adiponectin, and its inverse associations with insulin resistance, dyslipidemia and blood pressure in the viva la familia study, , and the high prevalence of obesity and t d in the united states hispanic population, we sought to identify genetic loci contributing to circulating adiponectin in hispanic children. previous investigations have found significant linkage for adiponectin in adults (table ). – the present analysis identified three new regions on chromosomes , and linked to adiponectin levels in hispanic children, and replicated two regions on chromosomes and reported in adults. our strongest linkage for fasting serum adiponectin was on chromosome and its strength was not diminished after adjustment for bmi-z score. although this is the first identification of a linkage signal on chromosome for adiponectin, this chromosomal region has been linked with obesity and diabetes-related traits (table ). stein et al. identified moderate evidence for linkage on chromosome near marker d s ) using five components of the metabolic syndrome. their analysis confirmed observations by other investigators who reported significant linkage of body size, diabetes mellitus and insulin resistance to chromosome q. significant linkage to chromosome q was found for obesity in subjects with t d in a study of siblings by van tilburg et al. after fine mapping this cm cm lod lod lod figure string plot of fasting serum adiponectin of hispanic children using sex, age, age and bmi-z score as covariates. lod scores were empirically adjusted using simulations. chromosome chromosome position (cm) l o d d s d s d s d s d s d s d s d s d s d s d s d s d s d s d s d s d s d s figure markers on chromosome . linkage analysis of circulating levels me tejero et al international journal of obesity table linkage studies for circulating adiponectin levels in adults population identified chromosomes map distance (cm) lod score lod score after adjustment for bmi reference white northern . comuzzie european ancestry . . . pima indians . . lindsay . . . . . . hawaiian . . chuang japanese . . . . chinese . . amish . pollin . . . . abbreviations: bmi, body mass index; lod, logarithms of odds. table replications of previously reported qtls linked to obesity and diabetes-related phenotypes chromosomal region markers phenotype population lod score reference q – q . d s –d s bmi white . van tilburg q –q f f f f f q –q d s bmi pima indians . norman q – d s body fat nigerian . adeyemo p . – q d s metabolic syndrome white p ¼ . stein bmi white (amish) p ¼ . platte q . d s body fat % pima indians . norman body fat % pima indians . norman q . d s bmi pima indians . lindsay q . d s h energy expenditure pima indians . norman q . d s bmi pima indians . lindsay bmi whites . stone bmi mexican-american . arya q . d s bmi f . stone p . d s obesity whites and npl ¼ . dong african-american p ¼ . price whites and african– american p . d s obesity white children and adolescents . saar p . d s bmi french population . hager p . d s obesity f . hinney q . d s bmi-adjusted leptin old order amish . hsueh q d s – bmi african . palmer d s apnea–hypopnea index american . p . d s bmi mexican–american . mitchell q . d s leptin mexican–american . comuzzie q . d s bmi mexican–american p ¼ . gorlova q . d s bmi whites . chagnon q d s young onset type diabetes british/irish descents . frayling p . d s bmi, sbp, dbp whites . turner q . d s bmi kg/m whites npl ¼ . li q . d s obesity finns . ohman q . d s bmi and blood pressure whites . north q mc r respiratory quotient whites p ¼ . chagnon q – d s fasting glucose european americans . li abbreviations: bmi, body mass index; dbp, diastolic blood pressure; lod, logarithms of odds; npl, non-parametric linkage; qtl, quantitative trait loci; sbp, systolic blood pressure. linkage analysis of circulating levels me tejero et al international journal of obesity region, they found a lod score of . on chromosome q –q using bmi as a phenotype. the combined phenotype ‘diabesity’ had a highly sig- nificant lod score of . at q – in pima indians. this study reported snps associated with bmi and a second region harboring a cluster of snps related to diabetes in this population. this group sequenced physiological candi- date genes in this region encoding serotonin receptor, dopamine receptor, three apolipoproteins, three zinc-finger proteins, two potassium-channel proteins and glucose- - phosphate transferase. none of these candidates had nucleo- tide variants that account for the linkage signal for bmi and diabetes. one of the candidates in the q – region is the dopamine d receptor gene (drd ). jenkinson et al studied polymorphisms of this gene in pima indians, and determined that heterozygotes at the ser cysdrd poly- morphism had a higher bmi than homozygotes. the list of positional candidates proposed in the present study is included in table . adipocyte-specific adhesion molecule (asam) is specifically expressed in adipose tissue, the transforming growth factor beta regulator regulates the development and homeostasis of tissues, the endothelial cell adhesion molecule is a type i transmembrane protein and is a new member of the immunoglobulin superfamily, similar to asam, and is considered an adhesion mole- cule. cdon (omim ) cell adhesion molecule- related/downregulated oncogenes is a cell surface receptor of the immunoglobulin (ig)/fibronectin type iii repeat family involved in myogenic differentiation. toll-interleu- kin receptor domain/adaptor protein (tirap) (omim ), which is a protein involved in the inflammatory response in mice. potassium inwardly rectifying channel (kcnj ) (omim ) are important regulator of resting membrane potential and cell excitability and interacts with the phosphatidylinositol , -biphosphate (pip ). most of these new candidates seem to be associated to the immune response. our genome scan replicated linkage findings in adults. the qtl on chromosome for adioponectin was previously reported in pima indians and hawaiian japanese adult subjects. in contrast to our study, adjustment for bmi did not alter their lod scores. other phenotypes such as bmi and blood pressure have been linked to this chromosome region. , the region localized on chromosome has been linked to adiponectin levels in pima indians, white americans of northern european ancestry and old order amish. in addition, linkage has been reported for other obesity-related phenotypes on this chromosomal region in numerous studies, including a previous investigation in children and adolescents. the region found on chromosome between markers d s and d s has shown significant linkage with the phenotypes bmi and leptin. a study by frayling et al. identified a locus on chromosome q linked to early-onset t d in a study conducted in the united kingdom. the region on chromosome has been linked to bmi in a previous study in caucasians of northern european back- ground. the investigation by chuang et al. identified significant linkage signals for adiponectin levels in hawaiian japanese population on chromosomes p and p (table ). the signals on chromosome were located at and cm and do not overlap the region found in our study. that study reported that the lod score on chromosome remained unchanged after adjustment for age, sex and bmi, whereas the signal on chromosome decreased from . to . , suggesting that the contribution of this qtl may be mediated by body mass. ohman et al. reported suggestive linkage in this region using obesity as a phenotype. this region has been linked to the respiratory quotient in caucasians and to fasting glucose. the lod score on the chromosome regions found on chromosomes and dropped to nonsignificant values after adjustment for bmi-z table positional candidates on chromosome chromosome markers lod score distance in cm candidates q – d s –d s . – asam – adipocyte-specific adhesion molecule tbrg – transforming growth factor beta regulator esam – endothelial cell adhesion molecule cdon – cell adhesion molecule-related/down regulated oncogenes tirap – toll-interleukin- receptor domain/adaptor protein kcnj – potassium inwardly rectifying channel table linkage findings for fasting serum adiponectin in hispanic children chromosome distance (cm) flanking markers lod score lod score model model d s . . d s d s . . d s d s . . d s d s . . d s d s . . d s model : sex , age, age as covariates. model : sex, age, age and bmi-z score as covariates. linkage analysis of circulating levels me tejero et al international journal of obesity score, interestingly both of them have been linked to this trait in previous studies in adults. in summary, the present investigation identified novel chromosomal regions linked with circulating adiponectin levels on chromosomes , and , and suggestive of linkage on chromosomes and . the last two replicate findings in other populations. all the chromosome regions identified in the present study have been linked to obesity and diabetes-related phenotypes in adults across different ethnicities. further fine mapping of these regions will allow the identification of genetic polymorphisms that influence the circulating levels of adiponectin. acknowledgements we thank the families who participated in this study, and to acknowledge the contributions of mercedes alejandro and marilyn navarrete for study coordination, and sopar seribu- tra for nursing and theresa wilson, tina ziba, maurice puyau, firoz vohra, anne adolph, roman shypailo, joann pratt and maryse laurent for technical assistance, grace meixner and daniel zamarripa for genotyping and jennifer darling for the data analysis. this work is a publication of the us department of agriculture (usda)/agricultural research service (ars) children’s nutrition research center, department of pediatrics, baylor college of medicine and texas children’s hospital, houston, tx, usa. this project was funded with federal funds from the nih r dk and from usda/ars under cooperative agreement - - - . the contents of this publication do not necessa- rily reflect the views or policies of the usda, nor does mention of trade names, commercial products, or organiza- tions imply endorsement by the us government. references kershaw e, flier j. adipose tissue as an endocrine organ. j clin endocrinol metabol ; : – . esposito k, pontillo a, di palo c, giugliano g, masella m, marfella r et al. effect of weight loss and lifestyle changes on vascular inflammatory markers in obese women: a randomized trial. jama ; : – . hotta k, funahashi t, bodkin nl, ortmeyer hk, arita y, hansen bc et al. circulating concentrations of the adipocyte protein adiponectin are decreased in parallel with reduced insulin sensitivity during the progression to type diabetes in rhesus monkeys. diabetes ; : – . arita y, kihara s, ouchi n, takahashi m, maeda k, miyagawa j et al. paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. biochem biophys res commun ; : – . bacha f, saad r, gungor n, arslanian s. adiponectin in youth. relationship to visceral adiposity, insulin sensitivity and b-cell function. diabetes care ; : – . reinehr t, roth c, menke t, adler w. adiponectin before and after weight loss in obese children. j clin endocrinol metab ; : – . butte nf, comuzzie ag, cai g, cole sa, mehta nr, bacino ca et al. genetic and environmental factors influencing fasting serum adiponectin in hispanic children. j clin endocrinol metabol ; in press. perusse l, rankinen t, zuberi a, chagnon yc, weisnagel sj, argyropoulos g et al. the human obesity gene map: the map. obes res ; : – . kissebah ah, sonnenberg ge, myklebust j, goldstein m, broman k, james rg et al. quantitative trait loci on chromosomes and influence phenotypes of the metabolic syndrome. proc natl acad sci usa ; : – . vasseur f, lepretre f, lacquemant c, froguel p. single nucleotide polymorphism haplotypes in the both proximal promoter and exon of the amp gene modulate adipocyte-secreted adipo- nectin hormone levels and contribute to the genetic risk for type diabetes in french caucasians. hum mol genet ; : – . comuzzie ag, funahashi t, sonnenberg g, martin lj, jacob hj, black ae et al. the genetic basis of plasma variation in adiponectin, a global endophenotype for obesity and the metabolic syndrome. j clin endocrinol metab ; : – . pollin ti, tanner k, o’connell jr, ott sh, damcott cm, shuldiner ar et al. linkage of plasma adiponectin levels to q explained by association with variation in the apm gene. diabetes ; : – . lindsay rs, funahashi t, krakoff j, matsuzawa y, tanaka s, kobes s et al. genome-wide linkage analysis of serum adiponectin in the pima indian population. diabetes ; : – . chuang lm, chiu yf, sheu wh, hung yj, ho lt, grove j et al. biethnic comparisons of autosomal genomic scan for loci linked to plasma adiponectin in populations of chinese and japanese origin. j clin endocrinol metab ; : – . dib c, faure s, fizames c, samson d, drouot n, vignal a et al. a comprehensive genetic map of the human genome based on , microsatellites. nature ; : – . sun l, wilder k, mcpeek ms. enhanced pedigree error detection. hum hered ; : – . sobel e, papp jc, lange k. detection and integration of genotyping errors in statistical genetics. am j hum genet ; : – . heath sm. markov chain monte carlo segregation and linkage analysis for oligogenic models. am j hum genet ; : – . hopper jl, mathews jd. extensions to multivariate normal models for pedigree analysis. am j hum genet ; : – . blangero j, williams jt, almasy l. robust lod scores for variance component-based linkage analysis. genet epidemiol ; : s –s . butte nf, comuzzie ag, cole sa, mehta nr, tejero me, bastarrachea r et al. quantitative genetic analysis of the metabolic syndrome in hispanic children. ped res ; : – . ogden cl, flegal km, carroll md, johnson cl. prevalence and trends in overweight among us children and adolescents, – . jama ; : – . stein cm, song y, elston rc, jun g, tiwari hk, iyengar sk. structural equation model-based genome scan for the metabolic syndrome. bmc genet ; : s –s . imperatore g, knowler wc, kobes s, bennett ph, hanson rl. genome-wide linkage analysis of factors characterizing the metabolic syndrome among pima indians [abstract]. diabetes ; (suppl): a . ghosh s, watanabe rm, valle tt, hauser er, magnuson vl, langefeld cd et al. the finland–united states investigation of non-insulin-dependent diabetes mellitus genetics (fusion) study. ii an autosomal genome scan for genes that predispose to type diabetes. am j human genet ; : – . linkage analysis of circulating levels me tejero et al international journal of obesity watanabe rm, ghosh s, langefeld cd, valle tt, hauser er, magnuson vl et al. the finland–united states investigation of non-insulin-dependent diabetes mellitus genetics (fusion) study. ii an autosomal genome scan for diabetes-related quantitative trait loci. am j human genet ; : – . van tilburg jh, sandkuijl la, stengman em, pearson pl, van haeften tw, wijmenga c. variance component analysis of obesity in type diabetes confirms loci on chromosomes q and q. obes res ; : – . baier l, kovacs p, wiedrich c, cray k, schemidt a, shen gq et al. positional cloning of an obesity/diabetes susceptibility gene(s) on chromosome in pima indians. ann ny acad sci ; : – . jenkinson cp, hanson r, cray k, wiedrich c, knowler wc, bogardus c et al. association of dopamine d receptor poly- morphisms ser cys and taqia with obesity or type diabetes mellitus in pima indians. int j obes relat metab disord ; : – . katoh m, katoh m. igsf gene, frequently up-regulated in intestinal-type gastric cancer, encodes adhesion molecule homo- logous to cxadr, flj and esam. int j oncol ; : – . massague j. tgf-beta signal transduction. annu rev biochem ; : – . hirata k, ishida t, penta k, rezaee m, yang e wohlgemuth j, quertermous t. cloning of an immunoglobulin family adhesion molecule selectively expressed by endothelial cells. j biol chem ; : – . kang js, mulieri pj, hu y, taliana l, krauss rs. boc, an ig superfamily member, associates with cdo to positively regulate myogenic differentiation. embo j ; : – . yamamoto m, sato s, hemmi h, sanjo h, uematsu s, kaisho t et al. essential role for tirap in activation of the signa- ling cascade shared by tlr and tlr . nature ; : – . lopes cm, zhang h, rohacs t, jin t, yang j, logothetis de. alterations in conserved kir channel-pip interactions underlie channelopathies. neuron ; : – . turner s, kardia s, boerwincle e de am. multivariate linkage analysis of blood pressure and body mass index. genet epidemiol ; : – . li w, dong c, li d, zhao h, price r. an obesity-related locus in chromosome region q – . diabetes ; : – . saar k, geller f, ruschendorf f, reis a, friedel s, schauble n et al. genome scan for childhood and adolescent obesity in german families. pediatrics ; : – . stone s, abkevich v, hunt sc, gutin a, russell dl, neff cd et al. a major predisposition to locus for severe obesity, at p –p . am j hum genet ; : – . comuzzie ag, hixson je, almasy l, mitchell bd, mahaney mc, dyer td et al. a major quantitative trait locus determining serum leptin levels and fat mass is located on human chromosome . nat genet ; : – . frayling tm, lindgren cm, chevre jc, menzel s, wishart m, benmezroua y et al. young-onset type diabetes families are the major contributors to genetic loci in the diabetes uk warren genome scan and identify putative novel loci on chromosomes q , q and q . diabetes ; : – . ohman m, oksanen l, kaprio j, koskenvuo m, mustajoki p, rissanen a et al. genome-wide scan of obesity finnish sibpairs reveals linkage to chromosome xq . j clin endocrinol metab ; : – . chagnon yc, chen wj, perusse l, chagnon m, nadeau a, wilkison wo et al. linkage and association studies between the melanocortin receptors and genes and obesity-related phenotypes in the quebec family study. mol med ; : – . li wd, dong c, li d, garrigan c, price ra. a quantitative trait locus influencing fasting plasma glucose in chromosome region q – . diabetes ; : – . norman ra, thompson db, foroud t, garvey wt, bennett ph, bogardus c et al. genome wide search for genes influencing percent body fat in pima indians: suggestive linkage at chromo- some q –q . pima diabetes gene group. am j hum genet ; : – . adeyemo a, luke a, cooper r, wu x, tayo b, zhu x et al. a genome-wide scan for body mass index among nigerian families. obes res ; : – . platte p, papanicolaou gj, johnston j, klein cm, doheny kf, pugh ew et al. a study of linkage and association of body mass index in the old order amish. am j med genet ; c: – . norman ra, tataranni pa, pratley r, thompson db, hanson rl, prochazka m et al. autosomal genomic scan for loci linked to obesity and energy metabolism in pima indians. am j hum genet ; : – . hsueh wc, mitchel b, schneider j, st jean p, pollin ti, ehm mg et al. genome-wide scan of obesity in the old order. amish j clin endocrinol metab ; : – . lindsay rs, kobes s, knowler wc, bennett ph, hanson rl. genome-wide linkage analysis assessing parent-of-origin effects in the inheritance of type diabetes and bmi in pima indians. diabetes ; : – . arya r, duggirala r, jenkinson cp, almasy l, blangero j, o’connell p et al. evidence of a novel quantitative-trait locus for obesity on chromosome p in mexican–americans. am j hum genet ; : – . dong c, wang s, li w, li d, zhao h, price r. interacting genetic loci on chromosomes and influence extreme obesity in humans. am j hum genet ; : – . price ra, li wd, bernstein a, crystal a, golding em, weisberg sj et al. a locus affecting obesity in human chromosome region p . diabetologia ; : – . hager j, dina c, francke s, dubois s, houari m, vatin v et al. a genome-wide scan for human obesity genes reveals a major susceptibility locus on chromosome . nat genet ; : – . hinney a, ziegler a, oeffner f, wedewardt c, vogel m, wulftange h et al. independent confirmation of a major locus for obesity on chromosome . j clin endocrinol metab ; : – . palmer lj, buxbaum sg, larkin ek, patel sr, elston rc, tishler pv et al. whole genome scan for obstructive sleep apnea and obesity in african–american families. am j respir crit care med ; : – . mitchell b, cole sa, comuzzie ag, almasy l, blangero j, maccluer jw et al. a quantitative trait locus influencing bmi maps to the region of the beta- adrenergic receptor. diabetes ; : – . gorlova o, amos c, wang n, shete s, turner s, boerwinkle e. genetic linkage and imprinting effects on body mass index in children and young adults. eur j hum genet ; : – . chagnon yc, rice t, perusse l, borecki ib, ho-kim ma, lacaille m et al. heritage family study. genomic scan for genes affecting body composition before and after training in caucasians from heritage. j appl physiol ; : – . li w, dong c, li d, zhao h, price r. an obesity-related locus on chromosome region q – . diabetes ; : – . north ke, rose km, borecki ib, oberman a, hunt sc, miller mb et al. evidence for a gene on chromosome influencing postural systolic blood pressure change and body mass index. hypertension ; : – . linkage analysis of circulating levels me tejero et al international journal of obesity linkage analysis of circulating levels of adiponectin in hispanic children introduction materials and methods study design and subjects phenotyping genotyping analysis results discussion acknowledgements references innate immunity and asthma risk in amish and hutterite farm children the new england journal of medicine n engl j med ; nejm.org august , established in august , vol. no. the authors’ affiliations are listed in the appendix. address reprint requests to dr. vercelli at the arizona respiratory cen- ter, university of arizona, the bio insti- tute, rm. , e. helen st., tucson, az , or at donata@ email . arizona . edu; to dr. ober at the department of human genetics, university of chicago, e. th st., clsc , chicago, il , or at c-ober@ genetics . uchicago . edu; or to dr. sperling at the department of medi- cine, university of chicago, e. th st., jfk r , chicago, il , or at asperlin@ uchicago . edu. ms. stein, dr. hrusch, and ms. gozdz and drs. von mutius, vercelli, ober, and sperling contributed equally to this article. this article was updated on august , , at nejm.org. n engl j med ; : - . doi: . /nejmoa copyright © massachusetts medical society. background the amish and hutterites are u.s. agricultural populations whose lifestyles are remark- ably similar in many respects but whose farming practices, in particular, are distinct; the former follow traditional farming practices whereas the latter use industrialized farming practices. the populations also show striking disparities in the prevalence of asthma, and little is known about the immune responses underlying these disparities. methods we studied environmental exposures, genetic ancestry, and immune profiles among amish and hutterite children, measuring levels of allergens and endotoxins and assess- ing the microbiome composition of indoor dust samples. whole blood was collected to measure serum ige levels, cytokine responses, and gene expression, and peripheral- blood leukocytes were phenotyped with flow cytometry. the effects of dust extracts obtained from amish and hutterite homes on immune and airway responses were assessed in a murine model of experimental allergic asthma. results despite the similar genetic ancestries and lifestyles of amish and hutterite children, the prevalence of asthma and allergic sensitization was and times as low in the amish, whereas median endotoxin levels in amish house dust was . times as high. differences in microbial composition were also observed in dust samples from amish and hutterite homes. profound differences in the proportions, phenotypes, and func- tions of innate immune cells were also found between the two groups of children. in a mouse model of experimental allergic asthma, the intranasal instillation of dust ex- tracts from amish but not hutterite homes significantly inhibited airway hyperreactiv- ity and eosinophilia. these protective effects were abrogated in mice that were deficient in myd and trif, molecules that are critical in innate immune signaling. conclusions the results of our studies in humans and mice indicate that the amish environment provides protection against asthma by engaging and shaping the innate immune re- sponse. (funded by the national institutes of health and others.) a b s t r a c t innate immunity and asthma risk in amish and hutterite farm children michelle m. stein, b.s., cara l. hrusch, ph.d., justyna gozdz, b.a., catherine igartua, b.s., vadim pivniouk, ph.d., sean e. murray, b.s., julie g. ledford, ph.d., mauricius marques dos santos, b.s., rebecca l. anderson, m.s., nervana metwali, ph.d., julia w. neilson, ph.d., raina m. maier, ph.d., jack a. gilbert, ph.d., mark holbreich, m.d., peter s. thorne, ph.d., fernando d. martinez, m.d., erika von mutius, m.d., donata vercelli, m.d., carole ober, ph.d., and anne i. sperling, ph.d. the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , t h e n e w e n g l a n d j o u r n a l o f m e d i c i n e many genetic risk factors have been reported to modify susceptibility to asthma and allergy, , but the dra- matic increase in the prevalence of these condi- tions in westernized countries in the past half- century suggests that the environment also plays a critical role. the importance of environmental exposures in the development of asthma is most exquisitely illustrated by epidemiologic studies conducted in central europe that show signifi- cant protection from asthma and allergic disease in children raised on traditional dairy farms. in particular, children’s contact with farm animals and the associated high microbial exposures , have been related to the reduced risk. , however, the effect of these traditional farming environ- ments on immune responses is not well defined. to address this gap in knowledge, we de- signed a study that compares two distinctive u.s. farming populations — the amish of indi- ana and the hutterites of south dakota — that recapitulate the differences in the prevalences of asthma and allergy observed in farmers and nonfarmers in europe. these two particular groups of farmers originated in europe — the amish in switzerland and the hutterites in south tyrol — during the protestant reformation and then emigrated to the united states in the s and s, respectively. both groups have since remained reproductively isolated. , their lifestyles are similar with respect to most of the factors known to influence the risk of asthma, including large sibship size, high rates of child- hood vaccination, diets rich in fat, salt, and raw milk, low rates of childhood obesity, long dura- tions of breast-feeding, minimal exposure to tobacco smoke and air pollution, and taboos against indoor pets. however, whereas the amish practice traditional farming, live on single- family dairy farms, and use horses for fieldwork and transportation, the hutterites live on large, highly industrialized, communal farms. strik- ingly, the prevalence of asthma in amish versus hutterite schoolchildren is . % versus . % and the prevalence of allergic sensitization is . % versus . %, as previously reported. , m e t h o d s overview we characterized the immune profiles of amish and hutterite schoolchildren. furthermore, we used mouse models of asthma to study the effect of the environment on airway responses and to create a mechanistic framework for the interpre- tation of our observations in humans. study participants and study oversight in november , we studied amish children to years of age who lived in indiana, and in december we studied hutterite children who lived in south dakota and were matched with the amish children for sex and for age within year. (for information on the characteristics of the children see table , and the methods section in the supplementary appendix, available with the full text of this article at nejm.org.) written informed consent was obtained from the parents and written assent was obtained from the chil- dren. one parent of each child responded to a questionnaire on asthma symptoms and previous diagnoses. the study was approved by the insti- tutional review boards at the university of chi- cago and at st. vincent hospital in indianapolis. blood-sample collection and analysis whole blood was collected in tubes that con- tained culture medium alone, medium plus . μg per milliliter of lipopolysaccharide, or medium plus . μg per milliliter of anti-cd plus . μg per milliliter of anti-cd monoclonal antibod- ies (truculture blood collection system, myriad rbm). after incubation at °c for hours, a quick take is available at nejm.org characteristic amish (n = ) hutterite (n = ) age (yr) median range – – girls (no.) sibships (no.) children with asthma (no.) positivity for allergen-specific ige (no.) > . kua/liter > . kua/liter serum ige (ku/liter) median interquartile range – – * ua denotes allergen-specific unit. table . demographic and clinical characteristics of the study populations.* the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , immunit y a nd a s thm a in a mish a nd hu t ter ite childr en supernatant and cells were frozen for use in gene-expression and cytokine studies. levels of cytokines were measured with the use of the milliplex map human th magnetic bead panel (emd millipore) or enzyme-linked immuno- absorbent assay (ebioscience) in the supernatant, in accordance with standard protocols. addi- tional blood was collected to obtain peripheral- blood leukocytes for flow cytometry and dna isolation, and serum was collected for ige stud- ies (as described in the methods section in the supplementary appendix). cryopreserved human peripheral-blood leuko- cytes were incubated for minutes with pooled human igg antibodies (fcx, biolegend) to block nonspecific antibody binding before undergoing surface staining with f luorescently conjugated antibodies (see table s in the supplementary appendix) and intracellular staining for foxp (ebioscience). flow-cytometry data were acquired on an lsrfortessa cell analyzer (bd biosciences), and acquisition data were analyzed with flowjo software (tree star). dust collection and extract preparation electrostatic dust collectors were placed in one bedroom and the living room in each of amish and hutterite homes to collect air- borne house dust. all amish homes and of hutterite homes housed children who partici- pated in the study. after month, dust was ana- lyzed for endotoxin and allergen levels, and ex- tracts were prepared for studies in mice. in addition, a vacuum was used to collect dust from the living-room floor in amish homes and from mattresses in amish and hutterite homes for use in microbiome studies (as described in the methods section in the supplementary appendix). aqueous extracts of house dust from amish and hutterite homes were prepared as described in the methods section in the supplementary appendix. genetic studies rna was extracted from thawed cells with the use of allprep dna/rna mini kits (qiagen). rna underwent complementary dna synthesis and was then hybridized to humanht- v expression beadchip arrays (illumina). a com- mon set of , single-nucleotide polymor- phisms (snps) was genotyped or imputed in the children in the study (see fig. s in the sup- plementary appendix). mouse models we instilled μl of house-dust extract intra- nasally every to days (for a total of times) into -week old balb/c mice (harlan laborato- ries), beginning on day . the mice had been sensitized intraperitoneally with μg of oval- bumin (grade v, sigma) plus alum (pierce) on days and and were challenged intranasally with μg of ovalbumin on days and . beginning days before day , we also instilled μl of dust extract from amish homes intra- nasally every to days (for a total of times) in -week old, c bl wild-type, myd -deficient mice and in mice deficient in both myd and trif (jackson laboratories). these mice were sensitized intraperitoneally with μg of oval- bumin plus alum on days and and chal- lenged intranasally with μg of ovalbumin on days , , and . statistical analysis statistical analyses were performed with the use of r or prism software (graphpad). differences in the distributions of median cytokine levels between amish and hutterite children were de- termined with use of a wilcoxon signed-rank test. we used linear regression to identify differ- entially expressed genes in the amish and hut- terite untreated samples of peripheral-blood leukocytes. the methods of benjamini and hoch- berg were used to control the false discovery rate. for flow cytometric studies and the study in mice, differences in cell populations and air- way resistance were assessed with the use of an unpaired student’s t-test. additional details on sample processing, quality control, and statisti- cal analysis for all methods described here are provided in the methods section in the supple- mentary appendix. r e s u l t s asthma and allergic-sensitization rates and genetic ancestry none of the amish children and six ( %) of the hutterite children had asthma, rates similar to those reported in earlier studies. , levels of total serum ige and the number of children whose levels of ige against common allergens were high (defined as more than . kua [allergen- specific unit] per liter) were lower in the amish group than in the hutterite group (table , and the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , t h e n e w e n g l a n d j o u r n a l o f m e d i c i n e table s in the supplementary appendix). no statistical differences were observed in levels of serum ig isotypes other than ige (fig. s in the supplementary appendix). to evaluate whether the differences in the prevalence of asthma and of allergic sensitiza- tion and differences in ige level could be attrib- uted to population history, we assessed ancestry by conducting principal component analysis and compared allele frequencies using genomewide snps. these studies revealed remarkable genetic similarities between the amish children and the hutterite children, as compared with other euro- pean populations (fig. a, and fig. s in the supplementary appendix). exposures to allergens, microbes, and microbial products common allergens (from cats, dogs, house-dust mites, and cockroaches) were detectable in air- borne dust from of amish and of hut- terite homes (table s in the supplementary appendix). in contrast, endotoxin levels were measurable in airborne dust from all homes, and median levels were strikingly higher ( . times as high) in amish homes than in hutterite homes ( endotoxin units [eu] per square meter vs. eu per square meter, p < . ) (fig. b). analysis of a single pooled sample of mattress dust from each population revealed different profiles of the relative abundance of bacteria at the family level (fig. s in the supplementary appendix). composition and phenotype of peripheral- blood leukocytes peripheral-blood leukocytes from amish children had increased proportions of neutrophils, de- creased proportions of eosinophils, and similar proportions of monocytes as compared with samples from hutterite children (fig. a). neu- trophils from amish children expressed lower levels of the chemokine receptor cxcr and the adhesion molecules cd b and cd c than did neutrophils from hutterite children, suggesting that these cells may have recently emigrated from the bone marrow (fig. b). although propor- tions of monocytes were similar in amish and hutterite children, monocytes from amish chil- dren, unlike those from hutterite children, ex- hibited a suppressive phenotype characterized by lower levels of human leukocyte antigen dr (hla-dr) and higher levels of the inhibitory molecule immunoglobulin-like transcript (ilt ) , (fig. c). in contrast with previous studies, , no significant differences in percent- figure . ancestries and environments of amish and hutterite children. panel a shows a principal components plot of the first two principal com- ponents (pc and pc ) of the analysis of , single-nucleotide poly- morphisms (snps). amish and hutterite genotypes were projected onto the sample space created by human genome diversity project (hgdp) for european populations. panel b shows endotoxin levels in airborne dust from amish and hutterite homes. box-and-whisker plots show a hor- izontal line indicating median value, a box representing the interquartile range, and whiskers showing the % confidence interval. the p value was calculated with the use of the wilcoxon rank-sum test. eu denotes endo- toxin units. a snp analysis of genetic association p c − − − − − pc b endotoxin levels in airborne dust e u /m amish homes hutterite homes , , , , p< . amish hutterite basque french north italian russian russian caucasus sardinian scottish tuscan the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , immunit y a nd a s thm a in a mish a nd hu t ter ite childr en figure . proportions of peripheral-blood leukocytes and cell-surface–marker phenotypes in amish and hutterite children. the percentages of total peripheral-blood leukocytes (panel a) were determined with flow cytometry for neutrophils (defined as cd b+cd +), eosinophils (defined as ccr +siglec- +), and monocytes (defined as cd +cd b−). box-and-whisker plots show a line indicating median value, with the box showing the interquartile range and whiskers showing the % confidence interval. neutrophils (panel b) were characterized according to the surface expression of cxcr , cd b, and cd c (shown here), along with cxcr and cxcr , expressed as mean fluorescence intensity (mfi). the expression of the interleukin- coreceptors cxcr and cxcr was not signifi- cantly different between groups (p = . and p = . , respectively). monocytes (panel c) were characterized for the surface expression of hla-dr and immunoglobulin-like transcripts (ilts), including ilt (shown here). there was no significant difference in the mfi of in- hibitory receptors ilt and ilt between amish and hutterite children (p = . and p = . , respectively; data not shown), whereas the surface expression of ilt was increased on amish monocytes (p = . ; data not shown). all p values were calculated with the use of an unpaired student’s t-test. cell proportions and phenotypes after the exclusion of children with asthma or allergic sensitization are shown in table s in the supplementary appendix. c d b + c d + ( % ) amish hutterite b cell-surface markers on neutrophils a cell proportions of peripheral-blood leukocytes neutrophils p= . c c r + s ig le c- + ( % ) amish hutterite eosinophils p< . c d + c d b – ( % ) amish hutterite monocytes p= . m f i amish hutterite cxcr p< . m f i , , , , , amish hutterite cd b p< . m f i amish hutterite cd c p= . c cell-surface markers on monocytes m f i amish hutterite hla-dr p= . m f i amish hutterite ilt p= . the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , t h e n e w e n g l a n d j o u r n a l o f m e d i c i n e ages of t regulatory cells (defined as cd +, cd +, foxp +, and cd −) was observed in amish and hutterite children ( . ± . % vs. . ± . % of peripheral-blood leukocytes, p = . ). cytokine responses to innate and adaptive stimulation cytokine levels were measured in supernatants from peripheral-blood leukocytes that were cul- tured for hours, with or without innate stimuli (lipopolysaccharide) or adaptive stimuli (combined anti-cd and anti-cd antibodies). twenty-three cytokines were detectable in the supernatants from peripheral-blood leukocytes treated with lipopolysaccharide. median levels of each of these cytokines were lower in the amish children than in the hutterite children, and these distributions were significantly differ- ent (p < . by wilcoxon signed-rank test) (see tables s and s in the supplementary appen- dix). results were similar after the exclusion of children who were known to have asthma or allergies (table s in the supplementary appen- dix). in contrast, after adaptive stimulation, the overall distributions of median cytokine levels were not significantly different in peripheral- blood leukocytes from amish and hutterite children (p = . by wilcoxon signed-rank test) (table s in the supplementary appendix). gene-expression profiles the striking differences in the proportions of peripheral-blood leukocytes observed in amish and hutterite children were reflected in the gene- expression profiles of these cells (fig. s in the supplementary appendix). at a false discovery rate of %, genes were up-regulated in the peripheral-blood leukocytes of amish children (blue points in fig. a) as compared with genes up-regulated in the cells of hutterite chil- dren (red points in fig. a). these differentially expressed genes were organized into coexpres- sion modules with the use of the whole genome co-expression network analysis (table s in the supplementary appendix). to better understand the biologic relationships within each set of genes in each module, we used ingenuity pathway analysis (qiagen) to construct unsupervised net- works on the basis of prior knowledge of the physical and functional connections between the molecules encoded by the genes. the most sig- nificant network (p = . × − by fisher’s exact test) was in a module that contained genes. this module was associated with both amish and hutterite status (p = . × − ) and was therefore also associated with the proportions of neutro- phils (p = . × − ) and eosinophils (p = . × − ). eighteen of the genes in this module were over- expressed in amish peripheral-blood leukocytes, and all were clustered in a network that had as hubs tumor necrosis factor (tnf) and interferon regulatory factor (irf ), two key proteins in the innate immune response to microbial stimuli (fig. b). effects of house-dust extracts on experimental asthma to create a framework that would help us to interpret our observations, which were pointing toward a protective role of innate immunity, we used a classic ovalbumin mouse model of aller- gic asthma, comparing the effects of house dust obtained from amish and hutterite homes by administering extracts intranasally to mice over the course of to weeks. eosinophilia was observed in bronchoalveolar-lavage samples, and airway hyperresponsiveness was exacerbated in mice treated with ovalbumin and hutterite dust extracts as compared with mice treated with ovalbumin alone, findings that were consistent with the absence of protection from asthma observed in hutterite children (fig. a). in con- trast, inhalation of amish dust extracts was suf- ficient to significantly inhibit ovalbumin-induced airway hyperresponsiveness, eosinophilia in the bronchoalveolar lavage, and the elevation of se- rum ovalbumin-specific ige levels (fig. a, and table s in the supplementary appendix). levels of lung t regulatory cells (defined as cd +, cd +, and foxp +) were not increased (table s in the supplementary appendix), and all cyto- kines measured in bronchoalveolar-lavage sam- ples, including interleukin- , were suppressed in mice that received amish dust extracts (table s in the supplementary appendix). the inhibi- tory effects of these extracts in wild-type mice probably required innate immunity, because protection was strongly reduced in mice defi- cient in myd (fig. c) and completely abro- gated in mice deficient in both myd and trif (fig. d), two molecules that are critical to the development of multiple innate immune-signal- ing pathways. the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , immunit y a nd a s thm a in a mish a nd hu t ter ite childr en d i s c u s s i o n our studies in amish and hutterite schoolchil- dren revealed marked differences in the preva- lence of asthma despite similar genetic ances- tries and lifestyles. as compared with the hutterites, the amish, who practice traditional farming and are exposed to an environment rich in microbes, showed exceedingly low rates of asthma and distinct immune profiles that sug- gest profound effects on innate immunity. data generated in an experimental model of asthma support this notion by showing that the protec- tive effect of the amish environment requires the activation of innate immune signaling. analyses of the proportions and gene-expres- sion profiles of peripheral-blood immune cells in amish and hutterite children revealed differences in the cells and genes involved in innate immune responses to microbes. indeed, neutrophils, eosino- phils, and monocytes appeared to be major tar- gets of the distinct environments to which amish and hutterite children are exposed be- cause these cell types differed between the two groups in terms of their relative abundance, their phenotypes, or both. moreover, the network most associated with these differences consisted of innate immune genes. notable among the genes that were more highly expressed in the amish children was tnfaip , which encodes a , a ubiquitin-editing enzyme that limits the activity of multiple inflammatory pathways that depend on nuclear factor κb (nf-κb) and that has also been shown to mediate the protective effects of european farm-dust extracts in murine models of allergic asthma. irf , a hub in this network, figure . gene-expression profiles in peripheral-blood leukocytes from amish and hutterite children. in panel a, a volcano plot shows differences in baseline gene expression in peripheral-blood leukocytes from amish and hutterite children.the x axis indicates the log differences in gene-expression level between groups, with larger positive values representing genes with higher expression in the hutterites relative to the amish ( genes, shown in red points) and larger negative values representing genes with higher expression in the amish relative to the hut- terites ( genes, shown in blue points). the y axis shows the –log of the p values for each gene, with larger values indicating greater statistical significance. the solid horizontal line indicates the % false discovery rate. black points represent genes from amish and hutterite cells for which there was no significant difference in gene expression. differences in gene expression remain after the data for children with asthma or allergic sensitization were excluded (figs. s and s in the supplementary appendix). changes in gene expression between the two groups after correct- ing for differences in cell proportion are shown in figure s in the supplementary appendix. in panel b, a network of differentially expressed genes in untreated peripheral-blood leukocytes is shown. genes shown in blue have in- creased expression in amish children, and the gene shown in red has increased expression in hutterite children. the gene shapes indicate the class of each gene’s protein product (spirals denote enzymes, a v-shape denotes cyto- kines, conjoined circles denote a transcription regulator, hollow upside-down triangles denote kinases, cups denote transporters, and circles denote other products). lines represent different biologic relationships (solid lines indicate direct interaction, dashed lines indirect interaction, arrows direction of activation, arrows with a horizontal line direc- tion of activation and inhibition, and lines without arrows binding only). steap zc h a irak trim trim tnfaip parp tap parp samd l psme irf dhx map k stat tnfaip sco rhbdf tnf − − log (difference in gene expression) − lo g (p v al u e) ba the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , t h e n e w e n g l a n d j o u r n a l o f m e d i c i n e f ig u re . e ff ec ts o f a m is h a n d h u tt er it e h o u se -d u st e xt ra ct s o n a ir w ay r es p o n se s in m o u se m o d el s o f a lle rg ic a st h m a. p an el a s h o w s th e ef fe ct s o f th e in tr an as al i n st ill at io n o f μ l o f a m is h o r h u tt er it e d u st e xt ra ct i n -w ee k- o ld m ic e (b a lb /c s tr ai n ) ev er y to d ay s fo r a to ta l o f t im es b eg in - n in g at d ay . t h e m ic e w er e se n si ti ze d w it h o va lb u m in ( o v a ) in tr ap er it o n ea lly o n d ay s an d an d c h al le n g ed w it h o va lb u m in i n tr an as al ly o n d ay s an d . a ir w ay r es is ta n ce (s h o w n a s ce n ti m et er s o f w at er p er m ill ili te r p er s ec o n d a n d s ti m u la te d i n r es p o n se t o i n cr ea si n g d o se s o f ac et yl ch o lin e ad m in is te re d i n tr av en o u sl y) a n d b ro n ch o al ve o la r- la va g e (b a l) c el lu la ri ty w er e m ea su re d o n d ay ( t o m ic e p er g ro u p ). t h e to ta l am o u n t o f a m is h a n d h u tt er it e d u st e xt ra ct a d m in is te re d o ve r th e co u rs e o f th e ex p er im en t re p re se n t- ed t h e to ta l lo ad o f ai rb o rn e d u st d ep o si te d o n e le ct ro st at ic d u st c o lle ct o rs p la ce d i n a m is h o r h u tt er it e h o m es f o r m o n th . s ta ti st ic al d if fe re n ce s in e xp er im en ta l m ea su re s w er e as se ss ed w it h t h e u se o f s tu d en t’ s t- te st . a m is h h o u se -d u st e xt ra ct s ( . m g o f d u st e q u iv al en t in μ l) w er e in st ill ed i n tr an as al ly e ve ry t o d ay s fo r a to ta l o f t im es b eg in n in g d ay s b ef o re d ay i n to -w ee k o ld w ild -t yp e m ic e (p an el b ), m ic e d ef ic ie n t in m yd (p an el c ), a n d m ic e d ef ic ie n t in m yd an d t ri f (p an el d ) (a ll c b l s tr ai n s) . t h es e m ic e w er e se n si ti ze d i n tr ap er it o n ea lly w it h μ g o f o va lb u m in o n d ay s an d an d w er e ch al le n g ed i n tr an as al ly w it h μ g o f o va lb u m in o n d ay s , , an d . a ir w ay r es is ta n ce (s h o w n a s an i n cr ea se f ro m b as el in e in r es p o n se t o i n cr ea si n g d o se s o f n eb u liz ed m et h ac h o lin e) a n d b ro n ch o al ve o la r- la va g e ce llu la ri ty w er e m ea su re d o n d ay ( m ic e p er g ro u p f o r w ild -t yp e m ic e an d m ic e p er g ro u p f o r th o se d ef ic ie n t in m yd o r m yd an d t ri f) . s ta ti st ic al d if fe re n ce s in e xp er im en ta l m ea su re s w er e as se ss ed w it h t h e u se o f s tu - d en t’ s t- te st . i b ar s re p re se n t th e st an d ar d e rr o rs o f th e d at a. n s d en o te s n o t si g n if ic an t an d p b s p h o sp h at e- b u ff er ed s al in e. s al in e o v a o v a –a m is h s al in e o v a o v a –a m is h s al in e o v a o v a –a m is h p b s o v a o v a – a m is h o v a – h u tt er it e airway resistance (cm of water/ml/sec) . . . . . a ce ty lc h o lin e (µ g/ g m o u se ) b w ild t yp e c b l c c b l m yd k n o ck o u t d c b l m yd –t r if k n o ck o u t a b a lb /c p = . p = . p = . p < . p < . p = . airway resistance (cm of water/ml/sec) m et h ac h o lin e (m g/ m l)p = . airway resistance (cm of water/ml/sec) m et h ac h o lin e (m g/ m l)n s airway resistance (cm of water/ml/sec) m et h ac h o lin e (m g/ m l)n s bal cells (%) bal cells (%) bal cells (%) bal cells (%) e os in op hi ls n eu tro ph ils m ac ro ph ag es p < . p = . p = . p < . p = . p < . n s n s n s p = . n s eo sin op hi ls n eu tro ph ils m ac ro ph ag es eo sin op hi ls n eu tro ph ils m ac ro ph ag es eo sin op hi ls n eu tro ph ils m ac ro ph ag es p b s o v a o v a – a m is h o v a – h u tt er it e s al in e o v a o v a –a m is h s al in e o v a o v a –a m is h s al in e o v a o v a –a m is h the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , immunit y a nd a s thm a in a mish a nd hu t ter ite childr en regulates type i interferon transcription and is therefore essential for innate airway responses against viruses that are linked to susceptibility to asthma. , in turn, trim , the one gene in the network that was more highly expressed in the hutterites, acts as a positive regulator of tnf-α– and interleukin- β–induced activation of nf-κb. these findings suggest that in the amish, intense and presumably sustained exposure to microbes activates innate pathways that shape and cali- brate downstream immune responses. sustained microbial exposure was also reflect- ed in the phenotypes of peripheral innate im- mune cells in the amish. repeated microbial stimulation can lead to reduced expression of hla-dr on monocytes , and drive immature neutrophils from the bone marrow. - indeed, amish children had immature neutrophils bear- ing markers suggestive of recent emigration from the bone marrow, and they had monocytes with reduced expression of hla-dr and in- creased expression of ilt , all of which are sug- gestive of antiinflammatory function. proportions of t regulatory cells and levels of interleukin- , which typically mediate immune-balancing effects, were not increased in the amish children. how- ever, qualitative and functional differences in regulatory-cell populations remain to be defined. innate immunity has evolved to sense the environment and transduce signals that cali- brate adaptive responses to exogenous antigens. the proteins myd and trif are located at the convergence of multiple innate signaling path- ways, and deletion of these molecules virtually disables innate immune responses, thereby also dysregulating adaptive immunity. the fact that the loss of protection was more marked in mice deficient in both myd and trif than in mice deficient only in myd points to the involve- ment of multiple innate pathways. the concor- dance between findings from studies in humans and in mice was remarkable: in both studies protection was accompanied by lower levels of eosinophils, higher levels of neutrophils, general- ly suppressed cytokine responses, and no increase in levels of t regulatory cells or interleukin- . thus, the finding that these features were largely dependent on innate immune pathways in mice suggests that innate immune signaling may also be the primary target of protection in the amish children, in whom downstream adaptive immune responses may also be modulated. our study has several limitations. first, we were unable to include children younger than years of age, we collected samples at a single time point, and the numbers of amish and hutterite children in our study were relatively small. as a result, we may have missed important windows of immune development or lacked the ability to detect early, subtle shifts in cell composition, response, or phenotype that are critical for im- mune maturation. second, our microbiome as- sessments were limited, since only pooled dust samples from a limited number of homes were available for the studies in which we assessed bacterial composition. therefore, we cannot fur- ther dissect microbial composition and identify potentially protective microbes to target. how- ever, the striking differences found in endotoxin levels support the notion that the amish indoor environment is much richer in microbial expo- sures than the hutterite environment. third, the strategy used for sampling the hutterite chil- dren enriched selection for those with asthma, although the prevalence of asthma in our sample was similar to that reported in previous popula- tion-based studies. moreover, the exclusion of children with asthma or allergic sensitization from our analyses of gene expression, cell com- position, and immune phenotypes did not affect the outcomes. our study in a small number of children was sufficient to show significant differences in the prevalence of asthma and in immune profiles, suggesting that very strong environmental fac- tors must account for these differences. indeed, we showed that there are remarkable genetic similarities between amish and hutterite chil- dren. although we interrogated only common variants, other variants that occur at very low frequency in these populations are unlikely to account for the observed large differences in the prevalence of asthma. in the end, the novelty of our work lies in the identification of innate im- munity as the primary target of the protective amish environment, a finding supported by re- sults obtained in both humans and mice. con- versely, our work suggests that susceptibility to asthma may be increased when innate immune stimulation is weak. a deeper understanding of the relevant stimuli and the innate immune path- ways they engage may ultimately pave the way for the development of effective strategies for the prevention of asthma. the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , t h e n e w e n g l a n d j o u r n a l o f m e d i c i n e supported by the national institutes of health, st. vincent foundation, and the american academy of allergy, asthma, and immunology foundation. disclosure forms provided by the authors are available with the full text of this article at nejm.org. we thank the hutterite and amish volunteers and their families for participating in this study; gorka alkorta-aranburu, maitane arrubarrena orbegozo, kathleen bailey, christine billstrand, kelly blaine, daniel cook, donna decker, mohammad jaffery, courtney burrows, katherine naughton, raluca nicolae, rob stanaker, meghan sullivan, and emma thompson for assistance on field trips and with sample processing; peace ezeh, amanda herrell, ashley horner, kenneth addison, dominik schenten, and shane snyder for their contributions to the studies in mice; and minal Çalışkan, yoav gilad, jessie nicodemus-johnson, john novembre, and matthew stephens for helpful comments and statistical advice. appendix the authors’ affiliations are as follows: the department of human genetics (m.m. stein, c.i., r.l.a., c.o.), the department of medi- cine, section of pulmonary and critical care medicine, and the committee on immunology (c.l.h., a.i.s.), the department of ecology and evolution (j.a.g.), and the department of surgery (j.a.g.), university of chicago, chicago, and the institute for genomic and systems biology, argonne national laboratory, argonne (j.a.g.) — all in illinois; the niehs training program in environmental toxicology and graduate program in cellular and molecular medicine (j.g.), and the departments of cellular and molecular medicine (v.p., d.v.), medicine (j.g.l.), chemical and environmental engineering (m. marques dos santos), and soil, water, and environmental science (j.w.n., r.m.m.), university of arizona, and the arizona respiratory center and bio institute (j.g., v.p., s.e.m., j.g.l., f.d.m., d.v.) — all in tucson; the department of occupational and environmental health, university of iowa, iowa city (n.m., p.s.t.); allergy and asthma consultants, indianapolis (m.h.); and dr. von hauner children’s hospital, ludwig maximilians university munich, munich, germany (e.m.). references . ober c, yao tc. the genetics of asth- ma and allergic disease: a st century perspective. immunol rev ; : - . . meyers da, bleecker er, holloway jw, holgate st. asthma genetics and per- sonalised medicine. lancet respir med ; : - . . bach jf. the effect of infections on susceptibility to autoimmune and allergic diseases. n engl j med ; : - . . braun-fahrländer c, riedler j, herz u, et al. environmental exposure to endo- toxin and its relation to asthma in school- age children. n engl j med ; : - . . ege mj, mayer m, normand ac, et al. exposure to environmental microorgan- isms and childhood asthma. n engl j med ; : - . . ege mj, frei r, bieli c, et al. not all farming environments protect against the development of asthma and wheeze in children. j allergy clin immunol ; : - . . ege mj, strachan dp, cookson wo, et al. gene-environment interaction for childhood asthma and exposure to farm- ing in central europe. j allergy clin im- munol ; : - . hostetler ja. hutterite society. balti- more: johns hopkins university press, . . hostetler ja. amish society. th ed. baltimore: johns hopkins university press, . . holbreich m, genuneit j, weber j, braun-fahrländer c, waser m, von mutius e. amish children living in northern indi- ana have a very low prevalence of allergic sensitization. j allergy clin immunol ; : - . . motika ca, papachristou c, abney m, lester la, ober c. rising prevalence of asthma is sex-specific in a us farming population. j allergy clin immunol ; : - . . adachi o, kawai t, takeda k, et al. targeted disruption of the myd gene results in loss of il- - and il- -mediated function. immunity ; : - . . yamamoto m, sato s, hemmi h, et al. role of adaptor trif in the myd -inde- pendent toll-like receptor signaling path- way. science ; : - . . benjamini y, hochberg y. control- ling the false discovery rate: a practical and powerful approach to multiple testing. j r stat soc ser b ; : - . . cann hm, de toma c, cazes l, et al. a human genome diversity cell line panel. science ; : - . . kim-schulze s, scotto l, vlad g, et al. recombinant ig-like transcript -fc modu- lates t cell responses via induction of th anergy and differentiation of cd + t sup- pressor cells. j immunol ; : - . . velten fw, duperrier k, bohlender j, metharom p, goerdt s. a gene signature of inhibitory mhc receptors identifies a bdca (+) subset of il- -induced den- dritic cells with reduced allostimulatory capacity in vitro. eur j immunol ; : - . . lluis a, depner m, gaugler b, et al. increased regulatory t-cell numbers are associated with farm milk exposure and lower atopic sensitization and asthma in childhood. j allergy clin immunol ; : - . . schaub b, liu j, höppler s, et al. ma- ternal farm exposure modulates neonatal immune mechanisms through regulatory t cells. j allergy clin immunol ; ( ): - .e . . ma a, malynn ba. a : linking a complex regulator of ubiquitylation to immunity and human disease. nat rev immunol ; : - . . schuijs mj, willart ma, vergote k, et al. farm dust and endotoxin protect against allergy through a induction in lung epithelial cells. science ; : - . . bosco a, ehteshami s, panyala s, martinez fd. interferon regulatory factor is a major hub connecting interferon- mediated responses in virus-induced asthma exacerbations in vivo. j allergy clin immunol ; : - . . loss gj, depner m, hose aj, et al. the early development of wheeze: environ- mental determinants and genetic suscep- tibility at q . am j respir crit care med ; : - . . calışkan m, bochkov ya, kreiner- møller e, et al. rhinovirus wheezing ill- ness and genetic risk of childhood-onset asthma. n engl j med ; : - . . li q, yan j, mao ap, et al. tripartite motif (trim ) modulates tnfα- and il- β-triggered nf-κb activation by tar- geting tak for k -linked polyubiquiti- nation. proc natl acad sci u s a ; : - . . meisel c, schefold jc, pschowski r, et al. granulocyte-macrophage colony- stimulating factor to reverse sepsis-asso- ciated immunosuppression: a double-blind, randomized, placebo-controlled multi- center trial. am j respir crit care med ; : - . . gomez hg, gonzalez sm, londoño jm, et al. immunological characterization of compensatory anti-inf lammatory re- sponse syndrome in patients with severe sepsis: a longitudinal study. crit care med ; : - . . fortunati e, kazemier km, grutters jc, koenderman l, van den bosch j. hu- man neutrophils switch to an activated phenotype after homing to the lung irre- spective of inflammatory disease. clin exp immunol ; : - . the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. n engl j med ; nejm.org august , immunit y a nd a s thm a in a mish a nd hu t ter ite childr en . orden s, de pablo c, rios-navarro c, et al. efavirenz induces interactions be- tween leucocytes and endothelium through the activation of mac- and gp , . j antimicrob chemother ; : - . . devi s, wang y, chew wk, et al. neu- trophil mobilization via plerixafor-medi- ated cxcr inhibition arises from lung demargination and blockade of neutro- phil homing to the bone marrow. j exp med ; : - . . yamada m, kubo h, kobayashi s, et al. the increase in surface cxcr expres- sion on lung extravascular neutrophils and its effects on neutrophils during endotoxin- induced lung injury. cell mol immunol ; : - . . netea mg, wijmenga c, o’neill laj. genetic variation in toll-like receptors and disease susceptibility. nat immunol ; : - . copyright © massachusetts medical society. tucson, arizona gregory koshkarian, m.d. the new england journal of medicine downloaded from nejm.org at carnegie-mellon univ on april , . for personal use only. no other uses without permission. copyright © massachusetts medical society. all rights reserved. author's personal copy review diseases caused by defects of mitochondrial carriers: a review ferdinando palmieri ⁎ department of pharmaco-biology, laboratory of biochemistry and molecular biology, university of bari, via e. orabona , bari, italy a r t i c l e i n f o a b s t r a c t article history: received january accepted march available online march a strikingly large number of mitochondrial dna (mtdna) mutations have been found to be the cause of respiratory chain and oxidative phosphorylation defects. these mitochondrial disorders were the first to be investigated after the small mtdna had been sequenced in the s. only recently numerous diseases resulting from mutations in nuclear genes encoding mitochondrial proteins have been characterized. among these, nine are caused by defects of mitochondrial carriers, a family of nuclear-coded proteins that shuttle a variety of metabolites across the mitochondrial membrane. mutations of mitochondrial carrier genes involved in mitochondrial functions other than oxidative phosphorylation are responsible for carnitine/acylcarnitine carrier deficiency, hhh syndrome, aspartate/glutamate isoform deficiency, amish microcephaly, and neonatal myoclonic epilepsy; these disorders are characterized by specific metabolic dysfunctions, depending on the physiological role of the affected carrier in intermediary metabolism. defects of mitochondrial carriers that supply mitochondria with the substrates of oxidative phosphorylation, inorganic phosphate and adp, are responsible for diseases characterized by defective energy production. herein, all the mitochondrial carrier- associated diseases known to date are reviewed for the first time. particular emphasis is given to the molecular basis and pathogenetic mechanism of these inherited disorders. © elsevier b.v. all rights reserved. keywords: carrier deficiencies mitochondria mitochondrial carriers mitochondrial diseases mitochondrial carrier-related diseases transporters . introduction mitochondrial diseases are hundreds of clinical phenotypes caused by defects in one or more components of the mitochondrial proteome. this proteome consists of more than proteins that are encoded by either nuclear dna or mitochondrial dna (mtdna). the mitochon- drial genome encodes only proteins which are subunits of the four respiratory chain enzyme complexes (i–iv) and atp synthase complex (v). both the subunits encoded by mtdna or nuclear dna are essential for the activity of these complexes and therefore for the accomplish- ment of oxidative phosphorylation. since , when the first mutations in mtdna were described [ , ], more than mutations in mtdna have been identified as being responsible for respiratory chain and oxidative phosphorylation diseases (http://www.mitomap.org). these mutations concern not only mtdna genes encoding the above-mentioned proteins but also mtdna genes encoding ribosomal rnas and transfer rnas which are part of the protein synthesis machinery present in the mitochondrial matrix. respiratory chain and oxidative phosphoryla- tion diseases can also be caused by mutations of nuclear dna genes that encode proteins required for a) the replication, transcription, translation, repair and maintenance of mtdna; b) the functioning of complexes i–v (the nuclear-coded subunits) and their assembly; c) the import of the substrates of oxidative phosphorylation (see section of this review); and d) the import, modification and insertion of respi- ratory chain cofactors such as heme, metals and the iron–sulphur clusters. mtdna-dependent oxidative phosphorylation diseases are due either to large-scale rearrangements including deletions and duplications, which are usually sporadic and invariably heteroplasmic, or to point mutations which may be heteroplasmic or homoplasmic and are transmitted maternally. nuclear-dependent oxidative phos- phorylation diseases can induce secondary multiple mtdna deletions or loss of mtdna in affected tissues and follow the mendelian pattern of inheritance. although the primary function of mitochondria is the synthesis of atp by oxidative phosphorylation, these organelles play many other important roles. they contain several metabolic pathways, such as the citric acid cycle, or parts thereof, are the main site where reactive oxygen species (ros) are generated, and are fundamental for certain biological processes such as ca + cell signaling, cell proliferation and necrotic or apoptotic cell death. some enzymes involved in ros management, in amino acid catabolism and in the biosynthesis of fatty acids, cholesterol, steroid hormones, farnesyl and geranyl side chains, cardiolipin, ubiquinol, heme and urea are located inside mitochondria. furthermore, mitochondria communicate with other cell compart- ments by means of transport proteins (carriers) present in the mito- chondrial membrane that allow the selective passage of solutes in and out of the mitochondrial matrix. all these functions are accomplished by a large number of proteins which are encoded by the nuclear genome, translated in the cytosol and imported into the mitochondria. in recent years, the completion of human nuclear genome se- quencing and the ongoing identification of nuclear gene function have accelerated the disclosure of several mitochondrial disorders (apart biochimica et biophysica acta ( ) – ⁎ tel.: + x ; fax: + . e-mail address: fpalm@farmbiol.uniba.it. - /$ – see front matter © elsevier b.v. all rights reserved. doi: . /j.bbabio. . . contents lists available at sciencedirect biochimica et biophysica acta journal homepage: www.elsevier.com/locate/bbabio author's personal copy from oxidative phosphorylation diseases) resulting from mutations in nuclear genes encoding mitochondrial proteins. these include disorders caused by mutations of proteins involved in the citric acid cycle [ ], fatty acid β-oxidation [ ], cardiolipin metabolism (barth's syndrome) [ , ], the utilization of iron (friedreich's ataxia, x-linked ataxia and sideroblastic anemia) [ ], antioxidant defense [ ], protein import (x-linked deafness distonia) [ ], network dynamics (fission/ fusion) [ ] and mitochondrial metabolite carriers (this review). in addition, some cancers are caused by mutations in nuclear genes en- coding mitochondrial proteins [ , ]. several reviews on mitochon- drial diseases resulting from defects in the respiratory chain and oxidative phosphorylation have been published [ – ]. the con- tribution of mtdna mutations, ros generation and, in general, mito- chondrial dysfunction to cardiovascular disease, diabetes, cancer, aging and aging-related neurodegenerative disorders, such as parkin- son's and huntington's disease, has also been reviewed [ , – ]. this review highlights for the first time the current molecular, biochemical, clinical and pathophysiological information about all the diseases known thus far to be associated with defects of mitochondrial carriers. as a premise, some features of mitochondrial carriers are summarized. . characteristics and physiological role of mitochondrial carriers because mitochondria and cytosol cooperate in a large number of metabolic cellular processes, a continuous and highly diversified flux of metabolites, nucleotides, and cofactors into and out of the mitochondria is needed. the transport of solutes across the inner mitochondrial membrane is catalyzed by a family of nuclear-coded, membrane-embedded proteins called mitochondrial carriers. the carriers are involved in the krebs cycle, oxidative phosphorylation, modulation of the nucleotide and deoxynucleotide pools in the mito- chondrial matrix, the synthesis and breakdown of mtdna, mtrna and mitochondrial proteins, fatty acid oxidation, gluconeogenesis, lipo- genesis, transfer of reducing equivalents, urea synthesis, amino acid degradation, and other functions shared by cytosol and mitochondria. the central role in cell metabolism of most mitochondrial carriers identified so far (except the pyruvate carrier, pyc) is illustrated in fig. . in man, mitochondrial carriers are encoded by the slc gene family ([ ] for a review). several carriers, such as the adp/atp, atp- mg/pi, glutamate and ornithine carriers, have isoforms encoded by different genes, and only the phosphate carrier (pic) has two alternatively spliced isoforms. the main carriers importing substrates for oxidative phosphorylation are widely distributed in human tissues. in contrast, other carriers are tissue specific and have a limited dis- tribution reflecting their importance in special functions. the majority of mitochondrial carriers catalyze obligatory solute exchange reac- tions. those mediating h+-compensated undirectional substrate flux may also fall into the above category, given that at least pic has been shown to function in a phosphate/oh− antiport mode. the carnitine– acylcarnitine carrier catalyzes both unidirectional transport of carni- tine and the carnitine/acylcarnitine exchange, whereas the uncoupling protein catalyzes uniport as the exclusive transport mode. as their driving force, mitochondrial carriers utilize the concentration gradient fig. . metabolic roles of mitochondrial carriers. the scheme shows carriers catalyzing metabolite transport through the inner mitochondrial membrane. these carriers are involved in: oxidative phosphorylation (aac, pic, ucp); oxidation/reduction pathways (agc, ogc, dic, cic, cac, pyc); homeostasis of the intramitochondrial adenine nucleotide pool (apc); methylation of mtdna, mtrna and some intramitochondrial proteins (samc); import of the essential coenzyme thiamine pyrophosphate (thpp) required for pyruvate– and oxoglutarate–dehydrogenase complex activities (tpc); and, with partial overlap, amino acid metabolism (agc, orc, gc, odc). the scheme does not show all the metabolic pathways in which the already identified carriers are involved. f. palmieri / biochimica et biophysica acta ( ) – author's personal copy of the solutes and/or the h+ electrochemical potential gradient (Δμh+) generated across the inner mitochondrial membrane by the function of the respiratory chain. mitochondrial carriers can be divided into electrogenic (or electrophoretic) and electroneutral transporters depending on whether their transport reactions result in charge imbalance. the intra-/extra-mitochondrial distribution of solutes transported by electophoretic carriers is regulated by the electrical component of Δμh+, whereas the distribution of solutes carried by the proteins transporting anions together with an equivalent amount of h+ (anion/h+ symport) or in exchange for oh− (anion/oh− antiport) is regulated by the transmembrane ph gradient [ ]. all primary structures of the mitochondrial carrier family mem- bers consist of three tandemly repeated homologous domains of about amino acids in length. each repeat contains two hydrophobic stretches, that span the membrane as α-helices, and a characteristic signature motif p-x-[de]-x-x-[rk]-( – residues)-[de]-g-x-x-x-x- [ywlf]-[rk]-g. based on the sequence features described above and on the accessibility of carriers to peptide-specific antibodies, proteo- lytic enzymes and impermeable reagents, each mitochondrial carrier monomer has six helices traversing the membrane connected by hydrophilic loops with both the n- and c-termini on the cytosolic side of the inner mitochondrial membrane. in , the d structure of a member of this protein family, the adp/atp carrier in complex with its inhibitor, carboxyatractyloside, was determined [ ]. this structure, whose pseudo-three-fold symmetry [ , ] is in agreement with the three-fold sequence repeats, consists of six transmembrane α-helices (h –h ) and three short α-helices (h , h and h ) parallel to the membrane plane on the matrix side [ ]. in each repeated domain, the first part of the signature motif p-x-[de]-x-x-[rk] is located at the end of the odd-numbered transmembrane α-helices, whereas the second part [de]-g-x-x-x-x-[ywlf]-[rk]-g is located immediately before the even-numbered transmembrane α-helices. the prolines of the signature motif p-x-[de]-x-x-[rk] sharply kink the odd-numbered transmembrane α-helices, and the charged residues of the three signature motifs form a salt bridge network that closes the water- accessible cavity that is exposed towards the cytosolic side of the mitochondrial membrane and is occupied by the inhibitor. by using comparative models of carriers with known substrate specificity, a common substrate-binding site was proposed [ ]. this site is formed by residues which belong to the three even-numbered transmembrane α-helices and protrude into the cavity at the midpoint of the membrane, one-and-a-half helix turns above the salt bridge network. the significant sequence conservation in the mitochondrial carrier family suggests that the structural fold and transport mechan- ism are similar for all carriers. although the conformational changes involved in substrate translocation are not yet known, it is currently thought that translocation might be triggered by substrate-induced rearrangement of the salt bridge network from inter- to intra-domain interactions [[ ] and references therein]. the human genome encodes about different mitochondrial carriers. in the last decade, a significant advance in the field of mitochondrial transport has been the identification of many mito- chondrial carrier family members by over-expression in escherichia coli and/or saccharomyces cerevisiae, purification and reconstitution into liposomes for functional characterization by transport assays. until now, almost human carriers have been characterized in terms of substrate specificity, inhibitor sensitivity, transport mechanism, tissue distribution and kinetic characteristics [[ ] for a review, [ – ]]. naturally, this extension of the mitochondrial carrier family members has greatly favoured the discovery of their involvement in several diseases. . diseases associated with mitochondrial carriers mitochondrial carrier-related diseases are rare errors of metabo- lism caused by alterations of nuclear genes encoding mitochondrial carriers. the nine known disorders are listed in table . carrier acronyms throughout the text are those used in ref. [ ]; aliases are mentioned in the same reference. these disorders are all transmitted by mendelian inheritance; with the exception of autosomal dominant progressive external ophthalmoplegia (adpeo), the others are inher- ited in an autosomal recessive manner. mitochondrial carrier-related diseases can be divided into two groups. the first concerns defects of mitochondrial carriers directly linked to oxidative phosphorylation, such as the adp/atp carrierand the pic. the symptomatology of these diseases is characterized by insufficient energy production in tissues where these carriers are expressed and play an important role in oxidative phosphorylation. these diseases should also include adpeo, which is caused by hete- rozygous mutations of the adp/atp carrier isoform gene (as well as of other nuclear genes), because these mutations cause mtdna instability. the second group of diseases is due to alterations of the genes encoding mitochondrial carriers that are required for mitochondrial functions other than oxidative phosphorylation and, in particular, intermediary metabolism. their symptomatology depends on the metabolism affected and its significance in specific tissues. . diseases due to defects of mitochondrial carriers directly linked to oxidative phosphorylation given that the catalytic site of the atp synthase complex is exposed towards the mitochondrial matrix, the uptake of inorganic phosphate (pi) and adp into the mitochondria is essential for the oxidative phosphorylation of adp to atp (see fig. ). these uptakes are catalyzed by two distinct carriers, the pic and the adp/atp carrier, respectively; very recently, deficiencies of one isoform of both carriers have been described. . . aac deficiency in , a homozygous mutation (c. c→a) was found in the slc a gene of a -year-old male patient of slovenian origin [ ]. slc a encodes the heart-/muscle-specific adp/atp carrier (aac , also termed ant ). the mutation involves a highly conserved alanine at position that is replaced with an aspartic acid (a d). in the crystallographic structure of bovine aac , a protrudes into the central cavity two helix turns above the salt bridge network (slightly above the level of the proposed binding site) and is localized in the third transmembrane segment within the consensus sequence gxxxg, which is thought to be involved in high-affinity associations between transmembrane α-helices [ ]. the substitution of a d results in a complete loss of the protein's ability to transport adp and atp in reconstituted liposomes [ ]. interestingly, in contrast with the other aac mutations found so far in humans (see . ), a d is the first recessive mutation found in the aac gene. the patient affected with aac deficiency (omim ) mani- fested exercise intolerance, lactic acidosis, hypertrophic cardiomyo- pathy and a mild myopathy with no peo. exercise intolerance with table diseases associated with mitochondrial carriers disorder gene carrier substrates aac deficiency slc a aac adp/atp sengers' syndrome ? aac adp/atp pic deficiency slc a pic phosphate adpeo slc a aac adp/atp cac deficiency slc a cac carnitine/acylcarnitines hhh syndrome slc a orc ornithine/citrulline niccd/ctln slc a agc aspartate/glutamate amish microcephaly slc a tpc thiamine pyrophosphate neonatal myoclonic epilepsy slc a gc glutamate carrier acronyms are taken from ref. [ ]; aliases are mentioned in the same reference. f. palmieri / biochimica et biophysica acta ( ) – author's personal copy easy fatigability and muscle pain was present since early childhood and ventricular hypertrophy was diagnosed during puberty, indicating that the disease is slowly progressive. serum lactate levels in fasting conditions and at rest were higher than normal. in the skeletal muscle of the patient, numerous ragged-red fibers and multiple mtdna large- scale deletions were present (without a reduction of the wild-type mtdna copy number). the activities of the three mtdna-dependent respiratory chain complexes (i, iii and iv) were lower than normal and citrate synthase activity was much higher than normal, probably due to mitochondrial proliferation. interestingly, this symptomatology closely resembles that of the aac knock-out mice [ ]. as in the mouse model, loss of aac function is compatible with adult life, presumably due to compensation by glycolysis and/or transport activities of aac isoforms or other adenine nucleotide mitochondrial carriers, such as the atp-mg/pi carrier. . . sengers' syndrome aac deficiency was previously demonstrated in two unrelated patients with sengers' syndrome (omim ), an inherited autosomal recessive disease characterized by congenital cataracts, hypertrophic cardiomyopathy, mitochondrial myopathy and lactic acidosis but not peo [ ]. in the muscle tissues of both patients, the protein content of aac was drastically reduced. furthermore, ade- nine nucleotide transport was strongly impaired in liposomes reconstituted with mitochondrial extracts of the patients' skeletal or heart muscle. no mutation was found in the slc a gene and involvement of the aac locus was excluded by linkage analysis. the genetic defect underlying sengers' syndrome is still unknown. nevertheless, aac deficiency appears to be causally related to the clinical symptoms and tissue specificity of the disease. it may be that defective transcription, translation or targeting of aac is responsible for this disorder. . . pic deficiency in , a homozygous mutation in the gene encoding the pic (slc a ) (c. g→a) was found in two ill siblings of non- consanguineous turkish parents (the parents were heterozygous for the same mutation) [ ]. the human gene, which is spread over . kb of dna, maps to q . and contains coding exons; of these, exons a and b are closely related and spliced alternatively [ ]. the resulting isoforms, termed pic-a and pic-b, differ in amino acids and kinetic parameters but have the same substrate specificity and inhibitor sensitivity [ ]. both catalyze the uptake of phosphate, either by h+ co-transport or in exchange for oh−, into the mitochondria at the expense of the Δph component of the protonmotive force generated by electron transport. this uptake of pi into mitochondria is essential for oxidative phosphorylation of adp to atp. like isoforms of other mitochondrial proteins involved in oxidative phosphoryla- tion, pic-a is abundantly expressed only in heart and muscle, whereas pic-b is expressed in all tissues [ , ]. the differences between the two pic isoforms in kinetic properties (km of pic-b is -fold lower than that of pic-a, and vmax of pic-b is -fold higher than that of pic-a) and abundance in tissue ( and pmol pic-a per mg protein, and and pmol pic-b per mg protein in heart and liver bovine mito- chondria, respectively ) may account for the variation in reliance of the tissues on oxidative phosphorylation. the ubiquitous pic isoform b might match the basic energy requirement of all tissues, and isoform pic-a might become operative to accommodate the higher energy demands associated with contraction of striated muscle fibers. interestingly, the c. g→a mutation found in the two patients is localized in exon a and therefore affects the heart-/muscle-specific isoform, pic-a. in the pic-a of both patients glycine , that is conserved in all known pic sequences and in most other mitochon- drial carriers and is located in the first transmembrane helix three helix turns from the membrane's cytosolic side, is substituted by a glutamic acid residue; this substitution is deleterious for protein function [ ]. pic deficiency (omim ) is characterized by muscular hypotonia, progressive hypertrophic cardiomyopathy, elevated plasma lactate levels, and lactic acidosis. in one of the two affected siblings, cyanosis and poor weight gain were also observed. the patients died of heart failure at and months. in accordance with the tissue specificity of disease symptomatol- ogy, the synthesis of atp by oxidative phosphorylation was defective only in muscle. indeed, it was found that in heart mitochondria, but not in digitonin-permeabilized fibroblasts, adp-stimulated respira- tion of pyruvate was drastically reduced, whereas uncoupler-stimu- lated respiration was normal [ ]. furthermore, the activities of respiratory chain enzymes, pyruvate dehydrogenase and oligomycin- sensitive atp-ase were normal. no mutation was detected in the genes of atp synthase subunits encoded by mtdna or in slc a encoding the heart-/muscle-specific isoform of the adp/atp carrier. in view of the above-reported results, the disease is due to a defect in the pic-a- mediated import of pi into mitochondria, which prevents atp synthesis by oxidative phosphorylation. . . autosomal dominant progressive external ophthalmoplegia (adpeo) adpeo is a clinically and genetically heterogeneous disorder that is usually inherited as a dominant trait. it is caused by defects in certain nuclear genes and is characterized by multiple deletions of mtdna in post-mitotic tissues [ – ]. therefore, adpeo constitutes an example of nuclear gene defects affecting mtdna. the mtdna deletions result in a lack of respiratory chain proteins that lead to defective energy production. adpeo manifests an adult-onset phenotype (typically at – years of age); however, early onset has also been reported. typical symptoms of the disorder are peo due to weakness of the external eye muscles, ptosis, and mild descending myopathy. addi- tional variable symptoms include bilateral cataract, sensorineural hypocusia, tremor, ataxia, sensorimotor peripheral neuropathy, gen- eralized muscle weakness, exercise intolerance, depression, parkin- sonism and endocrine dysfunction. serum lactate levels are normal or slightly increased. muscle biopsies of affected individuals exhibit ragged-red fibers, cytochrome c oxidase-negative fibers, and dimin- ished activity of respiratory chain complexes. southern blot analysis of muscle dna reveals the presence of heterogeneous mtdna species due to multiple large-scale deletions ranging from . to . kb in length. mtdna lesions are present and accumulate in post-mitotic tissues, mainly brain, muscle and heart. this is consistent with the tissue distribution of aac in man, since aac is the predominant isoform of the adp/atp carrier in skeletal and heart muscle but is also present in brain. peo is one of the most common diseases caused by primary mtdna deletions. however, more recently, mutations of three nuclear genes have also been shown through linkage analysis to be responsible for adpeo by causing secondary multiple deletions of mtdna. one of these nuclear genes is slc a located on chromosome q and encoding the heart-/muscle-specific mitochondrial aac (omim ). the other two genes are twinkle, on chromosome q encoding an mtdna helicase (omim ), and polg on chromosome q encoding the catalytic subunit of mtdna-specific polymerase γ (omim ). furthermore, at least a fourth locus must be implicated in view of cases that could not be linked to any of the three genes reported above. nuclear-dependent peo is usually inherited as an autosomal dominant disorder, but cases with autosomal recessive inheritance it should be mentioned that according to mayr et al. [ ], “the small proportion of isoform b” detectable in all muscle tissues “may originate from either myoblasts or contaminating connective tissue or blood”. f. palmieri / biochimica et biophysica acta ( ) – author's personal copy have been described in families carrying heterozygous mutations in the polg gene. mutations in the polg and twinkle genes are the most frequent cause of peo, whereas those in the slc a gene are rarer. four heterozygous missense mutations of aac (a d, a p, l p, d g) have been found in adpeo families and one (v m) in a sporadic case. in the crystallographic structure of bovine aac , these mutations interface with the membrane except for d g which is located in the cytosolic loop between h and h . all the mutations are near the cytosolic side of the carrier protein, three to four helix turns from the common binding site. aac -related adpeo is relatively benign because the symptoms are usually limited to skeletal and facial muscles. as for all diseases caused by mutations of mtdna, treatment of adpeo is symptomatic and includes eye props and ptosis surgery. the twinkle and polg genes are directly involved in the repair and replication of mtdna, whereas aac catalyzes the exchange of cytosolic adp for intramitochondrial atp. therefore, the mechanism by which aac mutations cause mtdna instability is unclear. several hypotheses have been set forth; the mutations may: modify the transport properties of aac ; alter the intramitochondrial pool of adenine nucleotides causing a shortage of adp, which may be insuf- ficient for datp synthesis through the action of ribonucleotide reductase and nucleoside diphosphokinase and, consequently, yield a high error rate of mtdna polymerase; and cause a defective import of the mutated proteins into mitochondria, leading to misfolded proteins that are more susceptible to ros or to an increased pro- duction of ros within the mitochondria and damage of mtdna. to investigate the functional consequences of the human aac muta- tions found in adpeo patients, the mutations were introduced at equivalent positions in aac , the yeast ortholog of human aac [ ]. interestingly, expression of some of these mutants in aac -defective haploid strains of s. cerevisiae caused a growth defect on nonfermen- table substrates, a decrease of cytochrome content and reduced respiratory activity, but variable inhibition of atp and adp transport as deduced from measurements in liposomes reconstituted with mitochondrial extracts obtained from cells transformed with either each mutant or wild-type aac . in addition, heteroallelic strains, expressing both the aac mutant allele and wild-type aac , behaved as a recessive trait for oxidative growth and as a dominant trait for mtdna instability. therefore, the dominant feature of mtdna alteration induced by pathogenic aac alleles is similar in yeast and adpeo patients. . diseases due to defects of mitochondrial carriers involved in intermediary metabolism the diseases of this group known so far are cac deficiency, hhh syndrome, agc deficiency, amish microcephaly and neonatal myoclonic epilepsy. they will be reviewed in the following sections in the order in which they have been associated for the first time to alterations of a specific mitochondrial carrier gene. . . cac deficiency carnitine–acylcarnitine carrier (cac) deficiency (omim ) is the first disorder to have been associated with a member of the slc gene family, slc a [ , ]. this gene, which spans about kb, contains coding exons, maps to chromosome p . and encodes the cac, a protein of amino acids. the rat cac was purified in and years later its cdna was cloned in rat and man [[ , ] and references therein]. cac catalyzes a : electroneutral exchange between a mo- lecule of acylcarnitine, that enters mitochondria, and a molecule of free carnitine, that exits the organelles (see fig. k of ref. [ ]). the cac function is conserved in all eukaryotes, although mammalian cac has a higher affinity for long-chain rather than short-chain acylcarnitines and the lowest affinity for free carnitine, in contrast with the fungal carriers [[ ] and references therein]. in particular, cac is the key component of thecarnitine cyclewhichconsists of three steps: i)transferof acyl groups from acyl-coa to carnitine through carnitine palmitoyltransferase (cpt i), an outer mitochondrial membrane enzyme; ii) cac-mediated transport of acylcarnitines across the inner mitochondrial membrane in exchange for free carnitine; and iii) transfer of acyl groups from acylcarnitines to coa inside the mitochondria through cpt ii, an inner mitochondrial membrane enzyme (see fig. k of ref. [ ]). by catalyzing the carnitine/acylcarnitine exchange, cac allows the import of fatty acyl moieties into the mitochondria where they are oxidized by the β- oxidation pathway. this pathway is the major source of energy for heart and skeletal muscles during fasting and physical exercise. besides the exchange, cac is also able to perform unidirectional transport of substrates across the inner mitochondrial membrane but at a much lower rate (about one tenth that of the exchange); nevertheless, uniport of carnitine into carnitine-depleted mitochondria is physiologically important to balance the matrix level of carnitine with that present in the cytosol, a prerequisite for optimal carnitine/acylcarnitine activity. given that cac-mediated transport is an essential step in the long-chain fattyacid β-oxidationpathway, cac deficiency is a fatty acid β-oxidation disorder that prevents the body from converting long-chain fatty acids into energy. cac deficiency was first described in by stanley et al. [ ]. it is a severe autosomal recessive, nonpopulation-specific disorder pre- senting an equal male-to-female ratio. the most affected organs are heart, liver, brain, and skeletal muscles. the disorder manifests with life-threatening episodes of coma upon fasting (due to hypoglycemia, since the liver is unable to produce ketone bodies from fat during fasting and muscles use glucose), cardiomyopathy, cardiac arrhythmia, muscle weakness and abnormal liver function (all likely due to the accumulation of long-chain fatty acids and acylcarnitines that cannot be oxidized). other symptoms include vomiting, lethargy, hy- potonia, weakness, hepatomegaly, cardiac insufficiency, respiratory distress, and seizures. in addition to hypoglycemia, metabolic alte- rations in blood include hypoketosis (caused by lack of hepatic fatty acid β-oxidation), acidosis, hyperammonemia (possibly due to a compensatory increase in amino acid oxidation), dicarboxylic acid- uria, increased long-chain acylcarnitines, decreased free carnitine, mildly elevated creatine kinase and liver enzyme levels and occa- sional hypocalcemia. when examined in cultured cells, cac and fatty acid β-oxidation activities are markedly reduced or nearly abo- lished, although the other carnitine cycle enzymes, cpt i and cpt ii, and β-oxidation enzymes exhibit normal activity. cac deficiency presents two infantile phenotypes: the first, and most common, with early onset in the neonatal period, and the second milder form with onset in infancy or, less frequently, in childhood. neonates with the early-onset variety deteriorate rapidly after birth; their mortality rate is high, generally displaying a good correlation between the severe phenotype and null genotype. infants whose cac retains some residual activity usually have no cardiac involvement and can respond to treatment with medium-chain triglycerides that do not require carnitine to enter the mitochondria. when both phenotypes are untreated, patients with cac deficiency experience hypoglycemic crises that may lead to brain damage, coma and death, or may die from cardiac arrest. since the first reported mutation in the slc a gene [ ], others have been identified (fig. ). interestingly, some missense mutations (d n, r w, p r and d h; fig. a) regard residues of the signature motifs present in all mitochondrial carriers, and two others (r q and g r; fig. b) concern residues whose equivalents in yeast cac have been proposed to bind the substrate [ ], underscoring the importance of the motifs and of the proposed “common substrate-binding site” [ ] for the structure and function of these proteins. also known as carnitine/acylcarnitine translocase (cact) deficiency. f. palmieri / biochimica et biophysica acta ( ) – author's personal copy early recognition and treatment is crucial in cac-deficient patients. cac deficiency can be identified by newborn screening programs using tandem mass spectrometry, although in severe infantile cases the results of testing might return after the child is already symp- tomatic. management and long-term treatment of the cac patient consist of fasting prevention with frequent meals, a diet rich in carbohydrates, low in lipids (of which about % should be provided as medium-chain triglycerides), and supplemented with essential poly- unsaturated fatty acids. patients should have an emergency protocol in place to assure administration of intravenous glucose in case of fever, vomiting or other illness preventing oral intake. intake of l-carnitine may be helpful, particularly in individuals with severely deficient car- nitine levels. cac deficiency can be differentiated from other disorders of the carnitine cycle and fatty acid β-oxidation in cultured fibroblasts (e.g., medium-chain acyl-coa dehydrogenase deficiency, omim ) by measurement of urine organic acid and plasma acylcarni- tine profiles. diagnosis should be confirmed in vitro by measurements of fatty acid β-oxidation activity, cac activity (in cultured fibroblasts [ ], in reconstituted liposomes [ ] or by complementation in s. cerevisiae [ ] or aspergillus nidulans [ ]) and dna testing. determi- nation of carrier activity is also important to establish that a newly found mutation is disease-causing. . . hhh syndrome another error of metabolism is hhh syndrome (omim ) that is caused by mutations in the slc a gene [ ]. this gene, which maps to band q . , spans about kb and contains coding exons, encodes isoform of the ornithine carrier, named orc . the ornithine carrier was purified from rat liver mitochondria in and termed ornithine/citrulline carrier for its ability to catalyze a highly active ornithine/citrulline exchange and for its importance in the urea cycle [ ]. it was cloned for the first time in s. cerevisiae in [ ]. later, starting from the yeast ortholog, two human isoforms, orc and orc , were identified [ , ]. the two human isoforms were over- expressed and characterized in reconstituted liposomes. both trans- port l-isoforms of ornithine, lysine, arginine, and citrulline by a : substrate exchange or, to a lesser extent, by an exchange of basic amino acids for h+; both are inactivated by spermine and spermi- dine and stimulated by malate and phosphate. however, these iso- forms differ in some respects. firstly, orc has a broader specificity than orc , since it transports l- and d-histidine, l-homoarginine and d-isoforms of ornithine, lysine and arginine with the same efficiency as l-isoforms. secondly, orc has a higher affinity for lysine and arginine and a lower affinity for ornithine and citrulline than does orc . thirdly, orc is expressed at higher levels than orc in all the tissues investigated, particularly in liver, lung, pancreas and testis [ ]. orc plays a number of important roles in cell metabolism. for example, under conditions of low arginine content in the diet and/or in tissues where argininase activity is negligible, ornithine produced intramitochondrially from glutamate must be exported to the cytosol to accomplish polyamine biosynthesis. conversely, when dietary content of arginine is high, the ornithine formed by arginine hydro- lysis in the cytosol must be imported into the mitochondria where it is converted to glutamate and proline by ornithine aminotransferase, an enzyme that is located in the mitochondrial matrix and abundant in liver and kidney. hepatic ornithine aminotransferase is localized in the pericentral hepatocytes that contain glutamine synthetase and not in the periportal hepatocytes containing the urea cycle enzymes [ ]. in periportal hepatocytes, orc carries out the important function of exchanging cytosolic ornithine for mitochondrial citrulline. by provid- ing this function, orc links the enzyme activities of urea synthesis in the cytosol to those in the mitochondria and is therefore an essential component of the urea cycle, as previously proposed (see fig. e of ref. fig. . mutations in patients with cac deficiency. (a) lateral view of the structural-homology model of human cac (in cartoon representation) showing the positions of the amino acid substitutions found to date in cac deficiency. (b) a view of the proposed substrate-binding site from the cytoplasmic side. the carnitine substrate is shown in stick representation. (c) list of type and number of mutations found to date in patients with cac deficiency. all mutations are from the hgmd database (http://www.hgmd.cf.ac.uk/ac/ index.php). the colour code for the transmembrane α-helices is as follows: h , red; h , orange-green; h , light green; h , dark green; h , light blue; and h , blue. purple surfaces highlight the salt bridge network between residues k and d , k and e , and k and d . f. palmieri / biochimica et biophysica acta ( ) – author's personal copy [ ]) [[ ] and references therein]. under physiological conditions, it is highly probable that the key step of the urea cycle consisting in the ornithine/citrulline exchange is catalyzed, mainly or exclusively, by orc , since orc has a lower affinity for ornithine and citrulline and is expressed in liver at a much lower level. deficiency of orc in patients with hhh syndrome supports this interpretation. as indicated by its name, hhh syndrome is characterized by hyperammonemia, hyperornithinemia and homocitrullinuria. these metabolic alterations result from a defect in orc as do many clinical symptoms of the disease. hyperammonemia is due to impairment of the urea cycle at the level of orc . defective orc does not allow import of ornithine from the cytosol to the mitochondria and, con- sequently, impedes the function of intramitochondrial ornithine transcarbamoylase that condenses carbamoyl phosphate and orni- thine to form citrulline. accumulation of ornithine in the cytosol explains hyperornithinemia and leads to an increased production of polyamines. in the absence of ornithine inside the mitochondria, car- bamoyl phosphate accumulates and either condenses with lysine to form homocitrulline, leading to homocitrullinuria, or enters the cytosolic pyrimidine biosynthetic pathway, leading to increased excretion of orotic acid and uracil. other laboratory findings include increased levels of glutamine, alanine, liver transaminases and alka- line phosphatase. hhh syndrome may present at any age from the neonatal phase to adulthood. it usually manifests in early childhood, with % of patients presenting in the neonatal period. the most common symptoms of the disorder are episodes of confusion, lethargy, and coma due to hyper- ammonemia, and neurologic features such as mental retardation, learning difficulties, spastic paraplegia and seizures. interestingly, most patients present with pyramidal dysfunction, often resulting in early adulthood in frank spastic paraplegia, whose course appears to be unrelated to treatment and whose pathogenetic mechanism(s) is still poorly understood [ ]. patients also often present abnormal liver function leading to hepatitis-like attacks and coagulopathy with factor-specific defects (factors vii, ix and x). some symptoms present in an acute way (e.g., intermittent episodes of vomiting, ataxia, lethargy, confusion, coma, myoclonic jerks, and hepatitis-like attacks), whereas others follow a more chronic course (e.g., aversion for protein-rich foods, coagulation abnormalities, hypotonia, develop- mental delay, progressive encephalopathy with mental regression, pyramidal dysfunction). similarly to other urea cycle defects, neonates may manifest symptoms soon after feeding. children and adults have a tendency to refuse high-protein foods. although variable, the phenotype of hhh patients is somewhat milder than that associated with defects of urea cycle enzymes. it may be that orc partially compensates for orc . gain of function polymorphism of orc and a haplogroup (mtdna lineage) have been suggested [ ] as possible factors that may influence the orc deficiency phenotype. because in mouse isoform of orc is a pseudogene (given the presence of a single nucleotide deletion near the ′-end causing a frame shift), it would be interesting to delete the murine orc and compare the resulting phenotype with that of hhh patients and the phenotype of urea cycle enzyme knock-out mice. hhh syndrome is an autosomal recessive disease and has a pan- ethnic distribution with a higher proportion of cases reported in canada (a founder mutation located in quebec), italy, and japan. the male-to-female ratio is approximately : . since its first description in by shih et al. [ ], additional cases have been reported. in fig. , all the naturally occurring mutations in orc known to date are listed, including from dr. dionisi-vici that are yet unpublished. many of the mutations have been functionally analyzed in recon- stituted liposomes and found to inactivate the carrier [ , ]. inter- estingly, two of the disease-causing mutations, r q and e k, concern residues involved in the proposed substrate-binding site, fig. . mutations in patients with hhh syndrome. (a) lateral view of the structural-homology model of human orc (in cartoon representation) showing the positions of the amino acid substitutions found to date in hhh syndrome. the transmembrane α-helices are coloured as reported in fig. . purple surfaces highlight the salt bridge network between residues k and d , k and e , and k and d . (b) a view of the proposed substrate-binding site from the cytoplasmic side. the ornithine substrate is shown in stick representation. (c) list of type and number of mutations found thus far in patients with hhh syndrome. seventeen mutations were taken from the hgmd database (http://www. hgmd.cf.ac.uk/ac/index.php); the remainder was obtained through the courtesy of dr. dionisi-vici. f. palmieri / biochimica et biophysica acta ( ) – author's personal copy whereas t r and p r residues belonging to the signature motifs of the mitochondrial carrier family (fig. ). furthermore, of the missense mutations affect residues protruding toward the cavity occupied by the entering substrate in the cytosolic conformation of the carrier (fig. ). early diagnosis and treatment of hhh syndrome are important to prevent neurologic and cognitive deterioration. however, diagnosis is often delayed as a result of non-specific symptoms. differential diag- nosis is based mainly on biochemical characteristics: persistently elevated plasma ornithine levels to times higher than normal, which distinguishes the disorder from other urea cycle defects; the presence of homocitrulline and orotic acid in urine; and episodic or postprandial hyperammonemia, differentiating hhh syndrome from gyrate atrophy (omim ) which is caused by ornithine trans- aminase deficiency. measurement of carrier activity in cultured fibro- blasts [ ] and in reconstituted liposomes followed by genetic testing constitutes evidence of the disease. treatment of hhh syndrome is similar to that of other urea cycle defects and is based mainly on a low-protein diet. it is usually accompanied by supplementation of citrulline and ornithine (to reduce ammonemia), although the long-term side effects of hyper- ornithinemia are not known. arginine, sodium benzoate and sodium phenylbutyrate have also been administered to decrease ammonia levels. treated patients exhibit good metabolic control and very infrequent relapses of hyperammonemia. the mortality rate for the disease is low. . . agc deficiency aspartate/glutamate carrier isoform (agc ) deficiency is a highly widespread autosomal recessive disease in the far east and southeast asia with a carrier prevalence of about in individuals and a male- to-female ratio of . : [ ]. agc deficiency was also detected in the middle east, including israel. more recently, some cases have been found in the us and the united kingdom, pointing towards a pan- ethnic distribution. agc deficiency has been extensively studied by dr. saheki in japan who identified slc a as the gene responsible for the disease by means of homozygosity mapping and positional cloning [ ]. the slc a gene, spanning about kb, maps to chromosome q . and consists of exons. subsequently, it was found that the gene product of slc a , previously termed citrin, and its closely related human homolog, aralar, function as ca +- regulated aspartate/glutamate carriers, abbreviated as agc and agc , respectively [ ]. agc (encoded by slc a on chromosome q ) is highly expressed in brain, heart, and skeletal muscle, whereas agc is found in several tissues but most abundantly in liver where agc is absent [ , ]. these proteins are localized in the inner mitochondrial membrane, bind ca +, and consist of two domains: the c-terminal domain, containing all the sequence features of the mito- chondrial carrier family, and the n-terminal domain, a long extension containing four ef-hand ca +-binding motifs and protruding outside the inner mitochondrial membrane. in reconstituted liposomes, agc and agc transport aspartate and glutamate by an obligatory : exchange. the exchange is electrophoretic because aspartate is tran- sported as an anion, whereas glutamate is transported with a proton. consequently, in energized mitochondria with a positive membrane potential outside, exit of aspartate and entry of glutamate are strongly favoured and therefore the agc-catalyzed reaction is essentially unidirectional and irreversible. the km values of both isoforms for external aspartate and glutamate are about . and . mm, re- spectively, do not change with membrane potential in reconstituted liposomes, and are virtually identical to those determined with native agc. the c-terminal domains of agc and agc account for the activities and all transport properties of the entire two proteins and constitute their catalytic portion, whereas the n-terminal domains, containing the ca +-binding sites, make up their regulatory portion. in fact, the activity of agc and agc is stimulated by ca + on the external side of the inner mitochondrial membrane, since this stimulation is not affected by ruthenium red, a specific inhibitor of ca + entry into mitochondria [ ]. furthermore, by using mitochond- rially targeted luciferase to monitor atp formation, a surplus production of atp was observed in the mitochondria of agonist- stimulated cells overexpressing agc or agc but not in stimulated cells overexpressing the c-terminal domains lacking the ca +-binding sites. notably, the intramitochondrial ca + level was the same in cells overexpressing either the entire protein (agc or agc ) or each of the two c-terminal domains alone [ ]. therefore, cytosolic ca + activates mitochondrial oxidative metabolism through its binding to the n- terminal domain of agc. the major function of agc is to supply aspartate to the cytosol. this is particularly important in hepatocytes that have a negligible capacity of taking up aspartate from the blood. in hepatocytes, agc plays a fundamental role in urea synthesis by supplying aspartate to argi- ninosuccinate synthetase (ass), a urea cycle enzyme that is localized in the cytosol and condenses citrulline and aspartate to produce argininosuccinic acid. the reactions of the urea cycle, their subcellular localization and site of aspartate involvement are shown in fig. e of ref. [ ]. besides urea synthesis, cytosolic aspartate is necessary for gluconeogenesis from reduced substrates and for protein, purine and pyrimidine synthesis. cytosolic aspartate is also very important for the oxidation of cytosolic nadh+h+, since agc is a key component of the malate–aspartate shuttle that transfers the reducing equivalents of nadh+h+ from cytosol into mitochondria (see fig. h of ref. [ ]). in this shuttle, agc again provides the cytosol with aspartate; in the cytosol, aspartate is transaminated to oxaloacetate which is reduced by cytosolic malate dehydrogenase to malate, leading to the oxidation of cytosolic nadh+h+. malate enters the mitochondria via the oxoglutarate carrier and in the matrix is reduced to oxaloacetate by mitochondrial malate dehydrogenase, resulting in the reduction of intramitochondrial nad+. subsequently, oxaloacetate is transami- nated to aspartate by mitochondrial aspartate aminotransferase, com- pleting the cycle. it should be emphasized that the malate–aspartate shuttle operates in the direction of transferring reducing equivalents from cytosol to mitochondria because the reaction catalyzed by agc is unidirectional and irreversible. by oxidizing cytosolic nadh, the malate–aspartate cycle allows aerobic glycolysis and alcohol metabo- lism to occur. it is important to note that the glycerol- -phosphate shuttle, which is the main physiological alternative mechanism for the oxidation of cytosolic nadh, exerts low activity in human liver (whereas it is very active in murine liver). because agc is the only isoform, or at least the most prevalent isoform, of this carrier expressed in liver, lack of its function in this tissue explains many symptoms of the disease. agc deficiency causes two age-dependent phenotypes: neonatal intrahepatic cholestasis caused by citrin (agc ) deficiency (niccd, omim ) and adult- onset type ii citrullinemia (ctln , omim ). type ii citrulline- mia usually manifests in adults between the ages of and years. a shortage of aspartate in the cytosol of hepatocytes causes citrulline- mia, hypoproteinemia, and recurrent episodes of hyperammonemia responsible for the observed encephalopathy and neuropsychiatric symptoms (e.g., sudden aberrant behavior, disturbance of conscious- ness, disorientation, delirium, tremor, convulsive seizures and coma). the inhibition of cytosolic nadh oxidation, with the consequent increase in the nadh/nad+ ratio, causes a distaste for carbohydrates, a preference for fat and especially for proteins as well as an incapacity to consume alcohol. in fact, in patient dietary surveys carbohydrates average only ~ % of total caloric intake, whereas proteins average ~ %. in particular, a strong desire for beans and nuts, which are the activity, which is based on measurement of the incorporation of [ c]ornithine, as compared to that of [ h]leucine, into cellular protein, is also markedly decreased or null in patients with gyrate atrophy. f. palmieri / biochimica et biophysica acta ( ) – author's personal copy particularly rich in aspartate and asparagine, has been described. citrullinemia and hyperammonemia are also due to a unique feature of the disease, i.e., a variable liver-specific reduction in ass protein and activity with no alterations in either its gene or hepatic ass mrna levels [ ]. conversely, in type i citrullinemia (ctln , omim ) the gene for ass is mutated, leading to ass deficiency in all tissues [ ]. it is not yet clear why the level of hepatic ass is low in ctln . it may be that critical aspartate levels are required to make ass active or to stabilize the enzyme. patients also manifest fatty liver most likely because they oxidize cytosolic nadh+h+ by yet another pathway, the citrate–malate shuttle (see fig. d of ref. [ ]), whose normal function is to synthesize fatty acids by transferring acetyl-coenzyme a from the mitochondrial matrix to the cytosol. in fact, the key enzyme of the citrate–malate shuttle, the citrate carrier, exports citrate from mitochondria to the cytosol where it is cleaved to acetyl-coenzyme a and oxaloacetate by atp-citrate lyase. furthermore, some patients develop hyperlipidemia which likely results from the functioning of the citrate–malate shuttle and from the accumulation of glycerol- - phosphate due to poor activity of the glycerol- -phosphate cycle in human liver. other laboratory findings are increased arginine and pancreatic secretory trypsin inhibitor levels, an elevated threonine-to- serine ratio, and a decreased ratio between branched-chain amino acids (bcaas) to aromatic amino acids (aaas) in patient sera. finally, pancreatitis and hepatocellular carcinoma occur with a higher incidence in ctln patients. adult-onset type ii citrullinemia is pro- gressive and patients usually die from hyperammonemic encephalo- pathy and complications of brain edema. given the poor prognosis of the adult agc -deficiency phenotype, patients should consider undergoing liver transplantation. the neonatal phenotype, niccd, was recognized more recently by saheki and co-workers [ ]. affected children commonly present transient intrahepatic cholestasis, fatty liver, hepatomegaly, growth retardation, citrullinemia, aminoacidemias (elevated methionine, threonine, tyrosine, phenylalanine, lysine and arginine), an increased threonine-to-serine ratio and galactose concentration, ketotic hypo- glycemia, and hypoproteinemia. some patients present with hepatitis, jaundice, decreased coagulation factors, hemolytic anemia and bleed- ing diathesis as a result of liver dysfunction and hypoproteinemia. high levels of plasma α-fetoprotein have been detected in niccd but not in ctln . the neonatal phenotype of agc deficiency is usually benign. symptoms disappear by the age of months; afterwards, these patients become seemingly healthy (or manifest non-specific symp- toms) but display a preference for protein- and lipid-rich foods and an aversion for foods high in carbohydrate content. one or several decades later, some agc -deficient individuals go on to develop ctln . the clinical spectrum of agc deficiency has recently been expanded with the report of infantile presentation characterized by failure to thrive and bleeding diathesis and no evidence of neonatal intrahepatic cholestasis [ ]. in the compensatory period (which corresponds to the transition from niccd to the onset of ctln ), affected individuals live with metabolic defects that mainly involve liver, i.e., a high cytosolic nadh/ nad+ ratio and impairment of urea synthesis. it is likely that in the agc -deficient liver, partial oxidation of cytosolic nadh is accom- plished by the low activity of the glycerol- -phosphate nadh shuttle and by the citrate–malate cycle, as mentioned above. given that in patient liver the export of aspartate from the mitochondria is nearly null and aspartate is virtually not taken up by the blood, ureagenesis is dependent on aspartate production in the cytosol. aspartate can be produced in the cytosol in two ways: from asparagine by the action of asparaginase and from oxaloacetate by cytosolic aspartate amino- transferase. asparagine can be synthesized by asparagine synthetase or can be supplied from the diet via the portal venous blood. oxa- loacetate can be formed from fumarate, a product of the urea cycle enzyme argininosuccinate lyase, by the successive actions of cytosolic fumarase and malate dehydrogenase. in both cases serious draw- backs emerge, i.e., the production of mol of ammonia per each mol of aspartate provided by asparagine and the generation of mol of nadh+h+ per each mol of aspartate provided by oxaloacetate origi- nating from malate (see fig. b of ref. [ ]). therefore, in the agc - deficient patient, the deficit of ureagenesis is due not only to a decreased availability of aspartate to ass but also to an increased cytosolic nadh/nad+ ratio as a consequence of the defective malate– aspartate nadh shuttle and of aspartate production from fumarate, as mentioned above. slc a is the only gene known to be associated with agc deficiency. the first mutations observed in slc a led to either truncation of the protein or extensive deletions causing agc de- ficiency [ ]. more recently, missense mutations were also detected. until now, no significant correlation has been observed between slc a mutation types and the age of ctln onset. forty-four mutations have been found thus far in patients with agc deficiency, of which have not yet been published (t. saheki, personal communication). all together, missense mutations have been found. the newly identified mutation r q that inhibits transport of glutamate and aspartate in reconstituted liposomes by about % [ ] regards a residue belonging to the proposed common substrate-binding site formed by r , r , e and k — residues equivalent to those proposed to bind the substrate in yeast agc (r , r , e and k ) [ ]. r corresponds to r of the bovine oxoglutarate carrier, to r of theyeast aac , and to r of the murine ucp which also do not tolerate replacement with other amino acids [[ ] and references therein]. r also corresponds to r of the human orc ; its substitution with q causes hhh syndrome (see . ). to examine the consequences of the r q mutation, docking of glutamate was performed using the residues of the common substrate- bindingsite of the human agc [ ]. docking with thehumanwild-type agc shows the substrate directly on top of the salt bridge network interacting with r and the charged residues k and k of the network (fig. a). in the case of the r q mutant, the substrate is positioned far from the salt bridge network at the level of the binding site (fig. b). therefore, lack of r in position impedes the interaction of the substrate with the salt bridges causing loss of activity. it is tempting to speculate that residue r functions as a mobile side-chain that transports the substrate onto the salt bridges, determining their aperture and the substrate's progression through the protein toward the matrix. the pathophysiology of agc deficiency was recently investigated by elegant studies conducted on knock-out mice [ ]. slc a −/− mice exhibited a marked decrease in mitochondrial aspartate tran- sport and malate–aspartate shuttle activities in vitro. in liver perfused with ammonia, the rate of urea production was drastically reduced and the lactate-to-pyruvate ratio, which reflects the cytosolic nadh/ nad+ redox state, was increased. under these conditions, both the deficit in ureagenesis and increase in the nadh/nad+ ratio were partially corrected by the administration of asparagine that enters hepatocytes and is hydrolyzed to aspartate. likewise, pyruvate (but not aspartate or citrate) reduces the deficit in ureagenesis and decreases the nadh/nad+ ratio in the liver-perfused system. further- more, in liver perfused with lactate (but not pyruvate) gluconeogen- esis was diminished. these results demonstrate that hepatic cytosolic aspartate is rate-limiting in slc a −/− mice. however, agc knock- out mice did not manifest the key symptoms of agc deficiency present in man. the mice exhibited neither hyperammonemia and changes in amino acid levels even following administration of protein- rich diets nor hypoglycemia upon fasting. the most likely explanation for the lack of ctln -like phenotype in the agc knock-out mice is the high activity of the glycerol- - phosphate cycle in their liver. consequently, saheki et al. generated mice with a combined disruption of the agc gene and the gene for mitochondrial glycerol- -phosphate dehydrogenase, a key compo- nent of the glycerol phosphate cycle [ ]. double knock-out mice f. palmieri / biochimica et biophysica acta ( ) – author's personal copy investigated after days of age manifested: (i) a reduction in growth rate, which is consistent with the observation that usually ctln patients are thin and niccd patients exhibit growth retardation; (ii) hyperammonemia and increased lactate-to-pyruvate ratio under fed conditions, which were further increased after sucrose administra- tion; (iii) elevated plasma citrulline levels and threonine/serine ratio under fed and fasted conditions (not altered by sucrose administra- tion); (iv) decreased plasma bcaa/aaa ratio and alanine level after sucrose administration (both were normal under fed or fasted conditions); (v) hypoglycemia upon fasting due to the increased cytosolic nadh/nad+ ratio leading to decreased gluconeogenesis from reduced substrates and to the lowered oxaloacetate level re- quired by phosphoenolpyruvate carboxykinase; and (vi) fatty liver, elevated levels of plasma free fatty acids and glycerol; the latter being due to loss of the glycerol- -phosphate shuttle activity in all the tissues and to loss of the malate–aspartate shuttle in liver. finally, the hepatic aspartate content was lower in the double knock-out mice compared to wild-type, glycerol- -phosphate shuttle and agc single knock-out mice [ ]. therefore, the double knock-out mice exhibited most of the features of the human agc -deficient phenotype. agc deficiency should be suspected in children with hypoglyce- mia, hepatomegaly, growth retardation or failure to thrive. in addition, agc deficiency should also be considered in children presenting with elevated blood galactose levels. it is important to confirm the diagnosis of agc deficiency, as treatment of these patients highly contrasts that of urea cycle disorders. individuals with urea cycle enzyme defects are given protein-restricted, high-caloric diets to prevent episodes of hyperammonemia. in contrast, ctln -affected patients manifest severe episodes of hyperammonemia upon consumption of high- carbohydrate diets. likewise, severe episodes of hyperammonemia have been observed after administration of glycerol or fructose for the treatment of hyperammonemia and brain edema [ ]. alcohol intake and the use of anti-inflammatory and analgesic drugs and/or surgery may often provoke ctln symptoms. at present, liver transplantation is the only effective treatment for type ii citrullinemia. to prevent hyperammonemia (and resolve growth retardation in children), a diet high in protein and lipid content and low in carbohydrates is highly recommended. this recommendation is further supported by the observed food preference of these patients. treatment with pyruvate has also been suggested to decrease the cytosolic nadh/nad+ ratio [ ]. moreover, in children with niccd, supplementation with fat- soluble vitamins and use of lactose-free formula or high protein and low carbohydrate diet have also been applied [ ]. in summary, treatment of niccd requires continued dietary control and growth monitoring. continuous monitoring of these patients is necessary to prevent a severe outcome later in life. . . amish microcephaly (mcpha) amish microcephaly (mcpha, omim ) is an inborn error of metabolism presenting severe microcephaly and -oxoglutaric acid- uria [ ]. the disorder is caused bya defect in the slc a gene which encodes a protein of residues [ ]. the protein was first identified as a deoxynucleotide carrier (dnc) [ ] and later as a thiamine pyro- phosphate carrier (tpc) [ ]. in reconstituted liposomes, tpc trans- ports the important coenzyme thiamine pyrophosphate (thpp), thiamine monophosphate (thmp) and deoxynucleotides in descend- ing order of potency, dndpndntpndnmp, by an obligatory exchange mechanism. nucleotides are also transported, though less efficiently than the corresponding deoxynucleotides. furthermore, the dideox- ynucleoside triphosphates that are produced in the cytosol from dideoxynucleosides, including antiviral and anticancer nucleoside analogs, are equally efficient substrates as dndps [ ]. to date, amish microcephaly has only been observed in the old order amish community in pennsylvania, u.s.a. with a high pre- valence of about in individuals. in this community, nuclear families affected with mcpha are connected to a single ancestral couple that lived in the s. the disease is characterized by severe fig. . structural-homology model of human agc illustrating the role of r in substrate translocation through the carrier. docking of glutamate in the r wild-type agc (a) and the q mutated agc (b) viewed from the lateral side. glutamate is shown in the van der waals representation and coloured in yellow. stick representations highlight some residues that are located within Å from the substrate. rectangular boxes contain residues r (a) and q (b). portions of helices iv, v and vi (in a and b) and of the salt bridge network (in a) were rendered transparent to facilitate viewing of the substrate and side-chains of some amino acids. the transmembrane α-helices are coloured as reported in fig. . purple surfaces highlight the salt bridge network between residues k and d , k and e , and k and d . f. palmieri / biochimica et biophysica acta ( ) – author's personal copy congenital microcephaly, elevated levels of α-ketoglutarate in urine, premature death (observed maximum survival, months) and, as a result of microcephaly, nearly absent cranial convexity, frontal sloping and distorted facial features. the only non-cns physical anomaly is moderate micrognathia. patients manifest no orientation to sight or sound and no fine or gross motor development, have metabolic acidosis enhanced by episodic viral illnesses, in some cases mild hepatomegaly, difficulty maintaining normal body temperature and develop increasing irritability. it was first considered that the increased levels of α-ketoglutarate might be the result of a defect in the α-ketoglutarate dehydrogenase complex which comprises three enzymes: -oxoglutarate dehydro- genase (omim ), dihydrolipoamide succinyltransferase (omim ) and dihydrolipoamide dehydrogenase (omim ). the genes encoding these enzymes were excluded on the basis of genetic linkage and haplotype analysis, indicating that this disorder must be associated with another genetic locus. through a whole-genome scan, fine mapping and haplotype ana- lysis, the gene affected in mcpha was localized to a region of mb, on chromosome q [ , ]. in this region, the genes encoding proteins with known mitochondrial functions were analyzed in view of the oxoglutarate abnormality in mcpha, which suggested mitochondrial dysfunction. a homozygous nucleotide change in the coding region of tpc, c. g→c (nm_ ), was identified in affected children. the parents of individuals affected by mcpha are obligate heterozygotes. the mutation, which produces a glycine-to-alanine substitution at position , alters a highly conserved residue in the mitochondrial carrier family that is located in the second part of the signature motif between helices h and h , in proximity to one of the important salt bridges that close the substrate translocation path in the cytosolic conformation of the carrier (fig. ). the substitution co-segregates with the disease in the families investigated [ ] and is deleterious for protein function. indeed, in reconstituted liposomes the transport activity of thpp, thmp or datp mediated by the g a mutant tpc was % to % that mediated by the wild-type tpc [ ]. in addition, substitutions of g with bulkier residues such as valine, cysteine and leucine are not tolerated at all (f. palmieri, unpublished data), as was also found for the equivalent glycine in other members of the mito- chondrial carrier family [[ ] and references therein]. it may be hy- pothesized that g functions as a hinge between helices h and h during the conformational changes that occur in the catalytic cycle of the carrier. slc a is the only gene known to be associated with amish microcephaly. to elucidate the pathogenic mechanism of this disease, a knock-out mouse for the slc a gene was generated, and the phenotype of both the knock-out mice and patients was studied at the cellular level [ ]. all slc a −/− mice died prior to . days' gestation. the homo- zygous embryos at e . exhibited an abnormally developed cns with a neural-tube closure defect and exencephaly that commonly fig. . structural-homology model of human tpc showing the position of the mutation g a responsible for amish microcephaly. cartoon representations of the g wild-type tpc (a) and the a mutated tpc (b) viewed from the cytoplasmic side. the residues g and a are in surf representation and coloured in yellow. the transmembrane α-helices are coloured as reported in fig. . purple surfaces highlight the salt bridge network between residues k and d , r and d , and k and d . cartoon and stick representations showing the proximity of g (c) and a (d) to the salt bridge between k and d . g and a are in surf representation and coloured in yellow. in c and d, the signature motifs (p-x-d/e-x-x-k/r) of h , h and h are coloured blue, green and orange, respectively, with the side-chains in stick representation. the salt bridges are indicated by black dotted lines. f. palmieri / biochimica et biophysica acta ( ) – author's personal copy involves the entire brain. in addition, they manifested erythropoietic failure, being nearly devoid of erythrocytes at e . , and elevated oxoglutarate levels in the amniotic fluid. in the mitochondria of knock-out mice fibroblasts and patient lymphoblasts, no differences in ribonucleoside- and deoxynucleoside- triphosphate levels, aswell as nodepletion or deletions in mitochondrial dna, were found in comparison to controls. these findings demonstrate that although slc a may be able to transport dndps and dntps in vivo, this function is not critical, owing perhaps to a redundancy of deoxynucleotide carriers in mammalian mitochondria. in agreement with the other function of tpc (i.e., to import thpp produced in the cytosol into the mitochondria in exchange for intra- mitochondrially generated thmp), it was found that thpp and thmp were not detectable in the mitochondria of knock-out mice fibroblasts and were markedly decreased in the mitochondria of patient lym- phoblasts as compared to controls. (of note, thpp and thmp were increased in the cytosol.) secondly, in the media of both cell lines lactate was markedly increased, indicating mitochondrial dysfunction. lastly, the mitochondrial thpp-dependent ketoglutarate dehydrogen- ase (kgdh) and pyruvate dehydrogenase (pdh) complex activities were nearly absent in knock-out mice mitochondrial extracts and strongly diminished in patient mitochondrial extracts as compared to controls. interestingly, the addition of thpp to the kgdh and pdh assay mixtures restored full activity, showing that the lower activities of kgdh and pdh in knock-out mice and patients is caused by lack of thpp in mitochondria [ ]. taken together, these data suggest that transport of thpp is the primary physiological function of tpc. table summarizes and compares the phenotypes of the slc a knock-out mice and patients with amish microcephaly. it can be observed that all the metabolic abnormalities of the human disease, starting from the decrease in thpp level in the mitochondria, were also present in the knock-out mice. however, these abnormalities, which are caused by lack of thpp in the mitochondria, were more severe in the knock-out mice. the only exception concerns increased oxoglu- tarate levels in amniotic fluid which were found to be less dramatic than those in the urine of patients. this is due to the fact that mouse embryos died prior to kidney formation and therefore did not concentrate the metabolite. the increased severity of the mouse model is also illustrated by the embryonic lethality of the slc a knock-out animals, by the arrest of brain formation at the level of the neural tube closure, probably caused by decreased fluxes through kgdh and pdh reactions, and by erythropoietic failure perhaps caused by lack of succinyl-coa, a product of kgdh. the most likely explanation for the differences in the mouse and human phenotypes is that human point mutation retains some thpp transport activity whereas the murine null mutation does not. in conclusion, amish microcephaly is due to a defect of thpp transport into mitochondria, which primarily affects brain development because of the brain's great need for oxidative metabolism. metabolic screening and eventual imaging studies are warranted for all children with congenital microcephaly. no intervention or vitamin therapy has proven to be effective for treating and/or im- proving the disorder. only supportive therapy is available for mcpha- table phenotypes of the knock-out mice and patients with amish microcephaly knock-out mice patients tpc activity absent reduced to – % lethality embryonic – months cns defects arrest of brain formation (open neural tube) microcephaly mitochondrial thpp and thmpa not detectable decreased cytosolic thpp and thmpa highly increased increased kgdh and pdh activitiesa highly decreased decreased kga increasedb highly increased lactatea highly increased increased mtdna abnormalitiesa absent absent mitochondrial (d)ntp levelsa normal normal a data obtained from slc a −/− mouse fibroblasts and patient lymphoblasts. b in amniotic fluid. fig. . partial sequence alignment of the glutamate and aspartate/glutamate carriers in man and other species displaying high conservation of p and g of the human glutamate carrier isoform . abbreviations: hs, homo sapiens; mm, mus musculus; bt, bos taurus; rn, rattus norvegicus; xt, xenopus tropicalis; dr, danio rerio; gg, gallus gallus; dm, drosophila melanogaster; ag, anopheles gambiae; nv, nasonia vitripennis; sc, saccharomyces cerevisiae; nf, neosartorya fischeri; af, aspergillus fumigatus; nc, neurospora crassa; dd, dictyostelium discoideum. f. palmieri / biochimica et biophysica acta ( ) – author's personal copy affected patients. phenobarbital has been administered for the treat- ment of seizures, and physical therapy is encouraged for alleviating contractures or other secondary neurologic manifestations. genetic risk of mcpha is best determined in the pre-gestational phase. . . neonatal myoclonic epilepsy mutations in the slc a gene encoding isoform of the gluta- mate carrier (gc ) cause a form of early myoclonic epilepsy (eme), named neonatal myoclonic epilepsy (omim ) [ ]. the slc a gene maps to chromosome p . and contains coding exons. gc and its isoform gc , which is encoded by slc a , were identified upon gene expression in e. coli as glutamate carriers by their transport properties in reconstituted liposomes [ ]. both iso- forms are located in the mitochondrial membrane (m. lasorsa and f. palmieri, unpublished data) and catalyze a glutamate/h+ symport with high specificity. however, gc has a high km for glutamate (∼ mm), whereas the km value of gc is low (∼ . mm) and the vmax value of gc is higher than that of gc . furthermore, isoform is expressed at higher levels than isoform in all the tissues investigated, particularly in liver, pancreas and brain. the differences in expression levels and kinetic parameters of the two isoforms suggest that isoform matches the basic requirement of all tissues, especially with respect to amino acid degradation, and that isoform becomes operative to accom- modate higher demands associated with specific metabolic functions. because glutamate is co-transported with an h+ by the gc, and therefore its distribution across the mitochondrial membrane is dependent on Δph, entry of glutamate is favoured in energized mi- tochondria. however, when glutamate is generated intramitochond- rially (e.g., by proline oxidation), the gc may operate in the reverse direction to limit intramitochondrial accumulation of glutamate. the first gc mutation, a substitution of proline with leucine, was found in a consanguineous arab muslim family with affected children among [ ]. a second mutation (a change from glycine to tryptophan) was identified in a consanguineous family from algeria with affected child among (l. colleaux and f. palmieri, unpublished data). all affected individuals were homozygous for the above- mentioned mutations, whereas the parents were heterozygous. the symptoms of the affected children in both families were similar: very-early-onset intractable myoclonic seizures, hypotonia, progressive microcephaly, abnormal visual nerve conduction, and rapid evolution into encephalopathy and spasticity. concerning labo- ratory features, neonatal myoclonic epilepsy is characterized by a typical eeg pattern with suppression burst and by an abnormal visual- evoked potential with low amplitude signal and slow response. both the p l and g w substitutions, which are located in h and h two and three helix turns from the cytosolic membrane side, respectively, alter highly conserved residues in the glutamate and aspartate/glutamate carriers found in man and other species (fig. ) and abolish glutamate transport in reconstituted liposomes. in digitonin-permeabilized fibroblasts from patients, glutamate oxida- tion was also strongly defective [[ ] and unpublished data]. these results have provided the first evidence that, despite normal oxidative phosphorylation, impaired mitochondrial glutamate import/metabo- lism leads to an alteration of neuronal excitability. although the pathogenesis of neonatal myoclonic epilepsy remains an open question, the following information should be stressed: i) during fetal development, gc is expressed first in brain, specifically within territories that contribute to the genesis and control of myo- clonic seizures [ ]; ii) gc expression is much greater in astrocytes than in neurons [ ]; iii) astrocyte mitochondria do not contain the aspartate/glutamate carrier [ ] and thus take up glutamate only via the glutamate carrier; iv) glutamate is a major excitatory neurotrans- mitter; and v) after its release into the synapse glutamate is taken up by astrocytes. it may be that gc -dependent epilepsy is due to a defect of mitochondrial glutamate transport in astrocytes, which would consequently lead to an increase in intrasynaptic glutamate concentration. there is no effective treatment for neonatal myoclonic epilepsy; affected children die within to years after birth or survive in a vegetative state. some severe cases of the disorder may be confused with febrile seizures, which are of shortened duration and recur less frequently. it is also important to distinguish neonatal myoclonic epilepsy from benign neonatal sleep myoclonus. the latter condition is seen in healthy infants, occurs only in sleep, and eeg is normal. aside from metabolic errors, eme syndromes may be caused by perinatal insults and brain malformations. a lumbar puncture may help to rule out neurodegenerative diseases. . conclusions since , when carnitine–acylcarnitine carrier deficiency was associated to the nuclear slc a gene, the number of nuclear gene defects impairing the function of mitochondrial metabolite transpor- ters has been rapidly increasing. to date, eight mitochondrial carrier- related diseases have been well characterized biochemically and genetically. this new group of diseases contributes to the current expansion of the field of mitochondrial disorders which were first thought to be limited to those related to respiratory chain dysfunction. in the last decade, the number of mitochondrial diseases caused by defects of the nuclear-coded components of the mitochondrial proteome has been growing at a booming rate to justify what is now known as “mitochondrial medicine”. despite the substantial progress that has been made in our understanding of the molecular bases of mitochondrial carrier-asso- ciated diseases, etiologic therapy is not yet available. current therapy is symptomatic and also addresses disease complications. however, some mitochondrial carrier-associated diseases, like other metabolic disor- ders, benefit enormously from appropriate dietary measures. effective disease management should include wider diffusion of newborn screening and close collaboration among physicians, geneticists and metabolic disease experts in specialized centers. preventive therapy through genetic counseling and prenatal diagnosis is essential and already available. as we wait for gene therapy to become available for practical application, further understanding of pathogenetic mechan- isms through a multidisciplinary approach combining in vitro assays with in vivo studies on patients, cellular and animal models will help to develop new therapeutic strategies that may prove useful to this group of metabolic disorders. further studies are likely to reveal additional mitochondrial carrier-related diseases (particularly in view of the fact that the function of about human genes of the slc family has yet to be identified) and provide new insight into this exciting field. acknowledgments this work was supported by grants from ministero dell'università e della ricerca (firb and prin), ministero della salute, apulia region, center of excellence in genomics (cegba) and european community contract lshm-ct- - . references [ ] i.j. holt, a.e. harding, j.a. morgan-hughes, deletions of muscle mitochondrial dna in patients with mitochondrial myopathies, nature ( ) – . [ ] d.c. wallace, g. singh, m.t. lott, j.a. hodge, t.g. schurr, a.m. lezza, l.j. elsas ii, e.k. nikoskelainen, mitochondrial dna mutation associated with leber's hereditary optic neuropathy, science ( ) – . [ ] p. rustin, t. bourgeron, b. parfait, d. chretien, a. munnich, a. rötig, inborn errors of the krebs cycle: a group of unusual mitochondrial diseases in human, biochim. biophys. acta ( ) – . [ ] p. rinaldo, d. matern, m.j. bennett, fatty acid oxidation disorders, annu. rev. physiol. ( ) – . [ ] m. schlame, j.a. towbin, p.m. heerdt, r. jehle, s. dimauro, t.j. blanck, defi- ciency of tetralinoleoyl-cardiolipin in barth syndrome, ann. neurol. ( ) – . f. palmieri / biochimica et biophysica acta ( ) – author's personal copy [ ] f. valianpour, r.j. wanders, h. overmars, p. vreken, a.h. van gennip, f. baas, b. plecko, r. santer, k. becker, p.g. barth, cardiolipin deficiency in x-linked cardio- skeletal myopathy and neutropenia (barth syndrome, mim ): a study in cultured skin fibroblasts, j. pediatr. ( ) – . [ ] i. napier, p. ponka, d.r. richardson, iron trafficking in the mitochondrion: novel pathways revealed by disease, blood ( ) – . [ ] a.g. estévez, j.p. crow, j.b. sampson, c. reiter, y. zhuang, g.j. richardson, m.m. tarpey, l. barbeito, j.s. beckman, induction of nitric oxide-dependent apoptosis in motor neurons by zinc-deficient superoxide dismutase, science ( ) – . [ ] j.a. mackenzie, r.m. payne, mitochondrial protein import and human health and disease, biochim. biophys. acta ( ) – . [ ] s.a. detmer, d.c. chan, functions and dysfunctions of mitochondrial dynamics, nat. rev. mol. cell biol. ( ) – . [ ] p. rustin, mitochondria, from cell death to proliferation, nat. genet. ( ) – . [ ] m. brandon, p. baldi, d.c. wallace, mitochondrial mutations in cancer, oncogene ( ) – . [ ] s. dimauro, e.a. schon, mitochondrial respiratory-chain diseases, new engl. j. med. ( ) – . [ ] m. zeviani, a. spinazzola, mitochondrial disorders, curr. neurol. neurosci. rep. ( ) – . [ ] j. schmiedel, s. jackson, j. schäfer, h. reichmann, mitochondrial cytopathies, j. neurol. ( ) – . [ ] a. rötig, a. munnich, genetic features of mitochondrial respiratory chain disorders, j. am. soc. nephrol. ( ) – . [ ] s. dimauro, g. davidzon, mitochondrial dna and disease, ann. med. ( ) – . [ ] a.h. shapira, mitochondrial disease, lancet ( ) – . [ ] j.a. smeitink, m. zeviani, d.m. turnbull, h.t. jacobs, mitochondrial medicine: a metabolic perspective on the pathology of oxidative phosphorylation disorders, cell metab. ( ) – . [ ] s. ohta, a multi-functional organelle mitochondrion is involved in cell death, proliferation and disease, curr. med. chem. ( ) – . [ ] m.r. duchen, roles of mitochondria in health and disease, diabetes ( ) – . [ ] d.c. wallace, a mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine, annu. rev. genet. ( ) – . [ ] e. mariani, m.c. polidori, a. cherubini, p. mecocci, oxidative stress in brain aging, neurodegenerative and vascular diseases: an overview, j. chromatogr. b ( ) – . [ ] m.t. lin, m.f. beal, mitochondrial dysfunction and oxidative stress in neurode- generative diseases, nature ( ) – . [ ] d.c. chan, mitochondria: dynamic organelles in disease, aging, and development, cell ( ) – . [ ] m. zeviani, v. carelli, mitochondrial disorders, curr. opin. neurol. ( ) – . [ ] e. trushina, c.t. mcmurray, oxidative stress and mitochondrial dysfunction in neurodegenerative diseases, neuroscience ( ) – . [ ] f. palmieri, the mitochondrial transporter family (slc ): physiological and pathological implications, in: m.a. hediger (ed.), the abc of solute carriers, pflugers arch. — eur. j. physiol., , , pp. – . [ ] f. palmieri, m. klingenberg, mitochondrial metabolite transporter family, in: w.j. lennarz, m.d. lane (eds.), encyclopedia of biological chemistry, vol. , elsevier, oxford, , pp. – . [ ] e. pebay-peyroula, c. dahout-gonzalez, r. kahn, v. trézéguet, g.j. lauquin, g. brandolin, structure of mitochondrial adp/atp carrier in complex with carbox- yatractyloside, nature ( ) – . [ ] e.r. kunji, m. harding, projection structure of the atractyloside-inhibited mitochondrial adp/atp carrier of saccharomyces cerevisiae, j. biol. chem. ( ) – . [ ] a.j. robinson, e.r. kunji, mitochondrial carriers in the cytoplasmic state have a common substrate binding site, proc. natl. acad. sci. u. s. a. ( ) – . [ ] a.r. cappello, d.v. miniero, r. curcio, a. ludovico, l. daddabbo, i. stipani, a.j. robinson, e.r.s. kunji, f. palmieri, functional and structural role of amino acid residues in the odd-numbered transmembrane α-helices of the bovine mitochon- drial oxoglutarate carrier, j. mol. biol. ( ) – . [ ] g. fiermonte, f. de leonardis, s. todisco, l. palmieri, f.m. lasorsa, f. palmieri, identification of the mitochondrial atp-mg/pi transporter. bacterial expression, reconstitution, functional characterization and tissue distribution, j. biol. chem. ( ) – . [ ] g. agrimi, m.a. di noia, c.m.t. marobbio, g. fiermonte, f.m. lasorsa, f. palmieri, identification of the human mitochondrial s-adenosylmethionine transporter: bacterial expression, reconstitution, functional characterization and tissue distribution, biochem. j. ( ) – . [ ] v. dolce, p. scarcia, d. iacopetta, f. palmieri, a fourth adp/atp carrier isoform in man: identification, bacterial expression, functional characterization and tissue distribution, febs lett. ( ) – . [ ] s. floyd, c. favre, f.m. lasorsa, m. leahy, g. trigiante, p. stroebel, a. marx, g. loughran, k. o'callaghan, c.m.t. marobbio, d.j. slotboom, e.r.s. kunji, f. palmieri, r. o'connor, the insulin-like growth factor-i-mtor signaling pathway induces the mitochondrial pyrimidine nucleotide carrier to promote cell growth, mol. biol. cell ( ) – . [ ] l. palmieri, s. alberio, i. pisano, t. lodi, m. meznaric petrusa, j. zidar, a. santoro, p. scarcia, f. fontanesi, e. lamantea, i. ferrero, m. zeviani, complete loss-of-function of the heart-/muscle-specific adenine nucleotide translocator is associated with mitochondrial myopathy and cardiomyopathy, hum. mol. genet. ( ) – . [ ] a.r. curran, d.m. engelman, sequence motifs, polar interactions and conforma- tional changes in helical membrane proteins, curr. opin. struct. biol. ( ) – . [ ] b.h. graham, k.g. waymire, b. cottrell, i.a. trounce, g.r. macgregor, d.c. wallace, a mouse model for mitochondrial myopathy and cardiomyopathy resulting from a deficiency in the heart/muscle isoform of the adenine nucleotide translocator, nat. genet. ( ) – . [ ] e.z. jordens, l. palmieri, m. huizing, l.p. van den heuvel, r.c.a. sengers, a. doërner, w. ruitenbeek, j.m.f. trijbels, j. valsson, g. sigfusson, f. palmieri, j.a.m. smeitink, adenine nucleotide translocator deficiency associated with sengers syndrome, ann. neurol. ( ) – . [ ] j.a. mayr, o. merkel, s.d. kohlwein, b.r. gebhardt, h. böhles, u. fötschl, j. koch, m. jaksch, h. lochmüller, r. horváth, p. freisinger, w. sperl, mitochondrial phosphate-carrier deficiency: a novel disorder of oxidative phosphorylation, am. j. hum. genet. ( ) – . [ ] v. dolce, v. iacobazzi, f. palmieri, j.e. walker, the sequences of human and bovine genes of the phosphate carrier from mitochondria contain evidence of alternatively spliced forms, j. biol. chem. ( ) – . [ ] g. fiermonte, v. dolce, f. palmieri, expression in escherichia coli, functional characterization, and tissue distribution of isoforms a and b of the phosphate carrier from bovine mitochondria, j. biol. chem. ( ) – . [ ] v. dolce, g. fiermonte, f. palmieri, tissue-specific expression of the two isoforms of the mitochondrial phosphate carrier in bovine tissues, febs lett. ( ) – . [ ] j. kaukonen, j.k. juselius, v. tiranti, a. kyttälä, m. zeviani, g.p. comi, s. keränen, l. peltonen, a. suomalainen, role of adenine nucleotide translocator in mtdna maintenance, science ( ) – . [ ] g. van goethem, b. dermaut, a. löfgren, j.j. martin, c. van broeckhoven, mutation of polg is associated with progressive external ophthalmoplegia characterized by mtdna deletions, nat. genet. ( ) – . [ ] j.n. spelbrink, f.y. li, v. tiranti, k. nikali, q.p. yuan, m. tariq, s. wanrooij, n. garrido, g. comi, l. morandi, l. santoro, a. toscano, g.m. fabrizi, h. somer, r. croxen, d. beeson, j. poulton, a. suomalainen, h.t. jacobs, m. zeviani, c. larsson, human mitochondrial dna deletions associated with mutations in the gene encoding twinkle, a phage t gene -like protein localized in mitochondria, nat. genet. ( ) – . [ ] f. fontanesi, l. palmieri, p. scarcia, t. lodi, c. donnini, a. limongelli, v. tiranti, m. zeviani, i. ferrero, a.m. viola, mutations in aac , equivalent to human adpeo- associated ant mutations, lead to defective oxidative phosphorylation in saccharomyces cerevisiae and affect mitochondrial dna stability, hum. mol. genet. ( ) – . [ ] m. huizing, v. iacobazzi, l. ijlst, p. savelkoul, w. ruitenbeek, l.p. van den heuvel, c. indiveri, j. smeitink, f.j.m. trijbels, r.j.a. wanders, f. palmieri, cloning of the human carnitine-acylcarnitine carrier cdna, and identification of the molecular defect in a patient, am. j. hum. genet. ( ) – . [ ] v. iacobazzi, m.a. naglieri, c.a. stanley, r.j.a. wanders, f. palmieri, the structure and organization of the human carnitine/acylcarnitine translocase (cact) gene, biochem. biophys. res. commun. ( ) – . [ ] c. indiveri, v. iacobazzi, n. giangregorio, f. palmieri, the mitochondrial carnitine carrier protein: cdna cloning, primary structure, and comparison with other mitochondrial transport proteins, biochem. j. ( ) – . [ ] j.r. de lucas, c. indiveri, a. tonazzi, p. perez, n. giangregorio, v. iacobazzi, f. palmieri, functional characterisation of residues within the carnitine/acylcarnitine translocase rx panaaxf distinct motif, mol. membr. biol. ( ) – . [ ] c.a. stanley, d.e. hale, g.t. berry, s. deleeuw, j. boxer, j.p. bonnefont, brief report: a deficiency of carnitine-acylcarnitine translocase in the inner mitochondrial membrane, new engl. j. med. ( ) – . [ ] s.v. pande, m. brivet, a. slama, f. demaugre, c. aufrant, j.m. saudubray, carnitine- acylcarnitine translocase deficiency with severe hypoglycemia and auriculo ventricular block. translocase assay in permeabilized fibroblasts, j. clin. invest. ( ) – . [ ] v. iacobazzi, f. invernizzi, s. baratta, r. pons, w. chung, b. garavaglia, c. dionisi- vici, a. ribes, r. parini, m.d. huertas, s. roldan, g. lauria, f. palmieri, f. taroni, molecular and functional analysis of slc a mutations causing carnitine- acylcarnitine translocase deficiency, hum. mutat. ( ) – . [ ] l. ijlst, c.w. van roermund, v. iacobazzi, w. oostheim, j.p. ruiter, j.c. williams, f. palmieri, r.j. wanders, functional analysis of mutant human carnitine acylcarni- tine translocases in yeast, biochem. biophys. res. commun. ( ) – . [ ] p. pérez, o. martínez, b. romero, i. olivas, a.m. pedregosa, f. palmieri, f. laborda, j.r. de lucas, functional analysis of mutations in the human carnitine/acylcarnitine translocase in aspergillus nidulans, fungal genet. biol. ( ) – . [ ] j.a. camacho, c. obie, b. biery, b.k. goodman, c.a. hu, s. almashanu, g. steel, r. casey, m. lambert, g.a. mitchell, d. valle, hyperornithinaemia–hyperammonae- mia–homocitrullinuria syndrome is caused by mutations in a gene encoding a mitochondrial ornithine transporter, nat. genet. ( ) – . [ ] c. indiveri, a. tonazzi, f. palmieri, identification and purification of the ornithine/ citrulline carrier from rat liver mitochondria, eur. j. biochem. ( ) – . [ ] l. palmieri, v. de marco, v. iacobazzi, f. palmieri, m.j. runswick, j.e. walker, identification of the yeast arg- gene as a mitochondrial ornithine carrier involved in arginine biosynthesis, febs lett. ( ) – . [ ] g. fiermonte, v. dolce, l. david, f.m. santorelli, c. dionisi-vici, f. palmieri, j.e. walker, the mitochondrial ornithine transporter. bacterial expression, reconstitu- tion, functional characterization, and tissue distribution of two human isoforms, j. biol. chem. ( ) – . f. palmieri / biochimica et biophysica acta ( ) – author's personal copy [ ] f.c. kuo, w.l. hwu, d. valle, j.e. darnell jr., colocalization in pericentral hepatocytes in adult mice and similarity in developmental expression pattern of ornithine aminotransferase and glutamine synthetase mrna, proc. natl. acad. sci. u. s. a. ( ) – . [ ] c. indiveri, a. tonazzi, i. stipani, f. palmieri, the purified and reconstituted ornithine/citrulline carrier from rat liver mitochondria: electrical nature and coupling of the exchange reaction with h+ translocation, biochem. j. ( ) – . [ ] s. salvi, f.m. santorelli, e. bertini, r. boldrini, c. meli, a. donati, a.b. burlina, c. rizzo, m. di capua, g. fariello, c. dionisi-vici, clinical and molecular findings in hyperornithinemia–hyperammonemia–homocitrullinuria syndrome, neurology ( ) – . [ ] j. camacho, r. mardach, n. rioseco-camacho, e. ruiz-pesini, o. derbeneva, d. andrade, f. zaldivar, y. qu, s.d. cederbaum, clinical and functional characteriza- tion of a human ornt mutation (t r) in the hyperornithinemia–hyperammo- nemia–homocitrullinuria (hhh) syndrome, pediatr. res. ( ) – . [ ] v.e. shih, m.l. efron, h.w. moser, hyperornithinemia, hyperammonemia, and homocitrullinuria. a new disorder of amino acid metabolism associated with myoclonic seizures and mental retardation, am. j. dis. child. ( ) – . [ ] a. tessa, g. fiermonte, c. dionisi-vici, e. paradies, m.r. baumgartner, y.h. chien, s. fecarotta, c. loguercio, h. ogier de baulny, m.c. nassogne, f. deodato, g. parenti, s.l. rutledge, m.a. villaseca, g. scarano, c.l. pierri, f. palmieri, f.m. santorelli, identi- fication of novel mutations in the slc a gene in hyperornithinemia, hyper- ammonemia, and homocitrullinuria (hhh) syndrome: a clinical, molecular and functional study. under submission. [ ] y.b. lu, k. kobayashi, m. ushikai, a. tabata, m. iijima, m.x. li, l. lei, k. kawabe, s. taura, y. yang, t.t. liu, s.h. chiang, k.j. hsiao, y.l. lau, l.c. tsui, d.h. lee, t. saheki, frequency and distribution in east asia of mutations identified in the slc a gene of japanese patients with citrin deficiency, j. hum. genet. ( ) – . [ ] k. kobayashi, d.s. sinasac, m. iijima, a.p. boright, l. begum, j.r. lee, t. yasuda, s. ikeda, r. hirano, h. terazono, m.a. crackower, i. kondo, l.c. tsui, s.w. scherer, t. saheki, the gene mutated in adult-onset type ii citrullinaemia encodes a putative mitochondrial carrier protein, nat. genet. ( ) – . [ ] l. palmieri, b. pardo, f.m. lasorsa, a. del arco, k. kobayashi, m. iijima, m.j. runswick, j.e. walker, t. saheki, j. satrústegui, f. palmieri, citrin and aralar are ca +- stimulated aspartate/glutamate transporters in mitochondria, embo j. ( ) – . [ ] a. del arco, m. agudo, j. satrústegui, characterization of a second member of the subfamily of calcium-binding mitochondrial carriers expressed in human non- excitable tissues, biochem. j. ( ) – . [ ] m. iijima, a. jalil, l. begum, t. yasuda, n. yamaguchi, m. xian li, n. kawada, h. endou, k. kobayashi, t. saheki, pathogenesis of adult-onset type ii citrullinemia caused by deficiency of citrin, a mitochondrial solute carrier protein: tissue and subcellular localization of citrin, adv. enzyme regul. ( ) – . [ ] f.m. lasorsa, p. pinton, l. palmieri, g. fiermonte, r. rizzuto, f. palmieri, recombinant expression of the ca +-sensitive aspartate/glutamate carrier increases mitochondrial atp production in agonist-stimulated chinese hamster ovary cells, j. biol. chem. ( ) – . [ ] k. kobayashi, n. shaheen, r. kumashiro, k. tanikawa, w.e. o'brien, a.l. beaudet, t. saheki, a search for the primary abnormality in adult-onset type ii citrullinemia, am. j. hum. genet. ( ) – . [ ] k. kobayashi, h. kakinoki, t. fukushige, n. shaheen, h. terazono, t. saheki, nature and frequency of mutations in the argininosuccinate synthetase gene that cause classical citrullinemia, hum. genet. ( ) – . [ ] t. ohura, k. kobayashi, y. tazawa, i. nishi, d. abukawa, o. sakamoto, k. iinuma, t. saheki, neonatal presentation of adult-onset type ii citrullinemia, hum. genet. ( ) – . [ ] d. dimmock, k. kobayashi, m. iijima, a. tabata, l.j. wong, t. saheki, b. lee, f. scaglia, citrin deficiency: a novel cause of failure to thrive that responds to a high- protein, low-carbohydrate diet, pediatrics ( ) – . [ ] m. moriyama, m.x. li, k. kobayashi, d.s. sinasac, y. kannan, m. iijima, m. horiuchi, l.c. tsui, m. tanaka, y. nakamura, t. saheki, pyruvate ameliorates the defect in ureogenesis from ammonia in citrin-deficient mice, j. hepatol. ( ) – . [ ] t. yasuda, n. yamaguchi, k. kobayashi, i. nishi, h. horinouchi, m.a. jalil, m.x. li, m. ushikai, m. iijima, i. kondo, t. saheki, identification of two novel mutations in the slc a gene and detection of seven mutations in patients with adult-onset type ii citrullinemia, hum. genet. ( ) – . [ ] g. fiermonte, d. soon, a. chaudhuri, e. paradies, p.j. lee, s. krywawych, f. palmieri, r.h. lachmann, an adult with type ii citrullinemia presenting in europe, new engl. j. med. ( ) – . [ ] a.r. cappello, r. curcio, d.v. miniero, i. stipani, a.j. robinson, e.r.s. kunji, f. palmieri, functional and structural role of amino acid residues in the even- numbered transmembrane α-helices of the bovine mitochondrial oxoglutarate carrier, j. mol. biol. ( ) – . [ ] m.l. verdonk, j.c. cole, m.j. hartshorn, c.w. murray, r.d. taylor, improved protein- ligand docking using gold, proteins ( ) – . [ ] d.s. sinasac, m. moriyama, m.a. jalil, l. begum, m.x. li, m. iijima, m. horiuchi, b.h. robinson, k. kobayashi, t. saheki, l.c. tsui, slc a -knockout mice harbor metabolic deficits but fail to display hallmarks of adult-onset type ii citrullinemia, mol. cell. biol. ( ) – . [ ] t. saheki, m. iijima, m.x. li, k. kobayashi, m. horiuchi, m. ushikai, f. okumura, x.j. meng, i. inoue, a. tajima, m. moriyama, k. eto, t. kadowaki, d.s. sinasac, l.c. tsui, m. tsuji, a. okano, t. kobayashi, citrin/mitochondrial glycerol- -phosphate dehydrogenase double-knockout mice recapitulate features of human citrin deficiency, j. biol. chem. ( ) – . [ ] r.i. kelley, d. robinson, e.g. puffenberger, k.a. strauss, d.h. morton, amish lethal microcephaly: a new metabolic disorder with severe congenital microcephaly and -ketoglutaric aciduria, am. j. med. genet. ( ) – . [ ] m.j. rosenberg, r. agarwala, g. bouffard, j. davis, g. fiermonte, m.s. hilliard, t. koch, l.m. kalikin, i. makalowska, d.h. morton, e.m. petty, j.l. weber, f. palmieri, r.i. kelley, a.a. schäffer, l.g. biesecker, mutant deoxynucleotide carrier is associated with congenital microcephaly, nat. genet. ( ) – . [ ] v. dolce, f. fiermonte, m.j. runswick, f. palmieri, j.e. walker, the human mitochondrial deoxynucleotide carrier and its role in toxicity of nucleoside antivirals, proc. natl. acad. sci. u. s. a. ( ) – . [ ] m.j. lindhurst, g. fiermonte, s. song, e. struys, f. de leonardis, p.l. schwartzberg, a. chen, a. castegna, n. verhoeven, c.k. mathews, f. palmieri, l.g. biesecker, knockout of slc a causes mitochondrial thiamine pyrophosphate depletion, embryonic lethality, cns malformations, and anemia, proc. natl. acad. sci. u. s. a. ( ) – . [ ] v. iacobazzi, m. ventura, g. fiermonte, g. prezioso, m. rocchi, f. palmieri, geno- mic organization and mapping of the gene (slc a ) encoding the human mitochondrial deoxynucleotide carrier (dnc), cytogenet. cell genet. ( ) – . [ ] f. molinari, a. raas-rothschild, m. rio, g. fiermonte, f. encha-razavi, l. palmieri, f. palmieri, z. ben-neriah, n. khadom, m. vekemans, t. attié-bitach, a. munnich, p. rustin, l. colleaux, impaired mitochondrial glutamate transport in autosomal recessive neonatal myoclonic epilepsy, am. j. hum. genet. ( ) – . [ ] g. fiermonte, l. palmieri, s. todisco, g. agrimi, f. palmieri, j.e. walker, identification of the mitochondrial glutamate transporter. bacterial expression, reconstitution, functional characterization, and tissue distribution of two human isoforms, j. biol. chem. ( ) – . [ ] d.a. berkich, m.s. ola, j. cole, a.j. sweatt, s.m. hutson, k.f. lanoue, mitochondrial transport proteins of the brain, j. neurosci. res. ( ) – . [ ] m. ramos, a. del arco, b. pardo, a. martínez-serrano, j.r. martínez-morales, k. kobayashi, t. yasuda, e. bogónez, p. bovolenta, t. saheki, j. satrústegui, developmental changes in the ca +-regulated mitochondrial aspartate-glutamate carrier aralar in brain and prominent expression in the spinal cord, brain res. dev. brain res. ( ) – . f. palmieri / biochimica et biophysica acta ( ) – wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ [pdf] cerebral haemodynamics in patients with glutaryl-coenzyme a dehydrogenase deficiency. | semantic scholar skip to search formskip to main content> semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. doi: . /brain/awp corpus id: cerebral haemodynamics in patients with glutaryl-coenzyme a dehydrogenase deficiency. @article{strauss cerebralhi, title={cerebral haemodynamics in patients with glutaryl-coenzyme a dehydrogenase deficiency.}, author={k. strauss and p. donnelly and m. wintermark}, journal={brain : a journal of neurology}, year={ }, volume={ pt }, pages={ - } } k. strauss, p. donnelly, m. wintermark published medicine brain : a journal of neurology in glutaric aciduria type , glutaryl-coenzyme a and its derivatives are produced from intracerebral lysine and entrapped at high concentrations within the brain, where they interfere with energy metabolism. biochemical toxicity is thought to trigger stroke-like striatal degeneration in susceptible children under years of age. here, we explore vascular derangements that might also contribute to brain damage. we studied injured and non-injured amish glutaric aciduria type patients using… expand view on pubmed academic.oup.com save to library create alert cite launch research feed share this paper citationshighly influential citations background citations results citations view all figures, tables, and topics from this paper table figure figure figure figure figure figure figure figure figure figure figure view all figures & tables coenzymes necrosis adverse reaction to drug glutaric aciduria, type cerebral blood volume retinal hemorrhage cerebrovascular circulation brain injuries coenzyme a x-ray computed tomography ultrasonography glutaryl-coa dehydrogenase cerebrovascular accident structure of middle cerebral artery white matter structure of basilar artery gray matter homeostasis blood capillaries structure of cerebral artery gastritis, atrophic edema lysine infant, newborn acetylsalicylic acid lysinate citations citation type citation type all types cites results cites methods cites background has pdf publication type author more filters more filters filters sort by relevance sort by most influenced papers sort by citation count sort by recency impairment of astrocytic glutaminolysis in glutaric aciduria type i shoko komatsuzaki, raga deepthi ediga, j. okun, s. kölker, s. sauer chemistry, medicine journal of inherited metabolic disease view excerpts, cites background save alert research feed glutaric aciduria type i: a translational approach to an enigmatic disease s. boy, silvana opp, j. heringer, j. okun, s. sauer, s. kölker medicine view excerpt, cites background save alert research feed disruption of brain redox homeostasis in glutaryl-coa dehydrogenase deficient mice treated with high dietary lysine supplementation. b. seminotti, a. u. amaral, + authors m. wajner biology, medicine molecular genetics and metabolism save alert research feed arachnoid cysts in glutaric aciduria type i (ga-i) n. boy, s. kölker biology save alert research feed mechanism of metabolic stroke and spontaneous cerebral hemorrhage in glutaric aciduria type i w. zinnanti, j. lazovic, + authors l. steinman medicine acta neuropathologica communications view excerpts, cites results and background save alert research feed mouse model of encephalopathy and novel treatment strategies with substrate competition in glutaric aciduria type i. w. zinnanti, j. lazovic biology, medicine molecular genetics and metabolism view excerpt, cites background save alert research feed unravelling the complex mri pattern in glutaric aciduria type i using statistical models—a cohort study in patients s. garbade, c. greenberg, + authors s. kölker medicine journal of inherited metabolic disease view excerpts, cites background save alert research feed glutaric acidemia type : treatment and outcome of patients over three decades. k. strauss, katie b williams, + authors d. morton medicine molecular genetics and metabolism view excerpts, cites background save alert research feed electroencephalography and transcranial doppler ultrasonography in neonatal citrullinemia. p. su, j. chen, y. chen, dau-ming niu, ju-hui hsu, inn-chi lee medicine journal of the formosan medical association = taiwan yi zhi save alert research feed current concepts in organic acidurias: understanding intra- and extracerebral disease manifestation s. kölker, p. burgard, s. sauer, j. okun biology, medicine journal of inherited metabolic disease view excerpts, cites background save alert research feed ... ... references showing - of references sort byrelevance most influenced papers recency multimodal imaging of striatal degeneration in amish patients with glutaryl-coa dehydrogenase deficiency. k. strauss, j. lazovic, m. wintermark, d. morton medicine brain : a journal of neurology pdf view excerpts, references background and methods save alert research feed excitotoxicity and bioenergetics in glutaryl-coa dehydrogenase deficiency s. kölker, d. koeller, + authors j. okun biology, medicine journal of inherited metabolic disease view excerpts, references background save alert research feed dynamic changes of striatal and extrastriatal abnormalities in glutaric aciduria type i. i. harting, e. neumaier-probst, + authors s. kölker psychology, medicine brain : a journal of neurology pdf view excerpts, references background save alert research feed mechanism of age-dependent susceptibility and novel treatment strategy in glutaric acidemia type i. w. zinnanti, j. lazovic, + authors k. cheng medicine, biology the journal of clinical investigation highly influential pdf view excerpts, references background save alert research feed glutaryl-coa dehydrogenase deficiency: region-specific analysis of organic acids and acylcarnitines in post mortem brain predicts vulnerability of the putamen. s. kölker, g. hoffmann, + authors r. chalmers biology, medicine neuropediatrics view excerpts, references background save alert research feed vascular dysfunction as an additional pathomechanism in glutaric aciduria type i c. mühlhausen, s. ergün, + authors t. braulke medicine journal of inherited metabolic disease view excerpts, references background save alert research feed type i glutaric aciduria, part : a model of acute striatal necrosis k. strauss, d. morton medicine american journal of medical genetics. part c, seminars in medical genetics view excerpt, references background save alert research feed bioenergetics in glutaryl-coenzyme a dehydrogenase deficiency s. sauer, j. okun, + authors s. kölker biology, medicine journal of biological chemistry pdf view excerpts, references background save alert research feed transport and distribution of -hydroxyglutaric acid before and during induced encephalopathic crises in a mouse model of glutaric aciduria type . b. keyser, m. glatzel, + authors c. mühlhausen biology, medicine biochimica et biophysica acta pdf view excerpts, references background save alert research feed a diet-induced mouse model for glutaric aciduria type i. w. zinnanti, j. lazovic, + authors k. cheng biology, medicine brain : a journal of neurology highly influential pdf view excerpts, references background save alert research feed ... ... related papers abstract figures, tables, and topics citations references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue hindawi publishing corporation case reports in dentistry volume , article id , pages http://dx.doi.org/ . / / case report modified bluegrass appliance: a nonpunitive therapy for thumb sucking in pediatric patients—a case report with review of the literature amish diwanji, preet jain, jigar doshi, prakash somani, and dhaval mehta department of pedodontics and preventive dentistry, faculty of dental science, nadiad, gujarat, india department of prosthodontics, pacific dental college, udaipur, india department of orthodontics and dentofacial orthopedics, darshan dental college, udaipur, india department of oral medicine and radiology, karnavati school of dentistry, gandhinagar, gujarat, india correspondence should be addressed to amish diwanji; amishdiwanji@yahoo.co.in received march ; accepted may academic editors: p. g. arduino and d. ram copyright © amish diwanji et al. this is an open access article distributed under the creative commons attribution license, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. oral habits in form of digit/thumb sucking are common phenomenon and part of childhood behavior. they are normally associated with oral pleasure, hunger, anxiety, and sometimes psychological disturbances. chronic practice can cause major orthopedic alterations to the skeletal structures of the oral cavity and lower face. aversive approaches in form of punitive therapy have been moderately effective. modified bluegrass appliance is nonpunitive therapy to treat sucking habits. it acts as a habit reversal technique and installs positive reinforcement in children. modified blue grass appliance proved to be very comfortable to patients and encourages neuromuscular stimulations. . introduction oral habit is a part of normal development in children. habits are learned patterns of muscle contraction with complex nature. oral habits are repetitive act seen commonly from infancy and should finish automatically as age advances. common repetitive behavior seen in infants is hand or figure sucking [ ]. sucking is one of the most common reflexes seen in infants. it manifests when they are in womb around wk of age [ ]. this is the first pattern of behavior observed in infant. infants and young children may use finger, thumb, pacifiers, or other objects to feel secure and learn the outside world. this is commonly seen when the child is anxious, insecure or surrounded by strangers and in families when they are separated from their parents. sucking habit induces sleep and hence makes infant and child calm and relaxed [ ]. hand sucking is naturally developed in % of infants in the second month and increases by first year of life [ ]. it is normal up to – years of age. it becomes a concern when continued for longer time and even seen in mixed dentition phase. this is the first sign for child to manifest future malocclusion or discrepancy during mixed dentition. the prevalence of oral habit has been reported up to % and % in high school girls and boys, respectively [ ]. % of prevalence has been reported in other literature [ ]. it has been documented that parental education, child’s nutrition, and sucking habits are associated with each other [ ]. however, higher prevalence rate has been claimed with high stress level among children in recent time [ ]. when child performs sucking habit in the first year of life, parents can move away his/her thumb smoothly and attract the child to other things. after second year of age, sucking habit should start decreasing and should appear only when child goes to sleep [ ]. when it continues in mixed and permanent dentition, it becomes a parental concern, as it is believed to affect growth of maxilla palate leading to skeletal changes, showing side effects on developing occlusion and resulting in malocclusion and constriction of skeletal structures [ , ]. the effect of prolonged sucking habit in children can affect development of occlusion. it may result in anterior open bite, increased over jet, lingual inclination of lower http://dx.doi.org/ . / / case reports in dentistry incisor and labial inclination of maxillary anterior, posterior crossbite, deep palate, compensatory tongue thrust, and sometimes speech defect [ , ]. the changes in dentition depend upon duration and frequency of habit being per- formed. during active eruption phase of permanent teeth, children who perform sucking habit for longer duration (more than hrs in a day), especially during sleep, tend to develop minor skeletal abnormalities and sever dentoalveolar changes [ ]. historically, correction of habit revolves around direct counseling of child, encouragement to improve self- confidence by rewarding the child, appliance therapy, and, in case of more complex dental changes, orthodontic therapy along with habit breaking appliances [ ]. the use of pacifier may cause severe and harmful effects on dentition if used for more than -year-old child [ ]. tongue, cribs, hay rakes and other sharp points employ an aversive negative stimulus to cease the undesirable oral habits. they are moderately effective and may trigger unexpected behavior sometimes. in , haskell and mink introduced blue grass appliance, also known as habit correction roller which gained universal attention and acceptance [ ]. it is userfriendly, nondestructive, easy to wear appliance replacing the common destructive habits. it is useful in avoiding traditional physical barriers of appliance in form of cribs and helping child with positive reinforcement. later, similar appliance called lingual pearl was used as a habit breaking and for multiple clinical applications [ ]. further, baker modified blue grass appliance with multiple rollers/beads and thus expanding its use from primary to permanent dentition [ ]. . management management of sucking habit depends upon the age. many questions arise in parents’ mind and among pediatricians regarding intervention by specific therapy to break the habit. counseling by pediatric dentist and pediatrician is important. if habit is stopped by - years of age, however, when they persists during eruption of permanent teeth child should be motivated to stop the habit [ , ]. appliance therapy involves use of either fixed or remov- able design in form of palatal crib or spurs. it is reminder therapy for child to make the habit unpleasant and difficult to practice. however, it causes difficulty in speech and eating and can cause iatrogenically inflicted wound and make child emotionally disturbed [ , ]. here, we present a case of thumb sucking habit where habit was corrected using bluegrass appliance as a non punitive therapy. . . case report. we present a case of an -year-old child, gir,l whose parents reported proclination of maxillary teeth and also complained of thumb sucking habit since birth. the patient used to suck her thumb regularly, - hrs/day, uncon- sciously in sleep or when idle from the primary dentition period. callous formation was seen over her digits (figure ). the patient reported with proclination of teeth, increased overjet and overbite with high palatal vault (figures (a) and (b)). management was started by counseling the parent figure : callous formation was seen over digits of patient. and the child regarding the ill effects of digit sucking on the developing dentition during the first visit. on the second visit, the patient was willing to discontinue the habit by treatment. a modified blue grass appliance was planned. molar bands were fabricated and adapted on maxillary molars. alginate impression was taken and casts were poured with dental stone over which molar bands were transferred. stainless steel wire ( . mm) was adapted over the palate extending from either side of molars. acrylic beads were made in laboratory using dental monomer and polymer. later, beads were inserted into stainless steel wire over palatal rugae area. no contact was established by beads with palatal tissues. the wire was soldered to molar bands by protecting the beads. the appliance was cemented using luting cement (figure ). the patient was instructed to roll the bead with tongue whenever she feels like sucking her thumb. the patient was kept on followup every month for checkup. the child was comfortable with the appliance and played by rolling the beads with the tongue. by end of months, callous formation had almost disappeared. patient was asked to wear appliance for almost months after correction to avoid relapse of the habit. appliance was removed after the discontinuation of habit. . discussion digit sucking is common phenomenon in pediatric age group that reflects the earliest form of habitual manipulation of body. many questions arise in the minds of general dentist, pediatricians, pediatric dentists and psychiatrists regarding impact of sucking habits on developing dentition. when should an attempt be made to break the habit? how does it disturb the child psychologically? in case of major orthopedic alterations to the skeletal structures of the oral cavity and lower face, intervention of orthodontist may require correct malocclusion. since years, habit breaking appliances in form of palatal cribs, spurs, palatal bars, hay rakes, and cage type appliances have been given to pediatric age group. however, emotional disturbances, difficulty in speech and eating, and iantrogenically self-inflicted wounds can occur with such appliances. hay rake and cage type appliances tend to get mutilated or destroyed while eating or due to habitual sucking habit. it reminds the child as punitive case reports in dentistry (a) (b) figure : proclination of teeth and increased overjet and overbite with high palatal vault. figure : modified blue grass appliance. therapy to cease the habit [ ]. haskell and mink described that blue grass appliance which is easy to wear, and did not have problems associated with traditional palatal cribs. the design consisted of hexagonal teflon roller on a cross-palatal wire which was effective to ending the sucking habit in several days [ ]. in the present study, modified blue grass appliance was used using mm acrylic beads as per recommended by baker [ ]. it encourages neuromuscular stimulations by using multiple beads as per what was the principles of castillo-morales [ ]. between – -year-old children can be instructed to play with the beads with the tongue immediately after placement. this allows the child to accept the appliance and learn the neuromuscular activity to normalize the tongue position. when a spinning roller is placed in close proximity to the tip of the tongue, “fascinating” response is quickly implemented due to neuromuscular and sensitive nature of tongue. since teflon rollers are not in contact with palatal tissues, children can roll them with their tongues. within few days, the tongue establishes new nonharmful habit of playing with roller. hence, this appliance works through counter conditioning response to the original conditioned stimulus for thumb sucking. psychologically, it is acceptable for parents also as they can encourage the child to play with beads instead of instructing the child to cease the habit all the time and thus making him/her anxious. reduced bulk of bead does not obstruct while eating, presents minimum disturbances with speech, and stimulates tongue movement. it is esthetic and child becomes comfortable quickly. the patient believes to have acquired a new toy in mouth to play with tongue. on the other side, direct relationship between age and time of appliance placement has been observed. the younger the patients are, the more quickly and completely the tongue position becomes normalized and the lesser the time required for cessation of the habit is. limbrock et al. [ ] suggested the appliance design even for toddler group to year old child. cessation of habit was reported on very st day in toddlers, whereas it takes few weeks in case of – -year-old children. hence, in early mixed detention or even in younger group, appliance could be used comfortably. if habit persists for longer time exhibiting posterior cross bite, modified blue grass appliance can be given with quad helix [ ] to expand arch. hence, two stage treatments can be completed with single appliance with correction of habit. . conclusion hence, modified blue grass appliance is a non punitive appliance and esthetic and child can wear it comfortably. it can be given as a supportive therapy as it requires no reminding or bribing, and parents can be freed of anxiety and frustration. it does not interfere with child’s growth and eliminates the habit with limited complications. references [ ] j. a. maguire, “the evaluation and treatment of pediatric oral habits,” dental clinics of north america, vol. , no. , pp. – , . [ ] l. davidson, “thumb and finger sucking,” pediatrics in review, vol. , no. , pp. – , . [ ] jada, vol. : , . [ ] s. yassaei, m. rafieian, and r. ghafari, “abnormal oral habits in the children of war veterans,” journal of clinical pediatric dentistry, vol. , no. , pp. – , . [ ] r. quashie-williams, o. o. dacosta, and m. c. isiekwe, “the prevalence of oral habits among to yr old school children in lagos,” journal of health and biomedical sciences, vol. , no. , pp. – , . case reports in dentistry [ ] n. m. a. farsi, “sucking habits in saudi children: prevalence, contributing factors and effects on the primary dentition,” pediatric dentistry, vol. , no. , pp. – , . [ ] n. shahraki, s. yassaei, and m. goldani, “abnormal oral habits: a review,” journal of dentistry and oral hygiene, vol. , no. , pp. – , . [ ] t. m. graber, “thumb- and finger-sucking,” american journal of orthodontics, vol. , no. , pp. – , . [ ] a. t. ruttle, w. quigley, j. t. crouch, and g. e. ewan, “a serial study of the effects of finger-sucking,” journal of dental research, vol. , no. , pp. – , . [ ] e. n. gale and w. a. ager, “thumb sucking revisited,” american journal of orthodontics, vol. , no. , pp. – , . [ ] t. a. yemitan, o. o. dacosta, o. o. sanu, and m. c. isiekwe, “effects of digit sucking on dental arch dimensions in the primary dentition,” african journal of medicine and medical sciences, vol. , no. , pp. – , . [ ] m. b. moore and j. p. mcdonald, “a cephalometric evaluation of patients presenting with persistent digit sucking habits,” british journal of orthodontics, vol. , no. , pp. – , . [ ] j. poyak, “effects of pacifiers on early oral development,” international journal of orthodontics, vol. , no. , pp. – , . [ ] b. s. haskell and j. r. mink, “an aid to stop thumb sucking: the “bluegrass” appliance,” pediatric dentistry, vol. , no. , pp. – , . [ ] a. k. ritto and p. leitão, “the lingual pearl,” journal of clinical orthodontics, vol. , no. , pp. – , . [ ] c. baker, “the modified blue grass appliance,” journal of clinical orthodontics, vol. , no. , pp. – , . [ ] j. j. warren, s. e. bishara, k. l. steinbock, t. yonezu, and a. j. nowak, “effects of oral habits’ duration on dental characteristics in the primary dentition,” journal of the american dental association, vol. , no. , pp. – , . [ ] j. j. warren and s. e. bishara, “duration of nutritive and nonnu- tritive sucking behaviors and their effects on the dental arches in the primary dentition,” american journal of orthodontics and dentofacial orthopedics, vol. , no. , pp. – , . [ ] m. massler and a. w. wood, “thumb-sucking,” journal of dentistry for children, vol. , no. , pp. – , . [ ] g. j. limbrock, h. hoyer, and h. scheying, “regulation therapy by castillo-morales in children with down syndrome: primary and secondary orofacial pathology,” asdc journal of dentistry for children, vol. , no. , pp. – , . [ ] b. s. haskell, “construction of a habit correction roller with arch expansion: chair side application of a new piece bondable “bluegrass” appliance,” journal of southeastern society of pedi- atric dentistry, vol. , no. , pp. – , . variants in scavenger receptor class b type i gene are associated with hdl cholesterol levels in younger women fax + e-mail karger@karger.ch www.karger.com original paper hum hered ; : – doi: . / variants in scavenger receptor class b type i gene are associated with hdl cholesterol levels in younger women caroline g.p. roberts a haiqing shen b braxton d. mitchell b coleen m. damcott b alan r. shuldiner b, c annabelle rodriguez a a department of medicine, the johns hopkins university school of medicine; b department of medicine, the university of maryland school of medicine, and c department of veterans affairs and veterans affairs medical center baltimore geriatric research, education and clinical center (grecc), baltimore, md. , usa sense mutation (ile val), which may be functional. more- over, rs (p = . ) and rs (p = . ) were sig- nificantly associated with higher hdl-c levels in women younger than years but not in women aged years or older ( p for interaction between age and rs = . ). none of the snp effects on hdl-c were modified in the pres- ence of diabetes, in either men or women. conclusions: scarb snps influence hdl-c levels in women, particularly in those less than years old. condensed abstract: we as- sessed associations between scarb snps and lipid traits in amish men and women. two snps, rs and rs , were significantly associated with higher hdl-c levels in women younger than years but not in women aged years or older, supporting an interaction between common sequence variants in scarb and estrogen on hdl-c. copyright © s. karger ag, basel the metabolism of high-density lipoprotein (hdl) is complex, with many factors inf luencing its circulating plasma levels. one such factor is the scavenger receptor, class b, type i (sr-bi), first characterized by acton et al. [ ] , and subsequently shown to be a physiologically rele- vant receptor that exerts a major inf luence on hdl cho- key words atherosclerosis � autosomal snps � snp abstract objective: variants within the scavenger receptor class b type i ( scarb ) receptor gene have been previously associ- ated with lipid levels, especially in women, with some stud- ies reporting the association to be stronger in the presence of diabetes or post-menopausal estrogen use. based on the reported gender-specific association and modification ef- fect of estrogen on lipid levels according to scarb variants, we explored the relationship between scarbi single nucleo- tide polymorphisms (snps) and lipid levels in an amish pop- ulation to assess sex and age differences. methods: eight scarb snps, identified from public databases, were geno- typed in subjects. results: rs and rs were in high linkage disequilibrium (ld), with r > . . none of the snps were significantly associated with lipid levels in men; however in women, rs (p = . ) and rs (p ! . ) were significantly associated with higher hdl-c levels. rs had an allele frequency of % and predicts a mis- received: october , accepted after revision: january , published online: may , dr. annabelle rodriguez the johns hopkins bayview medical center, division of endocrinology mason f. lord building, center tower, room , eastern avenue baltimore, md (usa) tel. + , fax + , e-mail arodrig @jhmi.edu © s. karger ag, basel – / / – $ . / accessible online at: www.karger.com/hhe c.g.p. roberts and h. shen are co-first authors. http://dx.doi.org/ . % f roberts /shen /mitchell /damcott / shuldiner /rodriguez hum hered ; : – lesterol (hdl-c) levels in rodents [ ] . it is highly ex- pressed in the liver and in steroidogenic tissues [ , ] , where its primary function is to mediate the uptake of cholesteryl esters from the hdl particle core. much less is known regarding the role of sr-bi in humans, although recent studies have shown some vari- ants in the sr-bi gene ( scarb ) to be associated with lipid levels, lipoprotein particle size and body mass in- dex (bmi) [ – ] . scarb variants have also been stud- ied in populations characterized with type diabetes mellitus (t dm) [ , ] and, interestingly, a scarb variant in exon was found to associate with differenc- es in insulin sensitivity in healthy people during the consumption of an olive oil-rich diet [ ] . in addition, a scarb variant was studied in older women using hor- mone replacement therapy [ ] . osgood et al. [ ] exam- ined scarb gene variants in the participants of the framingham study, and reported that three common single nucleotide polymorphisms (snps) rs (exon , + g ] a), rs (exon , + c ] t) and an intron (+ c ] t) snp were associated with variation in plasma lipoprotein concentrations and par- ticle size, particularly in subjects with t dm. while there was no association of snps with t dm, the g al- lele in rs was significantly associated with low- er hdl-c levels and smaller hdl particle sizes, al- though only among subjects with t dm. no interaction was observed for the rs snp with t dm, whereas the interaction between the intron snp and t dm on hdl metabolism was seen only in men. gender-specific associations have been reported be- tween some of the scarb variants and lipid levels, an observation that led richard et al. [ ] to examine the effect of exogenous estrogen on hdl-c levels by scarb variants in elderly women in the rancho bernardo study. these investigators found no significant associa- tions between either the intron snp or rs and hdl-c levels after adjusting for age, bmi, alcohol, smoking, triglycerides, fasting plasma glucose and es- trogen use. however, they did report significant estro- gen interaction with the rs snp on hdl-c levels, with hdl-c levels significantly higher in estrogen users than non-users [ ] . motivated by these previous observations, we assessed the relationship of eight different scarb variants, in- cluding the previously studied rs , intron (+ c ] t), and rs variants, with lipid levels in adult men and women participants of the amish family diabetes study (afds) and to determine if associations were mod- ified by the effects of age, gender and/or t dm. methods study population the old order amish (ooa) is a genetically homogenous population of central european ancestry. the original founders of this population immigrated to eastern pennsylvania (now lancaster county, pa., usa) in the mid to late s, with the lancaster county population now consisting of approximately , individuals [ ] . the ooa today are still characterized by their social cohesiveness and rural lifestyle [ ] . in , afds was begun to identify susceptibility genes for t dm and related traits. probands with t dm onset between and years of age were identified and all willing first-degree family members years of age and older were invited to participate. first-degree relatives of any family members subsequently diagnosed with t dm were also invited to participate. a total of subjects with lipid data and dna available for genotyping were included in this study. participating subjects were examined at the amish research clinic in strasburg, pa following a -hour overnight fast. height and weight were measured and body mass index (bmi) was calculated as the weight in kilograms divided by the height in meters squared (kg/m ). fasting lipid profiles [total choles- terol (tc), hdl-c, triglycerides (tg)] were performed by quest diagnostics (baltimore, md). intra-assays cvs of duplicate samples ranged between . and . %, and inter-assay cvs ranged between . and %. low-density lipoprotein cholester- ol (ldl-c) concentrations were estimated using friedewald’s formula [ ] . a g oral glucose tolerance test (ogtt) was administered, and diabetes mellitus was classified based on the american dia- betes association plasma glucose criteria [ ] of a fasting plasma glucose level ( mmol/l) or a -hour ogtt plasma glucose lev- el ( . mmol/l). subjects were also considered to have diabetes if they reported current use of insulin or oral glucose-lowering agents. subjects were excluded from these analyses if they had a diagnosis of diabetes before the age of years and reported cur- rent use of insulin (n = ). impaired glucose tolerance was diag- nosed based on ogtt plasma glucose levels ( -hour ogtt plas- ma glucose level . but ! . mmol/l). normal glucose toler- ance was defined as fasting plasma glucose level ( ! . mmol/l) and -hour ogtt plasma glucose level ( ! . mmol/l). informed consent was obtained from all afds participants, and the study protocol was approved by the institutional review board at the university of maryland school of medicine. details of the study design have been previously described [ ] . genotyping the scarb gene is . kb in length and consists of exons. we selected snps for genotyping within the coding and intronic regions of scarb from public databases (nih dbsnp, wellcome trust sanger institute and applied biosystems) that were vali- dated by frequency (minor allele frequency %) as well as snps reported in published articles [ – , ] . snps were genotyped us- ing the snpstream uht genotyping system (beckman coulter, fullerton, ca) [ ] . eight of the eighteen snps genotyped were polymorphic in this sample: rs , rs , rs , rs , rs , rs , rs , rs and the intron (+ c ] t) snp. error rates based upon blind replicates were – . %. scarbi snps and hdl-c levels in young women hum hered ; : – statistical analysis genotypes were checked for mendelian consistency using the pedcheck software program in the extended amish pedigree [ ] . a small number of mendelian errors were resolved or re- moved prior to analysis. the distribution of all snp genotypes conformed to those expected under hardy-weinberg equilibrium using the � test. association analyses were performed using a variance com- ponents methodology implemented in the sequential oligogenic linkage analysis routines (solar) software program, which allowed us to account for the relatedness of study subjects [ ] . brief ly, we evaluated the effects of snp genotype on hdl levels, while simultaneously adjusting for the effects of age, age , sex, bmi, and diabetes status. we accounted for the non-indepen- dence among family members by modeling the residual correla- tions in hdl levels between relative pairs explicitly as a function of the kinship matrix. our primary analysis was based on an ad- ditive genetic model, which implies a dose-response relationship between number of ‘risk’ alleles and hdl level. genotypes were thus assigned values of , , or , corresponding to the number of risk alleles. subjects currently taking lipid-lowering medica- tions (n = ) were excluded from the analysis. the significance of the genotype effects was assessed using the likelihood ratio test, in which we compared the likelihood of the data under a model in which the genotype effect was estimated against the likelihood of a nested model in which the genotype effect was constrained to zero. based upon our a priori hypothesis regarding an interaction between scarb genotype and age or sex, genotype-phenotype associations were estimated in men and women (and older and younger women) separately. interaction terms (e.g., genotype by sex, genotype by diabetes status, and genotype by age) were in- cluded in the model to assess whether the magnitude of the geno- type effect on hdl levels differed by group. given negligible ld between snps (except rs and rs ), haplotypes could not be reliably assigned, and thus haplotype association analysis was not performed. results the study subjects included t dm and non-t dm individuals from families, ranging in size from to . the characteristics of the study cohort are summarized in table . overall, there were slightly more women than men ( vs. %). women had higher bmi ( . vs. . kg/m , p ! . ), higher prevalence of t dm ( . vs. . %, p ! . ), higher mean hdl-c levels ( . vs. . mg/dl, p ! . ) and lower mean ldl-c levels ( . vs. . mg/dl, p ! . ). the use of prescription medications such as lipid-lowering agents and hormone replacement therapy is low in the amish. the frequency of cigarette smoking is also low in the amish. physical activity levels in the old order amish are typically high, especially compared to non-amish caucasians. the amish diet is generally high in calories and fat. we next examined the associations between scarb snps and lipid levels stratified by sex. in these analyses, we adjusted for age, age , bmi, diabetes status, family struc- ture and excluded those using lipid-lowering medications. none of the scarb snps were associated with tc, hdl- c, ldl-c, or tg levels in men (data not shown). however, in women, rs (p = . ) and rs (p ! . ) were significantly associated with higher hdl-c levels ( fig. ). the genotype ! gender interaction was significant for rs using a dominant model ( p ! . ), whereas no significant interaction was found for rs . as the ran- cho bernardo study [ ] suggested an interaction between estrogen use and rs snp genotypes on hdl-c and because estrogen levels are related to age, we examined as- men women age-adjusted p n age . . . . . bmi, kg/m . . . . < . diabetes . % . % . impaired glucose tolerance . % . % . total cholesterol, mg/dl . . . . . ldl-c, mg/dl . . . . . hdl-c, mg/dl . . . . < . triglycerides, mg/dl . . . . . lipid-lowering medications, % . % . % . estrogen users, % na . % na oral hypoglycemic agents, % . % . % . insulin therapy, % . % . % . na = not applicable. table . characteristics (mean sd, %) of the amish family diabetes study cohort roberts /shen /mitchell /damcott / shuldiner /rodriguez hum hered ; : – sociations between scarb snps and hdl-c levels in women older and younger than age years. as shown in table , women less than years of age who carried the rs (p ! . ) or rs (p ! . ) minor allele had significantly higher hdl-c levels compared with women homozygous for the major allele (hdl-c levels ap- proximately and % higher, respectively). in women greater than years of age, these two snps were not as- sociated with hdl-c levels. the genotype ! age group interaction term was statistically significant for rs genotypes (p = . ). by contrast, rs , which encodes a missense mutation (ile val), was associated with hdl- . kb rs rs rs intron rs rs rs rs rs rs rs in t r o n rs rs rs rs . . . . . r^ . . . . . d fig. . gene structure and pairwise ld among snps in scarb . the upper por- tion of the figure shows the gene structure and location of polymorphisms. the lower portion of the figure shows a schematic pairwise ld, calculated as d � and r among the polymorphic snps in the amish. the lines connect each snp name and the posi- tion with the corresponding cell in the ld matrix. magnitude and significance of the d � and r is illustrated by shading with a red to white or a blue to white gradient re- f lecting higher to lower ld values. table . mean hdl-c levels (se) according to scarb snp genotype in women ≥ and < years of age snp name maf women ≥ years (n = ): genotype women < years (n = ): genotype p* p* rs (c/t) . . ( . ) . ( . ) . ( . ) . . ( . ) . ( . ) . ( . ) . rs (g/a) . . ( . ) . ( . ) . ( . ) . . ( . ) . ( . ) . rs (c/t) . . ( . ) . ( . ) . . ( . ) . ( . ) . rs (g/a) . . ( . ) . ( . ) . ( . ) . . ( . ) . ( . ) . intron (t/c) . . ( . ) . ( . ) . . ( . ) . ( . ) . rs (a/g) . . ( . ) . ( . ) . ( . ) . . ( . ) . ( . ) . ( . ) . rs (c/t) . . ( . ) . ( . ) . ( . ) . . ( . ) . ( . ) . ( . ) . rs (t/c) . . ( . ) . ( . ) . ( . ) . . ( . ) . ( . ) . ( . ) . * p is for additive genetic model, adjusted for age, bmi, family structure, diabetes, and excluded lipid medications. significant p values are printed in bold. scarbi snps and hdl-c levels in young women hum hered ; : – c levels in women from both age groups, although this snp was uncommon ( %) in this population. none of the snps were associated with diabetes, in either men or wom- en, nor were the effects of any snp on hdl-c levels mod- ified in the presence of diabetes. excluding subjects with diabetes did not appreciably change the hdl-c associa- tion results (data not shown). a description of the gene structure showing snp loca- tions and pairwise ld between snps is provided as figure . rs (exon ; silent) and rs (intron ), both of which were associated with hdl-c levels in women younger than years old, are located . kb from each other and are in high ld with each other. by contrast, rs (exon ; ile val), which was also associated with hdl-c levels, is rarer and not linked to the other two hdl-c-associated snps, suggesting that its association with hdl-c levels is independent of the other two snps. this was supported by the fact that the association of rs with hdl-c levels remained statistically signifi- cant even after adjusting for the effects of the other two snps in either total women or women of each age group. the opposite analyses were done on rs or rs while adjusting for rs . significant association between rs or rs and hdl-c remained in total women and women younger than years old (data not shown). because of the relative absence of ld between all pairs of snps (r ̂ . ), with the exception of snps rs and rs , which were in very high ld (r = . ), no hap- lotype association analyses were performed. discussion we have observed several scarb polymorphisms to be associated with hdl-c levels in amish women, but not in men. furthermore, the associations were stronger in younger as compared to older women. because amish women, at least in lancaster county, rarely take estrogen ( . % in our cohort), the stratification of women accord- ing to those younger and older than age years is a proxy for examining the interaction of estrogen on lipid levels according to scarb genotype. our results are consis- tent with richard et al. [ ] in that hdl-c levels were significantly higher in amish women younger than years of age (presumably pre-menopausal and having ad- equate endogenous estrogen levels) who carried the rs variant, suggesting an important interaction be- tween estrogen and sr-bi. in addition, we found signifi- cantly higher hdl-c in younger female carriers of the minor allele of rs . however, unlike the rancho bernardo population, we did not find a difference in ldl-c levels in the old order amish women according to age and scarb genotype. osgood et al. [ ] did not show a sex difference between lipid levels and the rs snp. after multivariate adjust- ments, they showed that men homozygous for the minor allele had significantly higher total hdl-c, higher hdl -c levels and larger hdl particle size compared with men homozygous for the major allele. however, in women, while there were no apparent differences in hdl-c levels between minor allele homozygotes and major allele homozygotes, ldl-c levels were lower and hdl particle size was larger in the minor allele homozy- gotes [ ] . acton et al. [ ] also did not find significant as- h d l -c (m g /d l) gg ga aa p = n.s. rs gg ga aa p < . h d l -c (m g /d l) cc ct tt p = n.s. rs cc ct tt p = . men women fig. . adjusted hdl-c levels in men and women according to rs and rs genotype. mean hdl-c levels for men and women according to rs and rs genotype are shown. the p value for women is statistically significant for trend while the p value for men is not significant. there is a significant gene ! gen- der interaction for rs (p ! . ). roberts /shen /mitchell /damcott / shuldiner /rodriguez hum hered ; : – sociations between lipid levels and the rs snp in men in a population sampled from zaragoza, spain. while they also did not find significant associations between hdl-c levels and rs variant in women, they report- ed that women carrying the minor allele had significant- ly lower ldl-c levels compared to women homozygous for the major allele. other groups examining the rs snp have also reported association of this snp with lipid levels [ , ] . thus, our findings, coupled with reports in the literature, provide evidence for replicated association of rs with lipid levels, although there appear to be inconsistencies with respect to which lipid traits. in our population we did not find associations be- tween scarb snps and triglycerides (p ranges . – . ). only one scarb snp was significantly associated with bmi (rs , p = . ). relationships between bmi, triglycerides, and scarb snps have been found in a spanish population [ ] , and relationships between tri- glycerides and the scarb intron snp have been de- scribed in an obese population undergoing gastric bypass surgery [ ] . these differences may be due to the differ- ent populations studied. the relationship between scarb and estrogen may have biological relevance given that in animals estrogen regulates the expression of sr-bi and its isoform sr-bii [ , ] , and that estrogen response elements are found within the scarb promoter [ , ] . in humans, we have shown that women undergoing oocyte retrieval for in vitro fertilization who have low estradiol levels are also low expressors of sr-bi mrna [ ] . it is possible that rs or rs may be in linkage disequilibrium with a functional variant in estrogen response element in scarb such that carriers of variant alleles for scarb may have altered expression of sr-bi that becomes appar- ent only in the setting of estrogen. interestingly, rs , which encodes a missense mutation (ile val), is associ- ated with hdl-c levels in both age groups. although rare, it is possible that the effect of this potentially func- tional variant is strong enough to be independent of es- trogen status. the limitations of our study merit further discussion. the ooa are a closed founder population with relatively homogeneous environmental factors and fewer con- founders of disease and related phenotypes (e.g., low rates of smoking, alcohol consumption, and medication usage) [ ] . although this homogenous lifestyle might enhance our ability to discern genetic inf luences on disease and related traits, the ability to generalize our findings will require further study in the general population. in addi- tion, the high fat diet of the ooa (approximately % saturated fat (shuldiner, in preparation)) may also con- tribute to an interaction between diet, genotype and lipid levels. perez-martinez explored the effect of dietary fat content (saturated fat diet, carbohydrate-rich diet and a monounsatured olive oil diet) on lipid levels in subjects stratified by the scarb exon snp genotype. subjects consuming a saturated fat diet and expressing the minor allele in exon had significantly higher ldl-c levels compared to subjects homozygous for the major allele [ ] . this suggests the possibility that dietary fat might also have an important interaction with other scarb variants. furthermore, spady et al. [ ] have previously shown that polyunsaturated fatty acids up-regulate sr-bi in the hamster. it should be noted that we reported nominal p values in our statistical analysis instead of p values adjusted for multiple comparisons. however, since a major motiva- tion of our study was to determine if observed associa- tions between scarb snps and hdl-c levels were in- f luenced by age and gender given prior speculations that genetic effects at this locus might be estrogen sensitive, the comparisons we considered were not wholly indepen- dent. nonetheless, we could not exclude the possibility of a false-positive association and we need to be cautious in our interpretation of the results. in summary, we have shown that some scarb vari- ants are significantly associated with hdl-c levels in participants of the afds. one of these variants encodes a relatively rare conservative missense mutation and thus may be functional. interestingly, there was a significant age or estrogen interaction with two more common non- coding scarb variants. the clinical relevance of these associations and the mechanism by which these variants inf luence hdl-c levels, especially in younger women, warrants further study. acknowledgments this work was supported by research grants r -dk , u -dk , and k -ca awarded to the university of maryland and to hl awarded to dr. annabelle rodriguez. other support was received from the university of maryland general clinical research center grant m rr ; the gen- eral clinical research centers program; the national center for research resources (ncrr); the national institutes of health; the niddk clinical nutrition research unit of maryland (nih p dk ); and the baltimore veterans administration ge- riatric research and education clinical center. we gratefully ac- knowledge our amish liaisons and fieldworkers and the extraor- dinary cooperation and support of the amish community, with- out whom these studies would not be possible. scarbi snps and hdl-c levels in young women hum hered ; : – references acton s, rigotti a, landschulz kt, xu s, hobbs hh, krieger m: identification of scavenger receptor sr-bi as a high density lipoprotein receptor. science ; : – . rigotti a, trigatti bl, penman m, rayburn h, herz j, krieger m: a targeted mutation in the murine gene encoding the high density lipoprotein (hdl) receptor scavenger recep- tor class b type i reveals its key role in hdl metabolism. proc natl acad sci usa ; : – . trigatti b, rayburn h, vinals m, braun a, miettinen h, penman m, hertz m, schren- zel m, amigo l, rigotti a, krieger m: inf lu- ence of the high density lipoprotein receptor sr-bi on reproductive and cardiovascular pathophysiology. proc natl acad sci usa ; : – . acton s, osgood d, donoghue m, corella d, pocovi m, cenarro a, mozas p, keilty j, squazzo s, woolf ea, ordovas jm: associa- tion of polymorphisms at the sr-bi gene lo- cus with plasma lipid levels and body mass index in a white population. arterioscler thromb vasc biol ; : – . mccarthy jj, lewitzky s, reeves c, permutt a, glaser b, groop lc, lehner t, meyer jm: polymorphisms of the hdl receptor gene associated with hdl cholesterol levels in di- abetic kindred from three populations. hum hered ; : – . mccarthy jj, lehner t, reeves c, moliterno dj, newby lk, rogers wj, topol ej; gene- quest investigators: association of genetic variants in the hdl receptor, sr-b , with ab- normal lipids in women with coronary ar- tery disease. j med genet ; : – . hsu la, ko yl, wu s, teng ms, peng ty, chen cf, chen cf, lee ys: association be- tween a novel -base pair deletion mutation in the promoter region of the scavenger re- ceptor class b type i gene and plasma hdl cholesterol levels in taiwanese chinese. ar- terioscler thromb vasc biol ; : – . rodriguez-esparragon f, rodriguez-perez jc, hernandez-trujillo y, macias-reyes a, medina a, caballero a, ferrario cm: allelic variants of the human scavenger receptor class b type and paraoxonase on coronary heart disease: genotype-phenotype correla- tions. arterioscler thromb vasc biol ; : – . osgood d, corella d, demissie s, cupples la, wilson pw, meigs jb, schaefer ej, col- tell o, ordovas jm: genetic variation at the scavenger receptor class b type i gene locus determines plasma lipoprotein concentra- tions and particle size and interacts with type diabetes: the framingham study. j clin endocrinol metab ; : – . perez-martinez p, perez-jimenez f, bellido c, ordovas jm, moreno ja, marin c, gomez p, delgado-lista j, fuentes f, lopez-miran- da j: a polymorphism exon variant at the locus of the scavengar receptor class b type i (scarb ) gene is associatred with differenc- es in insulin sensitivity in healthy people during the consumption of an olive oil-rich diet. j clin endocrinol metab ; : – . richard e, von muhlen d, barrett-connor e, alcaraz j, davis r, mccarthy jj: modifi- cation of the effects of estrogen therapy on hdl cholesterol levels by polymorphisms of the hdl-c receptor, sr-bi: the rancho ber- nardo study. atherosclerosis ; : – . beiler k: church directory of the lancaster county amish. gordonsville, pa, peqaea publishers. hsueh wc, mitchell bd, aburomia r, pollin t, sakul h, gelder ehm m, michelsen bk, wagner mj, st jean pl, knowler wc, burns dk, bell cj, shuldiner ar: diabetes in the old order amish: characterization and her- itability analysis of the amish family diabe- tes study. diabetes care ; : – . friedewald wt, levy ri, fredrickson ds: estimation of the concentration of low-den- sity lipoprotein cholesterol in plasma, with- out use of the preparative ultracentrifuge. clin chem ; : – . expert committee on the diagnosis and classification of diabetes mellitus: follow- up report on the diagnosis of diabetes mel- litus. diabetes care ; : – . osgood-mcweeney d, galluzzi jr, ordovas jm: allelic discrimination for single nucleo- tide polymorphisms in the human scavenger receptor class b type gene locus using f luo- rescent probes. clin chem ; : – . bell pa, chaturvedi s, gelfand ca, huang cy, kochersperger m, kopla r, modica f, pohl m, varde s, zhao r, zhao x, boyce- jacino mt, yassen a: snpstream uht: ultra-high throughput snp genotyping for pharmacogenomics and drug discovery. bio- techniques ;suppl: – , , – . o’connell jr, weeks de: pedcheck: a pro- gram for identification of genotype incom- patibilities in linkage analysis. am j hum genet ; : – . almasy l, blangero j: multipoint quantita- tive-trait linkage analysis in general pedi- grees. am j hum genet ; : – . koumanis dj, christou nv, wang xl, gil- fix bm: pilot study examining the frequency of several gene polymorphisms in a morbid- ly obese population. obes surg ; : – . landschulz kt, pathak rk, rigotti a, krie- ger m, hobbs h: regulation of scavenger re- ceptor, class b, type i, a high density lipopro- tein receptor, in liver and steroidogenic tissues of the rat. j clin invest ; : – . graf ga, roswell kl, smart ej: beta-es- tradiol promotes the up-regulation of sr-bii in hepg cells and in rat livers. j lipid res ; : – . lopez d, mclean mp: estrogen regulation of the scavenger receptor class b gene: anti- atherogenic or steroidogenic, is there a prior- ity? mol cell endocrinol ;nov , epub. lopez d, sanchez md, shea-eaton w, mclean mp: estrogen activates the high- density lipoprotein receptor gene via bind- ing to estrogen response elements and inter- action with sterol regulatory element binding protein- a. endocrinology ; : – . velasco m, alexander c, king j, zhao y, garcia j, rodriguez a: association of lower plasma estradiol levels and low expression of scavenger receptor class b, type i in infertile women. fertil steril ; : – . perez-martinez p, ordovas jm, lopez-mi- randa j, gomez p, marin c, moreno j, fuen- tes f, fernandez de la puebla ra, perez-ji- menez f: polymorphism exon variant at the locus of the scavenger receptor class b type i gene: inf luence on plasma ldl choles- terol in healthy subjects during the con- sumption of diets with different fat contents. am j clin nutr ; : – . spady dk, kearney dm, hobbs hh: poly- unsaturated fatty acids up-regulate hepatic scavenger receptor b (sr-bi) expression and hdl cholesteryl ester uptake in the hamster. j lipid res ; : – . [pdf] commentary: physical activity and weight control. | semantic scholar skip to search formskip to main content> semantic scholar's logo search sign increate free account you are currently offline. some features of the site may not work correctly. doi: . /ije/dyt corpus id: commentary: physical activity and weight control. @article{hill commentarypa, title={commentary: physical activity and weight control.}, author={j. hill and j. peters}, journal={international journal of epidemiology}, year={ }, volume={ }, pages={ - } } j. hill, j. peters published political science, medicine international journal of epidemiology references luke a, cooper rs. physical activity does not influence obesity risk: time to clarify the public health message. int j epidemiol ; doi: . /ije/dyt . ng sw, popkin bm. time use and physical activity: a shift away from movement across the globe. obes rev ; : – . dugas lr, harders r, merrill s et al. energy expenditure in adults living in developing compared with industrialized countries: a meta-analysis of doubly labeled water studies. am j clin nutr ; : … expand view on pubmed academic.oup.com save to library create alert cite launch research feed share this paper citationsbackground citations view all topics from this paper ethanol exercise tracer obesity food published comment disease response domain fast foods paper mentions blog post let’s ask marion: can exercise balance out soda drinking? food politics august citations citation type citation type all types cites results cites methods cites background has pdf publication type author more filters more filters filters sort by relevance sort by most influenced papers sort by citation count sort by recency authors' response to commentaries on 'physical activity does not influence obesity risk'. a. luke, r. cooper medicine international journal of epidemiology pdf save alert research feed obesity and energy balance: what is the role of physical activity? r. shook medicine expert review of endocrinology & metabolism save alert research feed accelerometer-measured physical activity is not associated with two-year weight change in african-origin adults from five diverse populations l. dugas, stephanie kliethermes, + authors a. luke medicine peerj pdf save alert research feed the role of physical activity and exercise in obesity and weight management: time for critical appraisal p. wiklund medicine journal of sport and health science pdf save alert research feed global, regional, and national prevalence of overweight and obesity in children and adults during – : a systematic analysis for the global burden of disease study marie ng, t. fleming, margaret m. robinson, blake thomson, e. gakidou medicine the lancet , pdf save alert research feed long-term effects of physical activity level on changes in healthy body mass index over years in young adult women. t. pavey, g. peeters, sjaan r. gomersall, w. brown psychology, medicine mayo clinic proceedings save alert research feed the retail food environment in relation to socio-economic characteristics, weight status and diabetes yavgenia jane polsky business pdf save alert research feed extremes of weight gain and weight loss with detailed assessments of energy balance: illustrative case studies and clinical recommendations r. falck, r. shook, g. hand, c. lavie, s. blair medicine postgraduate medicine view excerpt, cites background save alert research feed correlates of adherence to an adolescent weight management program: a secondary data analysis meredith walker hanson medicine view excerpt, cites background save alert research feed relaxed natural selection contributes to global obesity increase more in males than in females due to more environmental modifications in female body mass wenpeng you, m. henneberg biology, medicine plos one pdf save alert research feed ... ... references showing - of references sort byrelevance most influenced papers recency physical activity and appetite control: can we close the energy gap? j. blundell medicine highly influential view excerpts, references background save alert research feed physical activity in an old order amish community. d. bassett, p. schneider, gertrude e. huntington medicine medicine and science in sports and exercise pdf save alert research feed time use and physical activity: a shift away from movement across the globe s. w. ng, b. popkin geography, medicine obesity reviews : an official journal of the international association for the study of obesity save alert research feed energy expenditure in adults living in developing compared with industrialized countries: a meta-analysis of doubly labeled water studies. l. dugas, r. harders, + authors a. luke medicine the american journal of clinical nutrition pdf save alert research feed reduction in obesity and related comorbid conditions after diet-induced weight loss or exercise-induced weight loss in men r. ross, d. dagnone, + authors i. janssen medicine annals of internal medicine , pdf save alert research feed the global obesity pandemic: shaped by global drivers and local environments b. swinburn, gary sacks, k. hall, k. mcpherson, s. gortmaker medicine the lancet , pdf save alert research feed from instinct to intellect: the challenge of maintaining healthy weight in the modern world j. peters, h. wyatt, w. donahoo, j. hill psychology, medicine obesity reviews : an official journal of the international association for the study of obesity save alert research feed effects of mo of verified, supervised aerobic exercise on macronutrient intake in overweight men and women: the midwest exercise trial. j. donnelly, e. kirk, d. jacobsen, j. hill, d. sullivan, s. johnson medicine the american journal of clinical nutrition pdf save alert research feed covert manipulation of the ratio of dietary fat to carbohydrate and energy density: effect on food intake and energy balance in free-living men eating ad libitum. r. stubbs, p. ritz, w. a. coward, a. prentice medicine the american journal of clinical nutrition save alert research feed physical inactivity as the culprit of metabolic inflexibility: evidence from bed-rest studies. a. bergouignan, floriane rudwill, c. simon, s. blanc medicine journal of applied physiology pdf save alert research feed ... ... related papers abstract topics paper mentions citations references related papers stay connected with semantic scholar sign up about semantic scholar semantic scholar is a free, ai-powered research tool for scientific literature, based at the allen institute for ai. learn more → resources datasetssupp.aiapiopen corpus organization about usresearchpublishing partnersdata partners faqcontact proudly built by ai with the help of our collaborators blog posts, news articles and tweet counts and ids sourced by altmetric.com terms of service•privacy policy the allen institute for ai by clicking accept or continuing to use the site, you agree to the terms outlined in our privacy policy, terms of service, and dataset license accept & continue the journal of academic social science studies international journal of social science doi number:http://dx.doi.org/ . /jasss number: , p. - , autumn ii yayın süreci yayın geliş tarihi / article arrival date - yayınlanma tarihi / the published date . . . . dÎvÂnu lugÂtİ’t tÜrk’te gİyİm kuŞam kÜltÜrÜ İle İlgİlİ kelİmeler words about clothing in dÎvÂnu lugÂti’t turk yrd. doç. dr. recep tek nevşehir hacı bektaş veli Üniversitesi fen-edebiyat fakültesi türk halk bilimi bölümü Öz bireyin bedenini örten, onu dondurucu soğuktan, yakıcı güneşten, çeşitli saldırılardan vb. dış etmenlerden koruyan giyinme, insana has bir özelliktir. Örf ve âdetler, inançlar, coğrafya, yaşam biçimi, estetik anlayış gibi hususlar, folklorik bir öge olan giyim kuşamın şekillenmesinde etkili olan faktörler olarak karşımıza çıkmaktadır. bu faktörler, milletlerin kendi milli giyimlerini yaratmalarında da mühim bir rol oynamıştır. tarihî süreç içerisinde milletleri birbirinden ayıran özelliklerden biri olarak giyim kuşam, milli kültür içerisinde yer alan önemli bir maddi kültür ögesi olmuştur. giyim kuşam, insanoğlu için aynı zamanda bir göstergedir. bu gösterge, insanın sosyal durumunu, statüsünü, dünya görüşünü, değerlerini ifade edebilir; onun cinsiyeti, yaşı, inancı, mensubu olduğu topluluk, medeni hâli ve hatta o andaki ruh hâli hakkında karşısındakilere bir fikir verebilir. türklerde giyim kuşam eşyalarının ana malzemesini deve, koyun, kuzu, sığır, tilki, samur ve ayı gibi hayvanların derisi ve kürkü ile koyun, keçi ve deve yünü oluşturmaktaydı. medeniyetin gelişmesi ve uygarlığın ilerlemesi ile birlikte bunlar yerini kumaşlara ve bezlere bırakmıştır. Özellikle yerleşik hayata geçiş ile birlikte dokumacılığın yaygınlaşması, pamuk, ipek, keten ve yünlü dokuma giyim kuşam eşyalarını ön plana çıkarmıştır. dîvânu lugâti’t türk’te giyim-kuşamla ilgili tespit edilmiş ve tespit edilen bu kelimeler dört alt başlıkta sınıflandırılmıştır. tespit edilen bu kelimelerden yola çıkarak milli kültürün önemli bir ögesi olan o dönem türk giyim kuşam gelenekleri hakkında genel bir bilgi edinilebilmektedir. dîvânu lugâti’t türk’te geçen kelimelerden, türklerin süse ve süslenmeye de büyük önem verdiklerini görmekteyiz. bu kelimeler göstermektedir ki türkler için giyinmek sadece bedeni örtmek ve çeşitli dış etmenlerden korunmak anlamına gelmeyip; kendilerini güzel, zarif ve şık göstermenin bir aracı olarak da karşımıza çıkmaktadır. eserde geçen giyim kuşam ile ilgili kelimelerin bazılarının beyit ve dörtlüklerle kalıplaşmış sözler olan atasözleri içerisinde geçtiği de görülmektedir. bu durum, bu kelimelerin o dönemdeki kullanımı, - nisan tarihlerinde karabük Üniversitesi, mahmud kaşgari barsgani doğu Üniversitesi ve türk dünyası belediyeler İşbirliği ile kırgizistan’ın başkenti bişkek’te düzenlenen “ii. uluslar arası kaşgarlı mahmud sempozyumu: bilim dünyasına katkıları” başlıklı sempozyumda sunulan yayımlanmamış bildiri metninin genişletilmiş şeklidir. recep tek kullanım yaygınlığı ve türklerin yaşamındaki yerini ve ehemmiyetini göstermesi açısın- dan da önemlidir. anahtar kelimeler: türkler, milli kültür, giyim-kuşam ve süslenme, kaşgarlı mahmut, dîvânu lugâti’t türk, giyim-kuşam ve süslenme ile İlgili kelimeler abstract clothing is a speciality belongs to human. it protects him from cold, hot, attacks and other factors. moreover, it covers his body. traditions, beliefs, geography, lifestyle, sense of aesthetics are factors to shape of clothing. these factors have important place in creating their own clothing style. at the same time clothing separates nations from each other and it symbolizes material culture in national culture. clothing is an indicator for human being. this indicator can explain a human social situation, world- view and val- ues, it can give information about his sex, age, belief, society, marital status and mood. in turks, there are some basic clothing materials. some of them are camel, sheep, cattle, lamb, fox, sable and bear. these animal skins and furs had been used for producing clothes. these materials replaced with fabrics and cloth along with rising civilization. especially, along with settled life textile industry has improved and cotton, silk, linen and wool came into prominence at that term. about words about clothing were de- termined in dîvânu lugâti’t türk and these words were classifed under four titles. the- se words can give general information about turkish clothing and traditions at that term. we can understand from dîvânu lugâti’t türk how adornment is important for them. these words show that clothing is not only to cover a body and protect from other factors but also it is a tool to be seen as smart and good. in this study, it is seen that these clothing words are used inside proverbs. this situation is important because it shows us that the use of words, prevalence and place in turkish life at that term. keywords: turks, national culture, clothing and adornment, kaşgarli mahmut, dîvânu lugâti’t turk, words coupled with clothing giriş türk dilinin bilinen ilk sözlüğü olan dîvânu lügati’t türk, xi. yüzyılın ikinci yarı- sında kaşgarlı mahmud olarak bilinen mahmûd bin el-hüseyn bin muhammed el- kâşgarî tarafından yazılmıştır. türkçe’den arapça’ya ansiklopedik bir sözlük mahiyetinde olan dîvânu lügâti’t türk, karahanlılar döneminin en önemli eser- lerinden biridir (ercilasun & akkoyunlu, : xvi). veya yılında muhteme- len bağdat’ta tamamlanan eser, barındırdığı türkçe kelimelerin yanı sıra dönemin türkçe- sinin grameri, türk boyları ve bu boyların ağızları, türk tarihi, türk coğrafyası, türk halk edebiyatı ve folkloru, türk mitolojisi gibi çok çeşitli alanlarda verdiği bilgiler bakımın- dan bir türkiyat ansiklopedisi özelliği gös- termektedir (atalay, : x ; kaçalin, : ; ercilasun & akkoyunlu, : xvi). türk kültürünü bütün yönleriyle der- lemeye çalışan kaşgarlı mahmut, bilgeliği ve akademik kişiliğiyle dönemin türk toplum yaşamını eserinde gözler önüne sermeye ça- lışmıştır (yavuz, : ). kaşgarlı mahmud, türkçenin ilk ta- nıklı sözlüğü olan eserine türkçe olduğunu düşündüğü kelimeleri almış ve bu kelimelerin cümle içindeki örnek kullanımlarını göstere- rek de arapların türkçeyi kolay bir biçimde öğrenmelerini amaçlamıştır (bulut, : ). dîvânu lügâti’t türk’ün günümüze ulaşmış tek nüshası İstanbul fatih’teki millet yazma eserler kütüphanesi ali emirî efendi yazmaları kısmında numarada bulun- maktadır (ercilasun & akkoyunlu, : xxxvi). eser, muhammed bin ebî bekr bin ebi’l feth es-sâvî tarafından müellif nüsha- sından Şam’da istinsah edilmiş ve istinsah ağustos ’da tamamlanmıştır (ercilasun & akkoyunlu, : xxxvi). ali emirî efendi tarafından tesadüfen bulunan eser (atalay, : xviii), ilk olarak - yılları arasında kilisli rıfat tarafın- dîvânu lugâti’t türk’te giyim kuşam kültürü İle İlgili kelimeler dan yayınlanmıştır (kaçalin, : ; ercila- sun & akkoyunlu, : ixx). türklerin sosyal hayatına ilişkin önemli veriler sunan eserde, giyim-kuşamla ilgili bilgiler de yer almaktadır. bireyin bede- nini örten, onu dondurucu soğuktan, yakıcı güneşten, çeşitli saldırılardan vb. dış etmen- lerden koruyan giyinme, insana has bir özel- liktir. Örf ve âdetler, inançlar, coğrafya, ya- şam biçimi, estetik anlayış gibi hususlar folk- lorik bir öge olan giyim kuşamın şekillenme- sinde etkili faktörler olarak karşımıza çıkmak- tadır. bu faktörler, milletlerin kendi milli gi- yimlerini yaratmalarında da mühim bir rol oynamıştır. tarihî süreç içerisinde milletleri birbirinden ayıran özelliklerden biri olarak giyim kuşam, milli kültür içerisinde yer alan önemli bir maddi kültür ögesi olmuştur. dîvânu lugâti’t türk’te geçen oğuz elbisesi giymek anlamına gelen “oguzlan-” (ercilasun & akkoyunlu, : ), yağma gibi giyin- mek anlamına gelen “yagmalan-” (ercilasun & akkoyunlu, : ), türk çarığı giymek anlamına gelen “çarukla, çarıkla” (ercilasun & akkoyunlu, : ), türk ayakkabısı anla- mına gelen “izlik” (ercilasun & akkoyunlu, : ) ve Çiğillerin giydiği börk demek olan “kıymaç börk” (ercilasun & akkoyunlu, : ) gibi sözcükler ile balasagun’da yaşayan ve soğdak diye adlandırılan bu kav- min türkler gibi giyindiklerinin kaşgarlı mahmud tarafından açıklamada belirtilmesi (ercilasun & akkoyunlu, : ) giyim kuşamın bir milletin kültürünün ayrılmaz bir parçası, onun simgesi ve sembolü olduğunu kanıtlar niteliktedir. giyim kuşam, insanoğlu için aynı zamanda bir göstergedir. bu gösterge, insanın sosyal durumunu, statüsünü, dünya görüşü- nü, değerlerini ifade edebilir; onun cinsiyeti, yaşı, inancı, mensubu olduğu topluluk, me- deni hâli ve hatta o andaki ruh hâli hakkında karşısındakilere bir fikir verebilir (ennınger, Örneğin uygur kadınları gençlik döneminde renkli (kırmızı, yeşil) desenli kumaşlardan elbiseler giymeyi severken; yaşlılık dönemlerinde beyaz ve siyah giysiler giymeyi tercih etmişlerdir. gençlik ve ihtiyarlık dönemle- rindeki bu farklılık, elbisenin şekil ve biçiminde de gö- rülmüştür. budist rahipler, müritlerden farklı bir biçimde beyaz kumaştan önü açık gömlek ve pantolon giyip üstüne sarı renkli kumaş örtmüşler veya yere değinceye kadar sarkıtmışlardır. başlarını da sık sık kazıtıp şapkasız dolaşmışlardır. müslüman din adamları ise başlarına sarık sarıp ayaklarına mes ve lastik üstüne de siyah cüp- pe giymişlerdir. toplum içerisinde yüksek rütbeli kimse- ler elbiselerinin önüne ve arkasına derecelerini gösteren altın ve kalotun iplerden kuş veya çeşitli hayvan şekilleri işlemişlerdi. yine elbisenin rengi, içinde bulunulan ruh hâlinin bir göstergesi kabul edilmiş ve elbisenin rengi ruh hâlini yansıtır biçimde seçilmiştir. mesela uygurlarda kırmızı, sevinç ve şadlığın; beyaz, saflık ve kutluluğun; siyah ise kaygı ve sükûnetin sembolü olarak algılanmıştır. ayrıntılı bilgi için bkz. rahman, : - . başka bir kaynakta ise bu konuda şu bilgileri görmekteyiz: “İslam devletlerinde daha halife Ömer zamanında müslüman olmayan tebaanın müslümanlardan ayırt edici bir giysi giymeleri ya da belirli bir işaret taşımaları öngörülmüştü. türk tarihinde de eski dönemler için dinlere göre ayrı ayrı giyimler söz konusu olmasa bile selçuklulardan başlayarak böylesi ayrımlara gidildiği bilinmektedir. osmanlı İmparatorluğu döneminde bu ayrım, daha da belirginleşmiş, zımmi denen, yani devletin güveni altında kabul edilen müslüman olmayan tebaanın, giyim- kuşamda müslümanlar gibi görünmemesine büyük önem verilmiştir. bu amaçla da zaman zaman yayımlanan fermanlar, çıkartılan divan kararları, yani hükümlerle, başa sarılan tülbentten ayağa giyilen pabuca dek, müs- lüman olmayanların giyecekleri şeyler, renk, kalite, biçim hatta uzunluk-kısalık bakımından birbirinden ayrı tutul- muştur. Örneğin daha xiv. yüzyıl sonlarında, müslü- manlar külahlarına beyaz tülbent sararlarken, rumların mor ya da mavi, yahudilerin ise sarı renkte şerit takmala- rı zorunlu kılınmıştı. böylece müslüman olmayan kişiler ayırt edilmiş, cizye tahsildarlarınca da kolaylıkla tanınmış oluyorlardı. xvi. yüzyıla gelindiğinde, atlas kemha ipekli gibi değerli kumaşların, ince tülbentlerin ve pahalı pabuç- ların müslüman olmayanlarca kullanılmasının önlendiği görülmektedir. zımmi sayılanlara bu yasaklar getirilir- ken, müslümanların da şapka giymeleri yasak edilmişti. tarihli bir belgede de vurgulandığı gibi daha fatih mehmet döneminde İstanbul’daki yahudilerin kırmızı, hıristiyanların ise siyah renk şapka giymeleri öngörül- müştü.” (turan, : ). ennınger ise bu konuda şu örneği verir: “Örneğin amish erkekleri tarafından giyilen mavi ya da siyah renkli mutze, bir yabancı için sadece bir cekettir. amish kültüründeki giysi normlarını bilen bir kimse için ise mutze, bu giysiyi giyen kimsenin bir amish olduğunu ve vaftiz edildiğini (bu işlem genellikle yaşında gerçekleşir.) gösteren bir giyim eşyasıdır. mutze mavi renkli ise giyen kimsenin ile yaşlarında; siyah recep tek : - ; uçar, : ; arığ, ). zaman içerisinde çeşitli işlevlere sa- hip olan giyim kuşam geleneklerinde, coğrafî şartlara uyma, korunma ihtiyacı, dinî inanç- lar, siyasal düzenlemeler, ekonomik şartlar ve meslekî nedenler gibi faktörler (turan, : - ) etkili rol oynamıştır. türklerde giyim kuşam eşyalarının ana malzemesini deve, koyun, kuzu, sığır, tilki, samur ve ayı gibi hayvanların derisi ve kürkü ile koyun, keçi ve deve yünü oluştur- maktaydı (Ögel, : - ; tezcan, : - ; arığ, ; Özbay, : ; kafe- soğlu, : ). medeniyetin gelişmesi ve uygarlığın ilerlemesi ile birlikte bunlar yerini kumaşlara ve bezlere bırakmıştır. Özellikle yerleşik haya- ta geçiş ile birlikte dokumacılığın yaygınlaş- ması, pamuk, ipek, keten ve yünlü dokuma giyim kuşam eşyalarını ön plana çıkarmıştır (Özbay, : ; rahman, : - ; turan, renkli ise bu giysiyi giyen kişinin yaşından büyük olduğunu göstermektedir. bir yabancıya göre bir rus kalpağı, kırmızı renkli basit bir şapkadır. bir rus için ise bu kalpak, bu şapkayı giyen kimsenin doktor olduğuna işaret etmektedir.” (ennınger, : ). nezihe araz ise “anadolu-kadın giyimi Üstüne notlar başlıklı yazısında bu konuda önemli bilgiler vermektedir. Örneğin kişinin giydiği çorabın burnundaki mühürden mensup olduğu yörük boyunun yanı sıra çoraptaki motiflerden hareketle giyenin evli mi bekâr mı, ovalı mı dağlı mı, büyük ağa mı küçük ağa mı olduğunun anlaşılabileceğini belirtir (araz, : - ). yine kadının alnındaki altın sayısının kadı- nın çocuk sayısını göstermekle birlikte gelinin başındaki süslemelerin ve işlemelerin her birinin de ayrı bir anlam içerdiğini ifade eder. mesela başta bulunan mezar taşı oyası gelinin kaynanası ile arasının bozuk olduğunu anlatırken Çayır çimen oyası gelinin kaynanası ile mutlu olduğunu, kırmızıbiber oyası gelinin kocasıyla arasının iyi olmadığını, hercai oyası ise kocasının gözünün dışa- rıda olduğunu anlatır (araz, : ). ayrıntılı bilgi için bkz. araz, : - . giyimin işlevleri için bkz. tezcan, : - ; ennınger, : - . türklerde pamuklu, ipekli kumaşlar ve keten dokumalarla ilgili ayrıntılı bilgi için bkz. Ögel, : - . bahaeddin Ögel, türk kültürünün gelişme Çağları adlı eserinde de ayrıca turfan’da dokunan çiçekli uygur kumaşlarının çok meşhur olduğunu ve Çin elçisinin bu kumuşlara hayran kaldığını, beş-balıg’da dokunan kumaşların da arap ve İran kumaşları ile rekabet hâlinde olduğunu belirtir (Ögel, : ). : ; Öger & İnce, : - ). tarihin eski dönemlerinde atlı-göçebe yaşayan türklerde erkekler, deri pantolon , belden süslü kemerlerle sıkılan uzun etekli ceketler, uzun kaftan, kürk, soğuk ve sıcak havalar için ayrı ayrı pelerinler, hırka, gömlek ve börk (Ögel, : - ; esin, : ; turan, : - ; tezcan, : - ; Özel, : - ; tavkul, : - ; lale, : - ; kafesoğlu, : ); kadınlar ise şalvar, gömlek, cepken, dolama ya da kaf- tan ve ayakkabı; başlarına ise çok çeşitli baş- lıklar giymişlerdir (Özel, : - ; Özda- rıcı, : - ; turan, : - ). bildiride, dîvânu lugâti’t türk’te tes- pit edilen giyim-kuşam ile ilgili kelimeler dört alt başlıkta sınıflandırılmıştır. bu alt başlıklar ve başlıklar içerisinde yer alan kelimeler şun- lardır : . giyim kuşamda kullanılan mal- zemeler ile İlgili kelimeler: agı: İpek kumaş (ercilasun & akkoyunlu, : ). Âl: turunç renginde bir kumaş ( ). ay: turuncu renkli ipek ( ). barçın: İpekli kumaş, ipek ( ). böz: bez ( ). buçgak: devenin ayak derisi ( ). Çarukluk: ayakkabı yapmak için hazırlanan deri ( ). Çaydam: yağmurluk yapmaya veya yatak doldurmaya yarayan ince bir keçe ( ). Çınaxsı: nakışlı Çin ipeği ( ). Çit: Üzerine nakışlar basılmış Çin ipeği ( ). Çuz: kırmızı ve siyah altınla işlenmiş Çin kumaşı (atlas) ( ). edēd: kumaş vb. imal edilen her şey ( ). İsmail hami danişmend, paris antropoloji mektebi etnoloji profösörü dr. george montandon’un “traite d’ethnologie culturelle” adlı eserinde Çin’e pantolunun ilk olarak orta asya türkleri tarafından ithal edildiğinin söylendiğini belirtmektedir (danişmend, : ). selçuklu ve osmanlı dönemindeki giyim-kuşam gelenekleri ve kullanılan kumaşlar ile ilgili ayrıntılı bilgi için bkz. Özel, : - . Çalışmada ahmet b. ercilasun ve ziyat akkoyunlu tarafından hazırlanan dîvânu lugâti’t türk, tdk yay., ankara adlı eserden faydalanılmıştır. dîvânu lugâti’t türk’te giyim kuşam kültürü İle İlgili kelimeler eldiri: oğlak derisi ( ). eşgürti: İpek cinsinden işlemeli bir Çin kuma- şı ( ). eteklik böz: etek yapmak için kullanılan ku- maş ( ). xulın: değişik renklerde olan ve Çin’den geti- rilen bir ipek ( ). kaçaç: bir Çin ipeklisi ( ). kāfgar: behremān ipeği ( ). keçe: oğuzcada keçe ( ). kedüklük: yağmurluk yapmak için hazırlan- mış keçe malzeme ( ). kemek: pamuktan yapılan nakışlı ve şeritli bir kumaş ( ). kenzi: değişik renklerde kırmızı, sarı, yeşil Çin kumaşı ( ). kerim: nakışlı kumaş ( ). kez: bir tür Çin kumaşının adı ( ). kimişge: nakışlı kaşgar keçesi ( ). kuyka: deri ( ). loxtay: Üzerinde sarı pullar olan Çin ipeklisi ( ). mındatu: İpek ( ). sagrı: deri ( ). Şalaşu: bir Çin dokuma türü ( ). tatırga: tirşe, tabaklanmış beyaz deri ( ). taxçek: bir tür Çin ipeği ( ). taxtu: eğrilmeden önceki ham ipek ( ). tewren: Şalvar uçkuru yapmak için bir araya getirilip burulan ipler ( ). tıgrak: deri ( ). torku: İpek ( ). uyma: türkmenlerin ayakkabı yapımında kullandıkları keçe ( ). yatuk: İki cins iplikten örülen yün, argacı pamuk olan yün ( ) yūnyun: yün, deve tüyü ( ) yun: pamuk ( ). yuvlıç: tiftik, keçinin ince, yumuşak yünü ( ). züngüm: bir tür Çin ipeği ( ). . kadın-erkek giyim kuşamı ile İl- gili kelimeler: artıg: kadın yeleği ( ). aşuk: demir tolga ( ). bagırdak: kadın göğüslüğü ( ). başmak: oğuzlar ve kıpçaklarda ayakkabı ( ). bertü: Üst kısma giyilen elbise, hırka ( ). beçkem: İpekten veya yaban öküzü kuyru- ğundan yapılan ve savaşta kahramanın kim olduğunu gösteren alamet ( ). börk: başa giyilen şey, börk ( ). büküm etük: oğuzcada kadınların giydiği ayakkabı ( ). bürünçük: burnu ve burundan aşağısını örten yarım peçe, yaşmak ( ). Çekrek: kölelerin giydiği yünden yapılmış aba ( ). Çenşü: küçük hırka ( ). didim: gerdek gecesi gelinin giydiği taç ( ) eliglik: eldiven ( ). eşük: sarınmak için kullanılan örtü, üste giyi- nilen ve bürünülen şey ( ). etek: etek ( ). etik/etük: ayakkabı, edik, çizme ( ). İçmek: kuzu derisinden kürk ( ). İçük: samur, sincap vb. hayvanlardan elde edilen kürk ( ). İzlik: kesilen hayvanın derisinden yapılan türk ayakkabısı ( ). kadış: kesilen hayvanların derisinden diline- rek yapılan kayış ( ). kaftan: kaftan ( ). kars: koyun yününden veya deve tüyünden yapılan elbise ( ). kedgü: giyilen şey, elbise ( ). kedük: kepenek ( ). kedük: kuş tüyünden başlık ( ). kedüt: giyilen her çeşit elbise ( ). kewşek: yumuşak ve gevşek olan şey, ince (elbise vb.) ( ). keyük: “d”yi y yapanların lehçesinde kepe- nek ( ). kıdıklıg börk: dikilmiş kenarı olan başlık ( ). kıymaç börk: Çiğillerin giydiği tiftikten beyaz börk ( ). Çobanların omuzlarına aldıkları dikişsiz, kolsuz, keçeden üstlük, aba (türk dil kurumu, : ). recep tek könlek: gömlek ( ). kŏşik: yüz örtüsü, örtü ( ). kulak ton: kısa yenli elbise ( ). kur: kuşak, kemer ( ). kurşag: kuşak ( ). kuturma börk: Önde ve arkada kanadı olan başlık ( ). kuyka: kürk ( ). mükim (etük)/mükin (etük): kadınların giy- diği ayakkabı ( ). otran: yağmalarda paçalı giyecek ( ). sakalduruk: başlık sıkı dursun ve düşmesin diye çene altından bağlanan ipekten örülmüş ip ( ). samda: Çiğil lehçesinde giyilen sandal ( ). saraguç: kadının yaşmağı ( ). sırdım: oğuzcada deri ip, kayış ( ). suf: yün ipliklerden elde edilen bir kuşak ( ). suwluk: sarık ( ). terinçek: oğuzcada ince kadın çarşafı ( ). tŏnton: elbise ( ). uguk: tozluk, çorap ( ). Ümǖm: Şalvar, tuman, pantolon ( ). yagku/yaku: yağmurluk ( ). yalma: kaftan ( ). yaptaç: Çobanların yağmur ve karda giydiği küçük keçe ( ). yarındak: türk sırımı, kayış. keçi derisinden yapılır ( ). yişim: tozluk, soğukta iki bacağa giyilen bir çift tozluk ( ). . kıyafetin bölümleri ile kıyafe- ti/elbiseyi tamamlayıcı unsurlar ile İlgili kelimeler: bogmak: gömlek düğmesi ( ). burtala-: börk vb. şeylere altın pullar yapış- tırmak ( ). burtalan-: börk vb. şeyler altın varaklarla altınlanmak ( ). cigi: kıpçak vb. lehçelerde sağlam, sık dikiş, dikişi sağlam dikiş ( ). Çırguy: böğrün iki yanından kemerin geçtiği ilik ( ). Çikin: altın ipekle ipekli kumaşı nakışlama; altın ipekle kumaşa işlenen tasvir ( ). esrile: kaplan derisi gibi nakışlamak ( ). İlersük: uçkur ( ). kırgag: elbisenin kenarları ve çevresi ( ). kimsen: başa giyilen başlık vb. şeylerde kul- lanılan ince, altın yapraklar ( ). koy: kaftanın koyun kısmı ( ). könçek: oğuz lehçesinde yaka ( ). kudurgak: kaftanın arkadaki iki kuyruğun- dan biri ( ). Ör: kaftanın koltuk altı ( ). saçu: elbise, mendil vb. şeylerin saçağı ( ). saxt: oğuzlarda tokalar, kemer başları ve eyerdeki altın ve gümüş kakmalar ( ). sıdıg: kaftanın uçlardan göğse kadar uzanan iki eteğinden biri ( ). sıgzıg: mest vb. şeylerde iki dikiş deliği arası- na konan şerit ( ). sidig: kaftanın yanlardaki iki eteğinden biri ( ). tizildürük: ayakkabıların ucuna takılan bakır pullar ( ). tizme: İçine ip geçirildikten sonra ağzı bağla- nan şalvarın uçkurluğu ( ). toku: kemerin tokası ( ). tūş: altından veya gümüşten yapılan ve ke- merin ucuna takılan toka ( ). tügme: düğme ( ). ulag: elbise yaması ( ). uldan: ayakkabının altı ( ). Üstem: toka, kemer başı ( ). yaka: elbise yakası ( ). yamag: yama ( ). yanalduruk: kepeneğin omuzlarına dikilen, tipi ve yağmurdan korunmak için başa örtü- len keçe parçası ( ). giyim kuşamı tamamlayıcı unsurlar- dan birisi de şüphesiz ki süslenme ve süs eşyalarıdır. kaynaklardan hareketle eski türk toplum yaşamında kadınların yanı sıra erkek- lerin de saçlarını uzatıp tokalar taktıklarını, ördüklerini ya da topuz yaptıklarını, kulakla- rına küpeler taktıklarını, kadınların süs eşyası olarak ya da değişik amaçlarla bilezik; erkek- lerin ise kolbağı/kolçak kullandıklarını, par- maklarına yüzükler taktıklarını öğrenmekte- yiz (Ögel, : - ; esin, : - ; Ögel, : ; sevin, : ; Özel, : - ; tavkul, : - ; Ögel, : ; Öz- dîvânu lugâti’t türk’te giyim kuşam kültürü İle İlgili kelimeler darıcı, : - ; turan, : ). bun- lara ilave olarak yukarıda sıralanan kelimeler içerisinde yer alan börk vb. başlıkların altın pullar, yapraklar ve varaklarla süslenmesi, ipekli kumaşın altın ipekle nakışlanması, altından veya gümüşten yapılan ve kemerin ucuna takılan tokalar ile tokalar ve kemer başlarındaki altın ve gümüş kakmalar, ayak- kabıların ucuna takılan bakır pullar bu süs eşyaları içerisine dâhil edilebilir. aynı za- manda dîvânu lugâti’t türk’te geçen “bezen- ”, “enlik”, “bogmak”, “önik” gibi sözcükler- den hareketle kadınların süslenmek, kendile- rini güzel göstermek için makyaj yaptıklarını, yanaklarına kırmızı allıklar sürdüklerini, altın vb. şeylerden yapılmış gerdanlıklar ve kolye- ler, keçi kılından yapılma sahte zülüfler tak- tıklarını da öğrenmekteyiz. dîvânu lugâti’t türk’te geçen süs ve süslenme ile ilgili bu kelimeler şunlardır: bakan: pirinçten yapılan halka ve boyun hal- kası (tavk), genel olarak boyunluk ve halka ( ). bezen: bezenmek, kadın süslenmek, kadın makyaj yapmak ( ). bogmak: İnci ve mücevher kakılmış altın vb. şeylerden yapılan gerdanlık, kolye. gelin bununla gerdeğe sokulur ( ). būt: kıymetli ve büyük firuze ( ). o, bü- yüklerin oğul ve kızlarının perçemlerinin altına takılır ( ). enlik: allık, kadınların yanaklarını boyadıkla- rı kırmızı bir boya ( ). kirşen: kirşan, üstübeç ( ). *yüze sürülen allık, pudra+. Önik: kadınların kullandıkları keçi kılından yapılma sahte zülüf ( ). “burtala-“, “burtalan-“, “kimsen”. “Çikin”. “tūş”. “saxt”. “tizildürük”. küpe ve yüzük taşı gibi süslemede kullanılan, mavi renkli, saydam olmayan hidratlı doğal alüminyum ve fosfattan oluşan değerli bir mineral (türk dil kurumu, : ). Örçüg: oğuzcada saç örgüsü ( ). Örgüç: kadının saç örgüsü ve saç öbeği ( ). Örgüçlen: saç örgüsü olmak ( ). Örme saç: saç örgüsü ( ). Örük saç: Örgülü saç ( ). sulundı: adamın saç örgüsü ( ). tartıg: adamın saç örgüsü ve onun bağı ( ). tod monçuk: parfüm ve miskten yapılmış boncukların adı. bunu cariyeler takınır ( ). tolgag: küpe, kadın küpesi ( ). Ügmek: altından veya gümüşten kadın hal- kası, küpe ( ). yinçü: İnci, büyük inci ( ). yüzük: yüzük ( ). . giyim kuşam ile İlgili diğer ke- limeler: beçkemlen-: savaş günü vb. zamanlarda beç- kem denilen alameti takınmak ( ). bertülen-: hırka giymek ( ). boxtay: elbise bohçası ( ). börk yanı: börk kalıbı ( ). burış: deri ve elbisedeki buruşukluk ( ). burkug: deri vb. şeylerin çekilip büzülmesi ( ). bürük: torba, şalvar gibi şeylerin ağzını büz- meye yarayan ip ( ). bürün: bürünüp yüzünü kapatmak ( ). Çarukla-çarıkla: türk çarığı giymek ( ). Çaruklan-: ayakkabı giymek ve ona sahip olmak ( ). Çaruglug: Çarıklı ( ). Çekreklen-: kepenek giyinmek ( ). Çikne-: altın ipekle ipekli kumaşı işlemek, üzerine tasvir yapmak ( ). Çöpre: eski elbise ( ). eteklen-: elbise eteklenmek ( ). eteglig: eteği olan ( ). etüklen-: ayakkabı sahibi olmak ( ). İçle-: (elbiseye) astar yapmak ( ). İçmeklen-: kuzu kürkü giymek ( ). İçükle-: elbiseye kürk yapıştırmak ( ). kadıg: sağlamlaştırılmış dikiş ( ). kadıl: elbiseyi teyellemek ( ). teyel: seyrek ve eğreti dikiş. teyel yapmak: dikilecek parçaları birbirine teyelle tutturmak, kumaşın üzerinde recep tek kadışla: kayış yapmak ( ). kadu: teyellemek ( ). kātunlan: hatun elbisesiyle bezenmek ( ). kaw kuw bol-: (elbise) kötü dikiş sonucu büzülüp yırtılmak ( ). ked: giymek ( ). kedil-: giyilmek ( ). kedindi: Çok giyilmiş elbise ( ). kedrül-: giydirilmek ( ). kedür-: giydirmek ( ). kirşenlen-: yüzüne düzgün sürmek ( ). kiz: elbise sandığı, elbise bohçası ve saklayıp koruyan her şey ( ). könçüklen-: (elbiseye) yaka yapılmak ( ). könleklen-: gömlek giymek ( ). köpül-: (elbise) kaftan gibi kabartılarak di- kilmek ( ). kurşa-: kemer bağlamak ( ). kurşag: kuşakla kuşanma ( ). kurşan-: kemer kuşanmak ( ). oguzlan-: oğuz elbisesi giymek ( ). opra-: elbise eskimek, yıpranmak ( ). sagrıla-: hayvan derisinden sahtiyan yap- mak ( ). saraguçlan-: baş örtüsüyle baş örtmek ( ). sarın-: sarınmak, sarık sarınmak ( ). sarın-: yaşmaklanmak, örtünmek ( ). sarıt-sarut-: (sarık vb. şeyleri) sarınmak ( ). sarlan-: Örtü vb. bir şeyi sarınıp örtünmek ( ). sedre-: (elbise) havı dökülüp eskimek ( ). sedreş-: (elbise vb.) için kalınlığı gitmek, yo- ğunluğu azalmak, seyrelmek ( ). serdet-: elbiseyi seyreltmek ( ). tıtıl-: (elbise vb.) eskiyip parçalanmak ( ). tik-: (elbise vb. şeyleri) dikmek ( ). tikiglik: dikilmiş olan (elbise vb.) ( ). tokula-: kayışa toka takmak ( ). tonat-: elbise giydirmek ( ). tonlan-: elbise giymek ( ). tŏnluk: elbise için planlanan kumaş ( ). topul-: oğuzcada (elbiseyi) çıkarmak ( ). dikilecek yerleri teyelle belirtmek. teyellemek: teyel yapmak (türk dil kurumu, : ). sahtiyan: tabaklanarak boyanmış ve cilalanmış genellikle keçi derisi (türk dil kurumu, : ). Ügmeklen-: küpe takınmak ( ). Ǖmlüg: Şalvarlı, tümenli ( ). Ütüg: kırışıklıkları gitsin diye kızdırılarak elbisenin dikiş yerlerine bastırılan mala şek- linde demir ütü ( ). yagmalan-: yağma gibi giyinmek, yağma gibi davranmak ( ). yama-: yamamak ( ). yamaglıg: yamalı ( ). yamaglıg böz: yamamak için hazırlanmış kumaş vb. bir şeyin parçası ( ). yamagu: yamamaya değer, yamanacak (elbi- se vb.) ( ). yamal-: (elbise vb.) yamamak ( ). yarat-: oğuzlarda (elbise, ayakkabı vb. şeyler) yapmak. yıgrıl: elbise çekmek ( ). yi: dikiş, dikiş yeri ( ). yişimlen-: tozluk giyinmek ( ). yorış-: (İpek vb.leri üzerinde) yıpranmadan dolayı yollar, çizgiler belirmek ( ). dîvânu lugâti’t türk’te geçen kelime- lerden bazılarının günlük yaşamın yanı sıra beyitler, dörtlükler ve atasözleri içerisinde de kullanıldıkları görülmektedir. giyim kuşamla ilgili kelimelerin geçtiği beyit ve dörtlükler şöyledir: türlüg çeçek yazıldı barçın yadım kerildi uçmak yeri körüldi tumlug yana kelgüsüz. bardı sana yek utru tutup bal barçın kedipen teli yuwga bolup kāl ( ) ulşıp eren bȫrleyü yırtıp yaka orlayu sıkrıp ǖni yurlayu “türlü çiçekler açıldı. sanki ipek halı yayıldı. böylece cennet yeri görüldü. mevsim öyle ılıklaştı ki soğuk hiç dönmeyecek.” (ercilasun & akkoyunlu, : ) “Şeytan sana bal verdi. hatta ona kanıp ondan ipek bile giyindin. madem ki onun entrikasını anlamıyorsun öyle kal ve delilik içinde yaşa.” ( ). dîvânu lugâti’t türk’te giyim kuşam kültürü İle İlgili kelimeler sıgtap közi örtülür. ( ) İçerisinde giyim kuşamla ilgili kelime- lerin yer aldığı atasözleri ise şunlardır: barçın yamagı barçınka kars yamagı karska. ( ) tatsız türk bolmas başsız börk bolmas. ( , ). taz keligi börkçile. ( ). suw körme ginçe etük tartma. ( ). İzlik bolsa er uldımas, içlik bolsa at yagrı- mas. ( ). kılnu bilse kızıl keder yaranu bilse yaşıl ke- der. ( , ). neçe me oprak kedük erse yagmurka yarar. ( ). kin ton opramas keneşlig bilig artamas. ( ). tawgaç xānın torkusu telim tenlemedip bıç- mas. ( ). “afrasiyâb’a üzüldükleri için adamlar kurt gibi ulumaya başladılar. feryat ve figan ederek yakalarını yırtıyorlar.” ( ). “İpeğin yaması ipekle daha uygun olur. yünün de yaması yünle yakışır. bu, her cinsin kendi cinsine daha meyilli olduğunu anlatmak için kullanılır.” ( ). “başsız börk olmadığı gibi farssız türk de olmaz.” ( ); “türklere karışmamış hiçbir fars yoktur; üzerine konacak baş olacak ki börk de olsun.” ( ). “kelin gelişi börkçüyedir.” ( ). “su görülmeden ayakkabı çıkarılmaz. İşlerde temkinli davranmak için söylenir.” ( ) “adam ayakkabılı ise yalınayak kalmaz; atın sırtında örtü varsa (atın) sırtı yaralanmaz. bu söz, işlerde tedbirli olmak için söylenir.” ( ). “kadın kocasıyla iyi geçinmek isterse kırmızı ipek giyer; naz ve cilve yapmak isterse yeşil ipek giyer. bu söz kadınlar için kullanılır; kadın iyi davranırsa iyi karşılık görür.” ( ). ayrıca bkz. s. . “keçe ne kadar yıpranmış olursa olsun yağmurda işe yarar. kötü davranan ve kibirlenen hizmetçiyi çıkarmak isteyen adam için kullanılır. böyle olsa bile belki onu bazı işlerinde kullanırsın ve sen de rahat edersin.” ( ). “geniş elbise çabuk yıpranmaz; meşveretle aşılanmış akıl bozulmaz. bu, işi yaparken başkasına danışılması ve kendi başına yapılmaması için söylenir.” ( ). “Çin hakanının ipeği çoktur. buna rağmen ölçmeden elbiselik kesmez. bu söz israfı önlemek ve bir işi bilerek yapmak için kullanılır.” ( ). itka uwut atsa uldan yimes. ( ). ernenke elig karı bözün ǖm tükemes. ( ). bütün ǖmlüg kança kolsa olturur. ( ). yakadaki yalgagalı eligdeki ıçgınur. ( , ). sonuÇ kaşgarlı mahmut’un dîvânu lugâti’t türk adlı eserinde “giyim kuşamda kullanı- lan malzemeler ile İlgili kelimeler” başlığı altında , “kadın-erkek giyim kuşamı ile İlgili kelimeler” başlığı altında , “kıyafetin bölümleri ile kıyafeti/elbiseyi tamamlayıcı unsurlarla İlgili kelimeler” başlığı altında ve “giyim kuşamla İlgili diğer kelimeler” başlığı altında ise kelime olmak üzere top- lam kelime tespit edilmiştir. bu kelime- lerden yola çıkarak milli kültürün önemli bir ögesi olan o dönem türk giyim kuşam gele- nekleri hakkında genel bir bilgi edinilebilmek- tedir. kaşgarlı mahmud’un eserinde yer ver- diği ve açıklamalarda bulunduğu kelimeler- den hareketle türklerin giyim kuşam eşyala- rını elde etmede çeşitli renklerde düz ve na- kışlı ipekler, pamuklu ve keçi, koyun gibi hayvanların yününden elde edilen dokuma- lar, deve, oğlak, kuzu, samur, sincap, keçi derileri, keçeler , deve ve kuş tüyü kullandık- “köpeğe hayâ atılırsa (utandırılırsa) ayakkabının altını yemez. birsinin hayâ ile iş yapması istendiği zaman söylenir ve bu sözle birisi hayâlı olmaya zorlanırsa, hayâdan dolayı kötü işlerini terk eder.” ( ). “bekâr adamın şalvarı için elli arşın kumaş yetmez. Çünkü ona yabancı öğüt vermez. evlenmesi istenen kişi için söylenir.” ( ). “Şalvarı sağlam olan istediği şekilde oturur. kendisinden emin olup hiçbir töhmeti umursamayan kimse için kullanılır.” ( ) “yakadaki yemek döküntülerini yalayanın elindeki kap vb. kaçar veya kaçırılır. elindeki kendisine yetiyorsa onunla yetinilmesi ve o şeyin muhafaza edilmesi için söylenir.” ( , ). robert lewie adlı amerikalı bir antropoloji profesörünün fransızcaya çevrilen eserinde, keçenin bir türk icadı olduğu ve bu icadın Şark âleminde yunanistan ile garp âleminde roma’ya türklerden geçtiği, ayrıca yunanlılarla romalıların türk yamçısına bürünerek recep tek larını; bunlardan yararlanarak elbise, panto- lon, şalvar, etek, gömlek, yelek, hırka, şal, kürk, kaftan, kepenek/aba, yağmurluk, ayak- kabı, çarık, börk ve çeşitli başlıklar ile kayış ve kuşak gibi giyim kuşam eşyaları ürettikleri görülmektedir. dîvânu lugâti’t türk’te geçen kelime- lerden, türklerin süse ve süslenmeye de bü- yük önem verdiklerini görmekteyiz. burada geçen kelimelerden hareketle kadınların mak- yaj yaptıklarını yanaklarına allıklar sürdükle- rini, keçi kılından yapılma sahte zülüfler, inci ve mücevher kakılmış altın vb. şeylerden ya- pılan gerdanlık ve kolyeler taktıklarını, kadın- lar gibi erkeklerin de saçlarını uzatıp ördükle- rini, altından ve gümüşten küpeler, yüzükler taktıklarını, yine altından veya gümüşten yapılan altın, gümüş kakmalı kemer başları, tokalar kullandıklarını öğrenmekteyiz. bu kelimeler göstermektedir ki türk- ler için giyinmek sadece bedeni örtmek ve çeşitli dış etmenlerden korunmak anlamına gelmeyip; kendilerini güzel, zarif ve şık gös- termenin bir aracı olarak da karşımıza çık- maktadır. “giyim kuşamla İlgili diğer keli- meler” içerisinde yer alan ve “ütü” anlamına gelen “ütüg” kelimesi de bu fikri destekler mahiyettedir. zira bu, türklerin tertipli ve düzenli olmak, hoş ve güzel görünmek için kıyafetlerini kırışıksız ve düzgün bir şekilde giymeyi âdet edindiklerini, buna önem verip bu konuda titiz davrandıklarını bize göster- mektedir dîvânu lugâti’t türk’te geçen giyim kuşam ile ilgili kelimelerin bazılarının beyit ve dörtlüklerle kalıplaşmış sözler olan atasöz- leri içerisinde geçtiği de görülmektedir. bu durum, bu kelimelerin o dönemdeki kullanı- mı, kullanım yaygınlığı ve türklerin yaşa- mındaki yerini ve ehemmiyetini göstermesi açısından da önemlidir. kaynakÇa araz, n. ( ). anadolu kadın giyimi Üstü- ne notlar. türk halk edebiyatı ve folk- yağmurdan korundukları belirtilmektedir (danişmend, : ). lorunda yeni görüşler i (s. - ), an- kara: konya kültür ve turizm derne- ği yayınları. arığ, a. s. ( ). türklerdeki kıyafetin kısa tarihi, atatürk araştırmaları merkezi dergisi, / - - . http://www.atam.gov.tr/dergi/sayi- - - /turklerdeki-kiyafetin-kisa-tarihi. adresinden . . tarihinde eri- şildi. atalay, b. ( ). divanü lûgat-it türk tercü- mesi ( . cilt). ankara: türk tarih ku- rumu basımevi. bulut, s. ( ). divânü lügâti’t türk’ten ahıska türkleri yazılı ve sözlü diline geçen atasözleri, littera turca journal of turkish language and literature, / , - . danişmend, İ. h. ( ). medenî kıyafetin batı’ya türklerden İntikali, türk folk- lor araştırmaları, / , - . ennınger, w. ( ). giyim (Çeviren: n. Öz- demir), (yay. haz.: m. Ö. oğuz vd.) halkbiliminde kuramlar ve yaklaşımlar (s. - ), ankara: geleneksel ya- yıncılık. ercilasun a. b. & akkoyunlu z. ( ). dîvânu lügâti’t türk, ankara: tdk yay. esin, e. ( ). İslamiyet’ten Önce türk kültür tarihi ve İslam’a giriş, İstanbul: edebi- yat fakültesi matbaası. kaçalin, m. s. ( ). dîvânü lugâti’t türk, diyanet vakfı İslam ansiklopedisi (s. - ), İstanbul: türkiye diyanet vakfı yay. kaya, m. ( ). divânü lûgati’t türk’ün halkbilimi açısından Önemi, folk- lor/edebiyat, viii/ , - . kafesoğlu, İ. ( ). türk milli kültürü ( . baskı). İstanbul: Ötüken yayınları. lale, m. ( ). ii. mahmud dönemi kıyafet alanında yapılan yenilikler, yayım- lanmamış yüksek lisans tezi, isparta: süleyman demirel Üniversitesi sosyal bilimler enstitüsü. oğuz, m. Ö & sever m. ( ). dîvânu luga- http://www.atam.gov.tr/dergi/sayi- - - /turklerdeki-kiyafetin-kisa-tarihi http://www.atam.gov.tr/dergi/sayi- - - /turklerdeki-kiyafetin-kisa-tarihi dîvânu lugâti’t türk’te giyim kuşam kültürü İle İlgili kelimeler ti’t türk’ün nesne dünyası, (editör: f. s. barutçu Özöndör) kaşgarlı mah- mud kitabı (s. - ), ankara: kültür ve turizm bakanlığı yayınları. Ögel, b. ( ). türk kültür tarihine giriş ( . cilt). ankara: kültür bakanlığı yay. Ögel, b. ( ). İslamiyet’ten Önce türk kültür tarihi ( . baskı). ankara: türk tarih kurumu basımevi. Ögel, b. ( ). türk kültürünün gelişme Çağ- ları ( . baskı). İstanbul: türk dünyası araştırmaları vakfı yayınları. Öger, a. & İnce, g. ( ). halı dokumacılı- ğının avanos yöresi sosyo-kültürel ve ekonomik yaşamındaki yeri, ava- nos sempozyumu bildiriler kitabı - ekim , (s. - ), ankara: grafiker yay. Özbay, m. ( ). İlk yazılı belgelerimize göre türklerde giyim, milli folklor, / , - . Özdarıcı, Ö. ( ). divânü lugat-it-türk’te kadın ve kadına İlişkin unsurlar, sosyal bilimler, , - . Özel, m. ( ). folklorik türk kıyafetleri, ankara: türkiye güzel sanatları ge- liştirme vakfı yayınları. tavkul, u. ( ). tarihi türk erkek kıyafet- leri, milli folklor, , - türk dil kurumu ( ). türkçe sözlük ( . baskı), ankara: tdk. tezcan, m. ( ). giyim olgusuna sosyo- kültürel bakış ve türklerde giyim, ankara Üniv. eğitim bilimleri fakültesi dergisi, / , - . turan, Ş. ( ). türk kültür tarihi ( . baskı). ankara: bilgi yay. rahman, a. ( ). uygur folkloru (Çev. s. yalçın, e. emet), ankara: kültür bak. yay. sevin, n. ( ). on Üç asırlık türk kıyâfet tarihine bir bakış, ankara: kültür bakanlığı yayınları. uçar, z. ( ). battal gazi ve digentis akri- tas destanında simgeleşen kıyafet kültürü Üzerine, akademik bakış der- gisi, , - . yavuz, s. ( ). dîvânü lügâti’t türk’teki akrabalık adları ve bu adların tür- kiye türkçesi ağızlarındaki karşılık- ları, ekev akademi dergisi, / , - . recep tek journal ofmedical genetics, , , - pitfalls of genetic counselling in pfeiffer's syndrome m baraitser,* mary bowen-bravery, and p saldana-garcia from the kennedv-galton centre for clinical genetics, harperbury hospital, harper lane, shenley, radlett, herts wd hq summary a family with pfeiffer's syndrome is presented in which members of two generations showed only partial but relevant syndactyly before a child was born, in the third generation, with the full acrocephalosynd:ctyfy syndrome. the acrocephalosyndactyly syndromes are a group of hereditary disorders which manifest with anoma- lies of the cranium, hands, and feet. as with other dominantly inherited syndromes the clinical picture varies considerably and this has led to conflicting views about the classification of the acrocephalies. most authors recognise apert's, pfeiffer's and chotzen's syndromes and there is uncertainty about *also at the division of inherited metabolic diseases, clinical research centre, northwick park hospital, watford road, harrow, middlesex hal uj. received for putlication november a fourth entity with features of both apert's and crouzon's syndrome.' the acrocephalic syndrome of carpenter can be distinguished because of the presence ofpolydactyly. others have documented the presence of apert's, pfeiffer's, and transitional syndromes in multiple generations of the same family suggesting that the subdivision is spurious. - the variable expression and improvement of the cranio- facial deformities with age has also led to difficulties in detecting minimal manifestations, thereby in- creasing the possibility of missing gene carriers and counselling incorrectly. the following report of a family (fig ) with fig i pedigree of the family. large big toes, partial syndactyly of toes examined personally e- o fig proband iv.]. photograph and x-ray of skull. ii ill lv o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n a u g u st . d o w n lo a d e d fro m http://jmg.bmj.com/ pitfalls ofgenetic counselling in pfeiffer's syndrome al /& -t /.' .. ui k., . l/)) fig photographs of hands andfeet of (a) iv.i, (b) iii.s, (c) iii. , (d) ii . ig: :: li .. i o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n a u g u st . d o w n lo a d e d fro m http://jmg.bmj.com/ m baraitser, mary bowen-bravery, and p saldana-garcia pfeiffer's syndrome illustrates the pitfalls in genetic counselling. case reports case iv. the patient, born in , was referred to the counselling clinic because of an unusually shaped skull (fig ). the pregnancy was complicated at months by loss of blood but was otherwise unevent- ful. examination of the male child showed acro- cephaly, hypertelorism, antimongoloid slant of the eyes, a high arched palate, and a flat nasal bridge. the patient's hands showed no abnormality. there was cutaneous syndactyly of the second and third toes bilaterally (fig ) and the big toes were unusually broad. when seen at the age of months the developmental milestones were normal. case . the patient's mother, born in , had no cranial manifestations of acrocephaly (fig ) but had partial cutaneous syndactyly of the second, third, and fourth toes and large big toes (fig ). her brother is said to be similarly affected. case iii. the patient's maternal aunt, born in , had no cranial manifestations of acrocephaly (fig ) but had partial cutaneous syndactyly of the second and third toes and large big toes (fig ). case . the patient's maternal grandfather, born in , had a high forehead but his facial features were otherwise unremarkable (fig ). he had partial cutaneous syndactyly of the second and third toes and large big toes (fig ). his mother, his brother, and his brother's two children were said to have similar deformities of the feet, but were of normal facial appearance. in all affected family members examined there were no visible joint creases between the middle and terminal phalanges of some of the fingers. radiographic findings x-rays of the hands (fig ) show fusion between the middle and terminal phalanges of fingers and in the patient's mother ( . ) and maternal aunt ( i. ), and of finger in the maternal grandfather ( . ). in the feet the changes include medial deviation and partial fusion of the phalanges of the big toes (fig ). x-rays of the patient's hands are reported to be within normal limits apart from incurved little fingers. a summary of the clinical and radiographic findings appears in the table. dermatoglyphs the fingerprint patterns of the proband and the affected members of his family are of great size and contain a large number of ridges (see appendix). the digital triradii on fingers , , and are in most cases placed near the limit of the ridged skin. unusually high ridge counts of near or over ridges occur on fingers and in the proband's mother and maternal aunt. the proband's finger ridge counts could not be ascertained for technical reasons. his plantar configurations show features in common with those observed in his affected relatives. for example, his pattern intensity ( . ) is above the corresponding normal average of . loops per sole fig (a) mother ofproband, (b) maternal aunt, (c) maternal grandfather. o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n a u g u st . d o w n lo a d e d fro m http://jmg.bmj.com/ pitfalls ofgenetic counselling in pfeiffer's syndrome (a) (d) fig x-rays of hands andfeet of (a) iv.j (hands only, permission withheld for x-ray offeet), (b) iii.s, (c) . , (d) i . . (c) f /) o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n a u g u st . d o w n lo a d e d fro m http://jmg.bmj.com/ m baraitser, mary bowen-bravery, and p saldana-garcia table summary of clinical and radiological findings . . . iv.] head acrocephaly + high forehead + + hypertelorism + antimongoloid slant of eyes + flat nasal bridge + high arched palate + upper limbs absent joint creases + + + fusion of phalanges + + + lower limbs large big toes + + + + cutaneous syndactyly of toes + + + + medial deviation of phalanges of big toes + + + x-ray not partial fusion of permitted phalanges of big toes + + + and zygodactyly is represented in both feet. his plantar configurations were not found in a sample of english male controls. the dermatoglyphs of the unaffected father differ from those of his son and show nothing remarkable. discussion pfeiffer's syndrome is characterised by acrocephaly, normal intelligence, hypertelorism, antimongoloid slant to the eyes, prominent eyes, flat nasal bridge, irregularly placed teeth, soft tissue syndactyly, broad thumbs and toes, brachymesophalangia, ulnar deviation ofthe proximal phalanx ofthe thumbs, and radially deviated phalanges of the fingers. genetic counselling is usually straightforward as there have been at least three families described with three affected in two generations, and subjects affected in many generations in whom dominant inheritance was the most likely pattern of trans- mission. in the large mid-western amish kindred reported by jackson et a variable expression was found. a total of members and possibly others were affected. all those affected had clinical or radiological abnormalities of the feet, but enlarge- ment of the thumb did not occur. several members looked clinically normal or had features ofcrouzon's disease, but there were radiographic changes in the feet compatible with pfeiffer's syndrome. naveh and friedman reported a family with affected members in three generations in whom the signs of pfeiffer's syndrome were confined to the head and feet, sparing the upper limbs. in the family presented here members were aware of the transmission of webbed toes over three generations, without noticeable acrocephaly. the main deformities were syndactyly of the second and third toes, large big toes, and the inability to flex the terminal phalanges of the fingers. only the proband had, in addition, the facial features of pfeiffer's syndrome. the gene carriers in this family showed in common certain unusual dermatoglyphic features, but there is as yet no evidence that they are specific for pfeiffer's syndrome. it came as a shock to the mother to learn that there was an association between what had been regarded as a mild familial trait and the cosmetically more unacceptable craniofacial manifestations of this disorder. other members of this family, with only the mild limb abnormalities, run a risk of having off- spring with the full syndrome, but the risk is probably small. syndactyly of the second and third toes is a common dominantly inherited malformation so that only the presence of large big toes or thumbs would make pfeiffer's syndrome a possibility. addendum the possibility that separate genes are responsible for the limb and craniofacial abnormalities is made less likely by a recent encounter with a second family showing the same variation in expression as the family described above. the authors thank dr m a c ridler for his help with the preparation of this article and mrs helen butcher for typing the manuscript. references mckusick va. mendelian inheritance in man. th ed. baltimore and london: john hopkins university press, : - . smith dw. recognizable patterns ofhuman malformation. major problems in clinical pediatrics. vol . philadelphia: saunders, : - . robinow m, sorauf tj. acrocephalopolysyndactyly, type noack, in a large kindred. birth defects ; : - . jackson ce, weiss l, reynolds wa, forman tf, petersen ja. craniosynostosis, midfacial hypoplasia and foot abnormalities: an autosomal dominant phenotype in a large amish kindred. j pediatr ; : - . escobar v, bixler d. the acrocephalosyndactyly syn- drome: a metacarpophalangeal pattern profile analysis. clin genet ; : - . martsolf jt, cracco jb, carpenter gg, o'hara ae. pfeiffer syndrome: an unusual type of acrocephalo- syndactyly with broad thumbs and great toes. am j dis child ; : - . saldino rm, steinbach hl, epstein cj. familial acro- cephalosyndactyly (pfeiffer syndrome). ajr ; : - . naveh y, friedman a. pfeiffer syndrome: report of a family and review of the literature. j med genet ; : - . requests for reprints to dr m baraitser, kennedy- galton centre for clinical genetics, harperbury hospital, harper lane, shenley, radlett, herts wd hq. o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n a u g u st . d o w n lo a d e d fro m http://jmg.bmj.com/ pitfalls ofgenetic counselling in pfeifjer's syndrome appendix dermatoglyphs of the family. (a) iv. ; (b) ii . ; (c) iii. ; (d) h . ; (e) . . j. ( 'a i (a) (b) £, ( c) o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n a u g u st . d o w n lo a d e d fro m http://jmg.bmj.com/ m baraitser, mary bowen-bravery, and p saldana-garcia (d) i~ ~ - (e) o n a p ril , b y g u e st. p ro te cte d b y co p yrig h t. h ttp ://jm g .b m j.co m / j m e d g e n e t: first p u b lish e d a s . /jm g . . . o n a u g u st . d o w n lo a d e d fro m http://jmg.bmj.com/ p p –p severe intellectual disability / / age of walking normal– months years speech none or single words none developmental regression / / seizures with age of onset / , – months / mri anomalies cd / , ch / , pl / / behavioral anomalies / / decreased deep tendon reflexes / / breathing anomalies / / p = centile; cd = cortical dysplasia; ch = cerebellar hypoplasia; pl = periventricular leukomalacia. data for cntnap : jackman et al., ; strauss et al., ; zweier et al., . data for nrxn : zweier et al., . a b fig. . facial appearance of patients with compound heterozygous defects in cntnap ( a ) or nrxn ( b ). note a wide mouth in the patient with nrxn defects but otherwise unsuspicious facial ge- stalts in both patients. reprinted from zweier et al. [ ], with permission from elsevier. recessive defects in cntnap and nrxn mol syndromol ; : – [orrico et al., ], but was reported in the other patients with cntnap defects, starting at the same age as onset of epilepsy between and months [strauss et al., ; zweier et al., ]. later on, the degree of mental impair- ment seems to be stable. the early onset mandatory epi- lepsy with concurrent developmental regression in pa- tients with cntnap defects might be a discriminating aspect regarding other disorders with regression pheno- types such as rett syndrome. furthermore, the discrep- ancy between severe speech impairment and rather mild motor delay seems to be quite specific for recessive cntnap defects. similarly, in the patient with the nrxn defect, only mild motor delay with a walking age of years but no speech development was reported [zwei- er et al., ]. seizures the single patient with biallelic nrxn defects does not have epilepsy [zweier et al., ]. due to the limited number of patients, no conclusion about frequency of seizures in nrxn related intellectual disability can be made. all patients with recessive defects in cntnap do show epilepsy with an early onset between and months of age [strauss et al., ; jackman et al., ; zweier et al., ]. concurrent with the onset of epi- lepsy, language regression and deterioration of social behavior occur in most of the patients [strauss et al., ]. regarding available data reported by strauss et al. [ ], the average peak seizure frequency (number of events per week) is with complex partial, simple par- tial, secondarily generalized, and status epilepticus types of seizures. growth parameters as far as data is available, birth measurements are nor- mal. apart from siblings with short stature [orrico et al., ; zweier et al., ], later body measurements are reported to be normal as well. interestingly, many pa- tients show a tendency to rather large head circumfer- ences in relation to body height [strauss et al., ]. this might be a suitable discriminating factor in differential diagnosis to other severe intellectual disability disorders where microcephaly is common. behavioral observations behavioral anomalies with autistic traits or pervasive developmental delay, stereotypic movements and atten- tion deficit-hyperactivity disorder are common [strauss et al., ; jackman et al., ; zweier et al., ]. magnetic resonance imaging mri examination of the brain showed focal malfor- mations in patients. two of them had unilateral dyspla- sia of the anterior temporal lobe, and had a malforma- tion of the left striatum [strauss et al., ]. in other patients, periventricular leukomalacia [jackman et al., ] and cerebellar hypoplasia were observed, respec- tively [orrico et al., ; zweier et al., ]. other findings breathing anomalies [zweier et al., ] and de- creased deep tendon ref lexes [strauss et al., ; jack- man et al., ] were reported in some patients; hepato- megaly was observed in girl [jackman et al., ]. natural history cntnap early infant development appears to be normal or with only mild motor delay and is followed by onset of sei- zures, language regression or no speech development, with social and behavioral disturbances, and moderate to severe intellectual disability by late childhood [orrico et al., ; strauss et al., ; jackman et al., ; zweier et al., ]. nrxn the development of the patient was reported to be nor- mal for the first year before severe intellectual disability with a walking age of years and no speech development was noted [zweier et al., ]. recommendations for management not much information about treatment is available. in patient, zonisamide was used for treatment of seizures [jackman et al., ]. electrocorticography-guided epi- lepsy surgery for disabling complex partial seizures in patients resulted in a temporarily seizure-free period of – months but with recurrence after this time [strauss et al., ]. genetics information about the genes and protein function cntnap is one of the largest genes in the human genome spanning . mb on chromosome q – . and zweier mol syndromol ; : – consisting of coding exons (nm_ ). nrxn also belongs to the largest known genes in humans with span- ning . mb on chromosome p . . the classical neurex- in genes in mammals have promoters, generating longer � - and shorter � - neurexins, and are subject to addition- al extensive alternative splicing, generating a large num- ber of variants [missler and südhof, ]. the represen- tative nrxn isoform � (nm_ ) consists of coding exons. cntnap encodes for caspr , a protein distantly related to the neurexins and regulating neuron-glia con- tact in vertebrates and glia-glia contact in insects [bellen et al., ]. vertebrate caspr has been shown to colo- calize with shaker-like k+ channels in the juxtaparanod- al areas of ranvier nodes in myelinated axons of both the cns and pns [arroyo et al., ; poliak et al., ]. furthermore, it seems to play a role in human cortical histogenesis as signs of neuronal migration anomalies were observed in brain samples of patients with a homo- zygous cntnap mutation [strauss et al., ]. the presynaptic neurexins like nrxn and their postsynaptic binding partners, the neuroligins, are cru- cial synapse molecules [li et al., ], with � -neurexins playing a role in normal neurotransmitter release and the function of synaptic calcium channels [missler et al., ]. recently, findings in drosophila indicated that not only nrxi (nrxn ), but also nrxiv (cntnap ) might be involved in synaptic organization and that both pro- teins might be linked by a common target, presynaptic protein bruchpilot [zweier et al., ]. mode of inheritance the mutations and deletions in the published patients were inherited in an autosomal recessive manner with homozygous or compound heterozygous defects in the patients and heterozygosity for of the defects in each parent [strauss et al., ; jackman et al., ; zweier et al., ]. the carrier parents were reported to be healthy; therefore, penetrance of clinical symptoms as- sociated with heterozygous defects in either gene might be lower than possibly appreciated from previous reports on neuropsychiatric disorders [verkerk et al., ; feng et al., ; autism genome project consortium, ; belloso et al., ; alarcón et al., ; arking et al., ; bakkaloglu et al., ; friedman et al., ; kim et al., ; kirov et al., ; marshall et al., ; vri- jenhoek et al., ; zahir et al., ; bucan et al., ; rujescu et al., ; awadalla et al., ; bradley et al., ; ching et al., ; magri et al., ; mefford et al., ; wiśniowiecka-kowalnik et al., ]. however, an increased risk for variable neuropsychiatric disorders has to be considered in carrier individuals. frequency of certain mutations/copy number variations in certain patient cohorts the number of patients carrying recessive defects in cntnap or nrxn is too small to give frequencies of certain mutations/copy number variations. in the amish population, specific stop mutation c. delg in the c- terminal region of cntnap is reported [strauss et al., ]. the other published patients either harbor a ho- mozygous deletion of exons – or a compound hetero- zygous intragenic deletion of exons – and a splice site mutation in exon of cntnap [zweier et al., ]. for nrxn , to date only a deletion of exons – in com- pound heterozygosity with a stop mutation in exon is known. genotype-phenotype correlation some phenotypic differences such as lack of speech development versus regression or the presence/absence of cortical dysplasia and episodes of hyperbreathing be- tween the amish patients with the c-terminal stop muta- tion and the other patients with rather n-terminal defects in cntnap can be noted [zweier et al., ]. however, it remains currently elusive if these observations might indicate a real genotype-phenotype correlation or if they are due to clinical bias as the phenotype in the amish pa- tients was classified as an epilepsy syndrome with devel- opmental deterioration, while the other patients were ini- tially classified as having primary intellectual disability with epilepsy. references alarcón m, abrahams bs, stone jl, duvall ja, perederiy jv, et al: linkage, association, and gene-expression analyses identify cntnap as an autism-susceptibility gene. am j hum genet : – ( ). arking de, cutler dj, brune cw, teslovich tm, west k, et al: a common genetic variant in the neurexin superfamily member cntnap increases familial risk of autism. am j hum genet : – ( ). arroyo ej, xu t, poliak s, watson m, peles e, scherer ss: internodal specializations of my- elinated axons in the central nervous system. cell tissue res : – ( ). autism genome project consortium, szatmari p, paterson ad, zwaigenbaum l, roberts w, et al: mapping autism risk loci using genetic linkage and chromosomal rearrangements. nat genet : – ( ). recessive defects in cntnap and nrxn mol syndromol ; : – awadalla p, gauthier j, myers ra, casals f, hamdan ff, et al: direct measure of the de novo mutation rate in autism and schizo- phrenia cohorts. am j hum genet : – ( ). bakkaloglu b, o’roak bj, louvi a, gupta ar, abelson jf, et al: molecular cytogenetic analysis and resequencing of contactin asso- ciated protein-like in autism spectrum dis- orders. am j hum genet : – ( ). bellen hj, lu y, beckstead r, bhat ma: neurex- in iv, caspr and paranodin – novel members of the neurexin family: encounters of axons and glia. trends neurosci : – ( ). belloso jm, bache i, guitart m, caballin mr, halgren c, et al: disruption of the cntnap gene in a t( ; ) translocation family without symptoms of gilles de la to- urette syndrome. eur j hum genet : – ( ). bradley we, raelson jv, dubois dy, godin e, fournier h, et al: hotspots of large rare dele- tions in the human genome. plos one :e ( ). bucan m, abrahams bs, wang k, glessner jt, herman ei, et al: genome-wide analyses of exonic copy number variants in a family- based study point to novel autism suscepti- bility genes. plos genet :e ( ). ching ms, shen y, tan wh, jeste ss, morrow em, et al: deletions of nrxn (neurexin- ) predispose to a wide spectrum of develop- mental disorders. am j med genet b neuro- psychiatr genet b: – ( ). feng j, schroer r, yan j, song w, yang c, et al: high frequency of neurexin beta signal peptide structural variants in patients with autism. neurosci lett : – ( ). friedman ji, vrijenhoek t, markx s, janssen im, van der vliet wa, et al: cntnap gene dos- age variation is associated with schizophre- nia and epilepsy. mol psychiatry : – ( ). jackman c, horn nd, molleston jp, sokol dk: gene associated with seizures, autism, and hepatomegaly in an amish girl. pediatr neu- rol : – ( ). kim hg, kishikawa s, higgins aw, seong is, donovan dj, et al: disruption of neurexin associated with autism spectrum disorder. am j hum genet : – ( ). kirov g, gumus d, chen w, norton n, geor- gieva l, et al: comparative genome hybrid- ization suggests a role for nrxn and apba in schizophrenia. hum mol genet : – ( ). li j, ashley j, budnik v, bhat ma: crucial role of drosophila neurexin in proper active zone apposition to postsynaptic densities, synap- tic growth, and synaptic transmission. neu- ron : – ( ). magri c, sacchetti e, traversa m, valsecchi p, gardella r, et al: new copy number varia- tions in schizophrenia. plos one :e ( ). marshall cr, noor a, vincent jb, lionel ac, feuk l, et al: structural variation of chromo- somes in autism spectrum disorder. am j hum genet : – ( ). mefford hc, muhle h, ostertag p, von spiczak s, buysse k, et al: genome-wide copy num- ber variation in epilepsy: novel susceptibility loci in idiopathic generalized and focal epi- lepsies. plos genet :e ( ). missler m, südhof tc: neurexins: three genes and products. trends genet : – ( ). missler m, zhang w, rohlmann a, kattenstroth g, hammer re, et al: alpha-neurexins cou- ple ca + channels to synaptic vesicle exocy- tosis. nature : – ( ). orrico a, galli l, zappella m, lam cw, bonifa- cio s, et al: possible case of pitt-hopkins syn- drome in sibs. am j med genet : – ( ). peippo mm, simola ko, valanne lk, larsen at, kähkönen m, et al: pitt-hopkins syndrome in two patients and further definition of the phenotype. clin dysmorphol : – ( ). poliak s, salomon d, elhanany h, sabanay h, kiernan b, et al: juxtaparanodal clustering of shaker-like k+ channels in myelinated ax- ons depends on caspr and tag- . j cell biol : – ( ). rujescu d, ingason a, cichon s, pietiläinen op, barnes mr, et al: disruption of the neurexin gene is associated with schizophrenia. hum mol genet : – ( ). strauss ka, puffenberger eg, huentelman mj, gottlieb s, dobrin se, et al: recessive symp- tomatic focal epilepsy and mutant contactin- associated protein-like . n engl j med : – ( ). verkerk aj, mathews ca, joosse m, eussen bh, heutink p, et al: cntnap is disrupted in a family with gilles de la tourette syndrome and obsessive compulsive disorder. geno- mics : – ( ). vrijenhoek t, buizer-voskamp je, van der stelt i, strengman e; genetic risk and outcome in psychosis (group) consortium, et al: recurrent cnvs disrupt three candidate genes in schizophrenia patients. am j hum genet : – ( ). wiśniowiecka-kowalnik b, nesteruk m, peters su, xia z, cooper ml, et al: intragenic rear- rangements in nrxn in three families with autism spectrum disorder, developmental delay, and speech delay. am j med genet b neuropsychiatr genet b: – ( ). zahir fr, baross a, delaney ad, eydoux p, fer- nandes nd, et al: a patient with vertebral, cognitive and behavioural abnormalities and a de novo deletion of nrxn alpha . j med genet : – ( ). zweier c, de jong ek, zweier m, orrico a, ous- ager lb, et al: cntnap and nrxn are mutated in autosomal-recessive pitt-hop- kins-like mental retardation and determine the level of a common synaptic protein in drosophila . am j hum genet : – ( ). conflict resolution among peaceful societies: the culture of peacefulness conflict resolution among peaceful societies: the culture of peacefulness author(s): bruce d. bonta source: journal of peace research, vol. , no. (nov., ), pp. - published by: sage publications, ltd. stable url: http://www.jstor.org/stable/ . accessed: / / : your use of the jstor archive indicates your acceptance of the terms & conditions of use, available at . http://www.jstor.org/page/info/about/policies/terms.jsp . jstor is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. we use information technology and tools to increase productivity and facilitate new forms of scholarship. for more information about jstor, please contact support@jstor.org. . sage publications, ltd. is collaborating with jstor to digitize, preserve and extend access to journal of peace research. http://www.jstor.org this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/action/showpublisher?publishercode=sageltd http://www.jstor.org/stable/ ?origin=jstor-pdf http://www.jstor.org/page/info/about/policies/terms.jsp http://www.jstor.org/page/info/about/policies/terms.jsp ? journal of peace research, vol. , no. , , pp. - conflict resolution among peaceful societies: the culture of peacefulness bruce d. bonta general reference section, pennsylvania state university libraries the literature about peaceful peoples was examined to determine if their ways of conflict resolution differ from the approaches to conflict found in other, more violent, societies. while the strategies for managing con- flicts employed by these peoples are comparable to those used in many other small-scale societies, their world- views of peacefulness and the structures they use to reinforce those world-views do distinguish them from other societies. several common notions about conflict and conflict resolution that are asserted by western scholars can be questioned in light of the success of these societies in peacefully resolving conflicts: namely, that violent con- flict is inevitable in all societies; that punishment and armed force prevent internal and external violence; that political structures are necessary to prevent conflicts; and that conflict should be viewed as positive and necess- ary. the contrary evidence is that over half of the peaceful societies have no recorded violence; they rarely punish other adults (except for the threat of ostracism); they handle conflicts with outside societies in the same peaceful ways that they approach internal conflicts; they do not look to outside governments when they have internal dis- putes; and they have a highly negative view of conflict. . introduction and forgive us our trespasses as we forgive those who trespass against us. from 'the lord's prayer' nyam, the articulate son of a former headman, had been accused of planting durian trees on lands that traditionally belonged to others. in recent years the semai, peaceful aboriginal people who live in the rugged mountains of the malay peninsula, have been harvesting durian fruit and packing it out to the road which comes up from the lowlands, so they can sell it and buy the consumer goods that have become essential to them - tobacco, machetes, radios, and so forth. planting trees on other properties threat- ened and angered nyam's neighbors, some of whom belonged to different families. tensions were mounting. tidn, the headman of the village affected by nyam's actions, recognized the potential for conflict so he convened a becharaa', a proceed- ing which the villagers use to try to resolve dis- putes. nyam and his relatives were invited to attend to discuss and settle the matter. since his land also had been invaded by nyam, tidn was a party to the dispute; he invited entoy, head- man from a nearby valley, to preside over the becharaa'. nyam arrived near dusk at the semai village. conversation was casual, as everyone was well acquainted and was generally familiar with the nature of the conflict. nyam, a picture of studied indifference, talked animatedly with various people. after a while, the villagers gathered in a circle and the formal discussions began with preliminary speeches about the im- portance of settling the dispute before it got out of hand. each of the parties to the conflict gave his version of events, justifying his actions in an unemotional manner. nyam denied some of his trespasses and sought to rationalize others. speakers advanced their points of view, but no one acted as witnesses except for the principals in the case; there was no direct confrontation or cross-examination. the speeches went on and on, with people frequently talking past one another and not answering the comments of others. when no one had anything more to say - points had been emphasized and re-emphasized until all were exhausted from the proceedings - the becharaa' was ready to be concluded. it was obvious to everyone that nyam's actions were wrong, but the consensus was that he could keep and use the trees that he had already planted, though he must plant no more. entoy could have levied a small fine on nyam but everyone felt it was more important for the group to keep its harmony than to treat the guilty party too roughly. entoy lectured the assembled people on the importance of their tradition of unity, this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp bruce d. bonta peacefulness, sharing food, and not fighting. he made it clear to all that the matter had been completely settled and that no one was allowed to bring it up again (robarchek, , , ). contrast that scene reported in the anthropol- ogy literature with a comparable one from the legal proceedings of pennsylvania. for two years charles peterman leased acres of farm land in columbia county, pennsylvania, but a crop of winter wheat which he planted the sec- ond fall could not be harvested before the lease expired the following april. late the next spring, peterman tried to harvest his grain any- way, despite being warned away by the agent of the owner; when he continued to enter the land, the agent had him arrested. the matter soon reached the court of quarter sessions in the county seat of bloomsburg, where peterman was found guilty of criminal trespass. he ap- pealed his conviction to the superior court of pennsylvania, which reversed the ruling of the lower court (commonwealth v. peterman, ). the ways that conflicts are handled in pennsylvania courthouses differ significantly from the approaches the semai take with their becharaas', though the latter may have a super- ficial resemblance to american trials: the semai are most concerned with resolving con- flicts peacefully, while americans are primarily focused on fulfilling justice. everyone in the semai village knows the parties to a conflict and are already familiar with the facts; if a case in pennsylvania goes to a formal jury trial, the ju- rors must have no previous knowledge of the parties or the case. the parties to a conflict in the us usually hire attorneys to present their ar- guments aggressively; the semai present their own positions without confrontation or aggres- siveness. near the conclusion of the proceed- ings, the pennsylvania judge explains the legal issues to the jury and tells them that their role is to decide the truth of what happened; the semai headman lectures the whole village on the over- riding importance of the peaceful resolution of the conflict. punishment is the normal conclu- sion of the us trial; it is relatively unimportant to the semai. and finally, at the end of the becharaa', the semai headman prohibits any further consideration of the case, since it has been thoroughly resolved; the pennsylvania cit- izen is free to appeal his conviction, as peterman did. the important point in the us courtroom is winning; the major issue for the semai is resolving the conflict, removing the emotions from the parties to the dispute, and reaffirming correct, peaceful behavior. the lives of their children and grandchildren depend on it, they believe (robarchek, , , ). while these brief, simplified sketches repre- sent only a couple of the many ways that societies resolve disputes, they do illustrate fun- damental differences in perceptions of conflicts, resolution of disputes, and tolerance for viol- ence. the semai are among more than so- cieties that have evolved highly peaceful lifestyles, that rarely if ever resort to violence; us citizens are among the thousands of soci- eties that do use violence, if need be, to settle their differences. the processes of settling dis- putes in the usa, such as the jury trial, are based on assumptions about conflict that differ from those of the peaceful societies. the goal of this article is to explore those differences. the basic issue is to gain an understanding of why dozens of peaceful peoples are able to resolve conflicts nonviolently virtually all the time, while the rest of the world is not so successful. as the examination of conflict resolution in these small-scale societies proceeds, one funda- mental fact emerges: the peacefulness of their conflict resolution is based, primarily, on their world-views of peacefulness - a complete rejec- tion of violence. that argument may appear to be circular, but a careful look at conflict resol- ution in those societies seems to support it. in contrast, the western world-view boils down to an acceptance of the inevitability of conflict and violence. peace and conflict studies, for western scholars, is frequently a process of understanding the reasons for conflict, and the study of conflict resolution often focuses on strategies for preventing and resolving dis- putes. some of the major facets of western be- liefs that will form a framework for this essay include the following concepts: ( ) all societies have violent conflict and warfare (boulding, ; deutsch, ; knauft, ); ( ) pun- ishment deters internal conflicts and violence (greenawalt, ); ( ) the threat of armed force helps prevent external conflicts and viol- ence (brown, ; ceadel, ); ( ) conflict is best managed through reliance on political this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp conflict resolution among peaceful societies structures such as governments (boulding, , p. ); and ( ) conflict has many positive functions, and as long as it is managed properly it should be viewed as normal, reasonable, beneficial and helpful (augsburger, ; deutsch, ), or at least neither desirable nor undesirable (nader, ; ross, b). the purpose of this investigation is therefore to examine conflict and conflict resolution among the peaceful societies and to compare them with the corresponding western beliefs. since much of the literature of conflict resol- ution is based on the experiences of the thou- sands of relatively violent societies, a balance is needed from the perspective of peaceful peo- ples. in this paper i attempt to show that conflict resolution in peaceful societies is founded on overarching world-views that conflicts are the exception, not the norm, and that they are neither reasonable nor desirable. conflicts, to these peoples, must be avoided as much as poss- ible, resolved as quickly as possible, and har- mony restored as soon as possible in order for people to live peacefully with one another and with outsiders. in order to achieve nonviolent conflict resolution in practice, individuals and groups of people should rely on themselves to settle disputes within their groups as well as conflicts with other peoples; furthermore, they should use resolution strategies that dissipate tensions as well as settle the issues. this resol- ution should be achieved as much as possible without the threat of punishment (other than os- tracism). before getting to the information about peaceful societies and the reasons they provide a challenge to western thinking about conflict resolution, it is necessary to pause a moment, define terms, and introduce some basic under- standings. . background and definitions peacefulness is a condition of human society characterized by a relatively high degree of in- terpersonal harmony; little if any physical viol- ence among adults, between children and adults, and between the sexes; workable strategies for resolving conflicts and averting violence; a commitment to avoiding violence (such as warfare) with other peoples; and strategies for raising children to adopt and continue these nonviolent ways. a people or a society (those terms are used in- terchangeably, for variety) is a group of human beings who share a common ancestry for the most part, who share common beliefs and cul- tural value systems, and who primarily live in the same area. the peoples.: evidence demonstrates that a modest number of societies have developed highly, and in some cases totally, nonviolent social systems. several writers have provided different, but overlapping, lists of these peace- ful, peaceable, nonviolent, or low-conflict soci- eties (e.g. bonta, ; fabbro, ; howell & willis, a; montagu, ; ross, a; sponsel & gregor, ). the peoples included in this paper are based on the peace- ful societies included in bonta ( ); these were selected because there is at least some information about their styles of conflict resol- ution in the literature. most of the societies dis- cussed here are far from being utopias: many of them are plagued by the same jealousies, gossip, resentments, and backbiting as the rest of hu- manity (see robarchek, , p. ). some have social and cultural practices that would repel outsiders; they vary greatly from one to the next. the common denominator among all of them is that they are able to resolve their con- flicts peacefully, and that they fit the definition of peacefulness as given above. some are pri- marily hunting and gathering peoples; others rely mostly on shifting cultivation (swidden agriculture); others are settled farmers and are very much a part of the modern, world-wide trading society. these societies are listed in the appendix, with a brief paragraph describing each one. conflict is variously defined by scholars. some think of it in economic terms, such as 'a phenomenon that necessarily implies scarcity' (padilla, , p. ), or as an 'incompatibility between the preferences or goals of two or more parties' (schmidt, , p. ), or as the exist- ence of incompatible activities (deutsch, , p. ). these definitions do not go far enough, so conflict is defined here as: the incompatible needs, differing demands, contradictory wishes, opposing beliefs, or diverging interests which produce interpersonal antagonism and, at times, hostile encounters. conflict situations thus range from antagonist behavior to verbal abuse to physical violence to, ultimately, killing. this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp bruce d. bonta conflict resolution among peaceful peoples is the settlement or avoidance of disputes between individuals or groups of people through sol- utions that refrain from violence and that at- tempt to reunify and re-harmonize the people involved in internal conflicts, or that attempt to preserve amicable relations with external societies. basic understandings: a few basic under- standings must be introduced before proceeding any farther. first of all, while the peaceful societies are quite different from one another, they can be grouped together for this analysis because they do share at least one major charac- teristic: they rarely, if ever, have violent con- flicts. also, comparing conflict management in widely differing cultures is risky, though ross ( a) is confident that the shared features of conflict resolution in different cultures can be analyzed successfully. and while conflict resol- ution is commonly practiced by almost all soci- eties (sponsel, ), the unifying feature of nonviolence among the small group of peaceful peoples makes the study of their strategies and attitudes toward peace particularly worthwhile. another caveat: this work is not based on statis- tical research about cross-cultural peacefulness. social scientists doing research on conflict (e.g., ember & ember, ; ross, b) often use statistically valid samples of cultures, such as from the human relations area files, but this essay does not follow that approach. it is based, instead, on a careful examination of the litera- ture about all of these societies: a sampling would not have served the purposes of the in- vestigation. . strategies of conflict resolution the peaceful societies use a variety of strat- egies to try to prevent, control, manage, and re- solve the conflicts that do come up, such as the semai becharaa' that was mentioned at the opening of this paper. an examination of these various strategies provides an overview of the common processes used by these peoples to re- solve conflicts, and helps set the stage for the discussion that follows. unfortunately, there is no standard listing of conflict-resolution strat- egies, which have been described in many ways (e.g., takie sugiyama lebra, as described by augsburger, , pp. - ; boulding, ; lederach, ; le vine, ; ross, a and scimecca, ). since a commonly- agreed upon list of strategies is not available, it seemed best to look directly at the literature on the peaceful peoples and see what common strategies are suggested there. the following six are suggested by the literature. . self-restraint the literature explicitly describes the ways that the ifaluk (lutz, ), tahitians (levy, ), paliyan (gardner, , , ), and toraja (hollan, ) use variations of self-re- straint as a means of moving away from conflict situations once they arise. (their approach is doubtless followed by other peaceful societies, such as the amish, mennonites, and hutterites, though the literature about those peoples is not as explicit on the subject.) these peoples feel that heightened emotional states lead quickly to further trouble, so they actively try to dissipate their emotions whenever a conflict seems poss- ible. a first-stage approach for a toraja individ- ual experiencing heated emotion is to remind himself or herself that any open expression of the feeling might be dangerous: the expression of such feelings would be ridiculed, might lead to hostile supernatural actions, and would open oneself to serious illness (hollan, ). . negotiation negotiation is often considered in a positive light by western writers (rubin, ), particu- larly when it is broadly defined as the interac- tion between parties to a dispute who work toward an agreement without the intervention of third parties who might make compulsory de- cisions (gulliver, , p. ). but the literature on the peaceful societies, other than the montagnais-naskapi (lips, ), semai (robarchek, ) and amish (cong, ), has little to say about direct negotiations by dis- putants. people in many of these societies do not want to confront one another directly, and they prefer indirection rather than assertion, infer- ence rather than confrontation. the parties to a conflict are encouraged to settle their problems on an internal level, through self-restraint, but not necessarily through the confrontational tac- tics of direct negotiation. other techniques are more effective. this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp conflict resolution among peaceful societies . separation at least ten of the peaceful societies separate in order to avoid conflicts (which is equivalent to resolving them). clearly, walking away from a dispute is one of the most favored ways of re- solving conflicts among these peoples. among the malapandaram (morris, , ), paliyan (gardner, , , ), birhor (sinha, ), buid (gibson, , , ), and !kung (draper, ; lee, ), in- dividuals, including spouses, separate when a quarrel cannot be easily resolved, and whole communities will split apart to avoid conflicts. the literature about these peoples is filled with examples of individuals or whole communities moving away from an area, in some cases quite abruptly, because they faced conflicts. among the toraga (hollan, ) and balinese (howe, ), separations to avoid conflicts appear from the literature to be somewhat less perma- nent than among the other five peoples men- tioned above. the historical literature about some of the western peaceful peoples - the amish, hutterites, and mennonites - makes it clear that they moved away from domination and conflict by stronger societies numerous times. while they would doubtless not abandon their communities and flee on a moment's no- tice because of a minor conflict, there is no question that they might well move again if faced with an unresolvable conflict with the larger society. . intervention western writers on conflict resolution concen- trate heavily on the importance of third-party in- tervention in disputes (keashly et al., ; augsburger, ; fisher & keashly, ). among peaceful peoples, intervention by others is an effective technique for resolving conflicts. in several of these societies, such as the ifaluk (lutz, ), !kung (lee, ), mala- pandaram (morris, , ), nubians (femea, , ), toraja (hollan, ), zapotec (paddock, ), montagnais-naskapi (lips, ), paliyan (gardner, ), and yanadi (raghaviah, ) the ethic of avoiding conflicts is so strong that it is incumbent on by- standers to become involved in virtually any cir- cumstances where controversies threaten to be- come serious or where a conflict situation seems to be developing. among some peoples, certain individuals are noted as being particularly skilled at helping defuse conflicts, but in others the literature indicates that any bystander will step in to mediate. the common thread of these mediators is their desire to get a dialogue going - and keep the potential contestants talking until the tensions are defused. . meetings humor and meetings, such as the semai becharaa' mentioned earlier, are specific tech- niques used by third parties, but they deserve to be mentioned separately because they are fre- quently used by several peaceful societies. as with the other strategies, the purpose of the meeting is to lessen tensions more than it is to confront or decide, though those elements may also be present. these meetings provide forums for the airing of hostilities: frequently the simple discussion of grievances is enough to defuse problems. the meetings also serve to contain conflicts before they can disrupt society, either by minimizing issues as private rather than public concerns, or by restricting involve- ment in order to allow informal mechanisms of social control to operate. meetings are used heavily, as a major part of the strategy for re- solving conflicts, by the birhor (sinha, ), buid (gibson, , ), ladakhis (norberg- hodge, ), zapotec (o'nell, , and nubians (femea, ; callender, ). . humor humor is undoubtedly a useful strategy for re- ducing tensions and resolving conflicts in many societies, but it has been mentioned only a few times in the literature of peaceful peoples. the !kung (marshall, ) try hard to maintain a joking atmosphere in their camps, frequently pointing out one another's faults in a facetious manner to resolve their tensions. when a leader in a paliyan community becomes involved in helping to resolve a conflict, he will often use joking or soothing to defuse the situation (gardner, ). if a tristan islander ever lost his temper in a quarrel he would have that scar on his reputation for life; people who defuse tense situations with jokes gain general respect (munch, ). the inuit joke to avoid and defuse conflicts; joking also allows them to con- front problems with enough ambiguity that this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp bruce d. bonta grievances can be aired without fear of provok- ing others (briggs, ). in the past, the inuit had song duels to resolve conflicts in a humor- ous fashion before they became serious enough to provoke violence, and to laugh off animosi- ties and return to friendship, or at least restraint (eckert & newmark, ). these strategies seem to dissipate tensions and resolve issues effectively when conflicts do arise in the peaceful societies. in some societies authority figures make judgments while in others the people decide by consensus, but the overall effect is the same - healing, continuation of the community, or separation. furthermore, the traditional forms that those strategies take among these peoples appear to be important fac- tors in their success. that is, peoples are con- scious of their own traditional ways of handling problems and seem able to keep the peace in part through the force of their traditions. for these peoples, the ways they resolve disputes are logical and effective - and they seem to work. when the traditional ways are not used, conflicts can result. for instance, the failure of a group of buid to follow their traditional meet- ing-style of conflict resolution (called a tul- tulan) on one occasion resulted in tragedy (gibson, ). . conflict is a normal aspect of all societies some scholars have maintained that conflict and violence is the normal condition of small-scale societies, which typically rely on a superior state authority to prevent warfare (ferguson, , pp. - ). others argue that all societies have to contend with violence (knauft, , ). the literature on the peaceful peoples flatly contradicts these assertions. while viol- ence exists in very modest amounts in some of these societies, in others it appears to be rare or completely absent. there are a few basic differences in strategies for resolving conflicts among these societies. some of the ones that experience occasional vi- olence use moderately aggressive techniques for resolving disputes, such as stylized rhetorical speaking referred to as 'talking' by some an- thropologists. when the !kung are discussing a contentious issue and their emotions begin to rise, they may pour out their thoughts at a very rapid rate - a sudden, spontaneous discussion by the various people involved with the issue (marshall, ; lee, ). when the g/wi have a conflict that is threatening to escalate, one party to the problem will talk out the diffi- culty to a third person within the hearing of the whole band, and the other party may answer to a fourth, again so everyone will hear (silberbauer, ). when the temair become too angry for mediation to work, instead of a face-to-face confrontation the angry people may conduct night time harangues so everyone in the longhouse can hear without specifically naming individuals (roseman, ). these practices allow everyone to be a party to the dispute, to get feelings about an issue into the open without provoking direct confrontations, and to settle the contentious issues. they also save face for all participants, a universal need according to some (augsberger, ). on the other hand, many of the societies that almost never experience any violence tend to be meek and to have world-views that advocate meekness. for instance, the highly peaceful chewong, ifaluk, paliyan, and semai generally describe themselves as fearful people; the batek, chewong, paliyan, and semai flee from violence; and the amish, hutterites, chewong, semai, tristan islanders, and yanadi are no- table for their belief in nonresistance (not resisting aggression by the state or other indi- viduals). but, while the most highly peaceful peoples are strongly characterized by a general fearfulness, passiveness, meekness, flight from conflict, and a belief in nonresistance, the soci- eties which appear to take a more active role in promoting peacefulness do have patterns of oc- casional violence. there are elements of aggres- siveness in these peoples - perhaps it could be described as an aggressive pursuit of non- violence in resolving conflicts. . punishment deters conflict and violence western peoples believe that punishment is necessary to deter crime and violent conflict. they feel it creates fear in potential offenders that they will suffer as a result of their actions, and it is a just retribution for violations of the normal moral order (greenawalt, ). it seemed reasonable to look for evidence of pun- ishment in the literature about these societies to see if it is part of their conflict resolution this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp conflict resolution among peaceful societies practices. as it turns out, except for the punish- ment that parents in a few of these societies use for disciplining their children, these peoples use very little adult punishment. in fact, the absence of punishment appears to be one of the defining characteristics of a peaceful society. these peo- ples seem to rely on the strength of their other mechanisms to prevent and resolve conflicts peacefully and effectively. the threat of punish- ment is not needed, except for the practice of os- tracism, a form of punishment. ostracism is practiced by a range of societies worldwide to enforce social standards, according to gruter & masters ( , p. ), who define it in general terms as 'the general process of social rejection or exclusion'. from the perspective of the peaceful peoples, ostracism may be defined as complete banishment from the society or, per- haps less severely, as rejection by a people of an individual's participation in some or all of the group's activities. the societies that use it at all use it quite infrequently, but the possibility is al- ways there. probably the most dramatic practice of os- tracism in this body of literature is the amish strategy of shunning. if an amish person has a problem accepting one of the rules of their church, and he or she refuses to give in to the will of the group, the individual will be os- tracized by all members of the community, in- cluding the spouse, children, parents, siblings, and friends. no one may speak to the shunned person or hand food or other goods to him or her - food or other articles will be placed on a table for the shunned person to pick up (gruter, ; hostetler, ). the person may continue to live at home and try to carry on a normal life - though that is, of course, nearly impossible. the hutterites have a similar style of excommuni- cating members without expelling them from their colonies (hostetler, ). a comparable example can be found in ladakh, where again ostracism does not necess- arily mean the person is sent away from the community. if someone refuses to stop provoca- tive or offensive behavior, the lamas may cease serving the religious needs of the individual, which would be highly demoralizing to a ladakhi. no one would visit the ostracized per- son; no one would help the offender or his fam- ily in any endeavor; no one would offer food to, or accept food from, the individual; and there would be no possibilities of marriage alliances with other families. a harsh punishment such as that could only be relieved when the offender sought the pardon from the village civil and re- ligious leaders (norberg-hodge, ). ostracism in other societies usually means totally excluding offenders from the group - e.g., the nubians (fernea, ) - though in some cases it is done very gently. when a mem- ber of a g/wi band does not heed the consensus judgment of the group about a conflict, and when he ignores the barbed comments of others and does not mend his ways, the people may have to ease the offender out. this is done not by overt antagonism, but rather by subtly frus- trating the offender, by misunderstanding his wishes on purpose, by not hearing him: by, in effect, rejecting him without causing him to feel rejected or offended. the process prompts the offender to feel disgusted with his life in the band, so that he'll leave of his own accord with- out feeling a need for revenge. sometimes the offender will find another band to be more com- patible and will settle into acceptable behavior patterns. some g/wi, of course, never adapt and move about from band to band, accepted by all as individuals who have to be tolerated for a time (silberbauer, ). . armies are necessary to deter external conflict many western writers maintain that the exist- ence of armies and the threat of military force is the only thing that keeps the peace between nations. states would invade one another con- stantly in their egocentric drives to acquire more territory, goods, trade markets, resources, and security, according to this argument, if it weren't for the certainty that the invaded state would fight back (brown, ; ceadel, ). this kind of argument is also extended to peace- ful societies, which, it is argued, exist only in re- lation to, and through the sufferance of, more aggressive neighboring societies. these peace- ful peoples must have relatively peaceful neigh- bors, live where they are relatively isolated from attack, live where flight from attack is a reason- able option, or be much stronger than potential attackers so that others wouldn't dare try an at- tack (argument and literature summarized by ross, a, pp. - ). some of the peaceful societies under this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp bruce d. bonta consideration here follow this generalization, at least superficially. the problem with the idea is that it views the relationship of the nonviolent society and the aggressive society only from the perspective of the latter: the peaceful society must be isolated from the strong society or it can't exist; it must be able to flee quickly from an attack by the neighboring violent people or it would quickly be destroyed. the literature on these peoples and their relationships with dominating societies provides insights into this issue of peaceful peoples getting along with ag- gressive peoples - and it allows the simple gen- eralizations to be challenged. some of the peaceful societies fit those stereotypes but others do not. clearly, a few of the peoples live in very isolated locations, such as the ifaluk and the tristan islanders, who inhabit, respectively, is- lands in the pacific and atlantic oceans. other societies, such as the paliyan (gardner, , ), semai (dentan, a), batek (endicott, ), malapandaram (morris, ), buid (gibson, , ), and chewong (howell, , ) solve problems with outsiders, par- ticularly with more powerful outsiders, by flee- ing from danger. at the first sign of conflict, these peoples will abandon their villages and melt back into the forest, where they may stay for weeks or even years. but it is a mistake to assume that their relationships with their more powerful neighbors or the nations that they live in can be characterized only by isolation or flight from danger. they take their nonviolence seriously - as a positive approach to human re- lationships and as the basis of their lives - and avoiding conflict is only part of their logic. conflict resolution, such as the semai becharaa', is more complex and ingenious than the simple term 'separation' would imply. the semai are highly committed to their peaceful ways, and they try hard to resolve conflicts with their more powerful neighbors, the malay people, nonviolently. they have been invaded, dominated, and enslaved by the malays for a long time (endicott, ; robarchek, , pp. - ), but they still agonize over the di- lemma of how to continue to maintain their own ethic of peacefulness in the face of this domi- nation (robarchek, , pp. - ); they do not easily accept the ethic of the aggressor (dentan, ). a number of the peaceful peoples do have frequent contacts with outsiders and have been able to maintain their peacefulness despite it. the literature on these peoples suggests that they are able to get along with larger and more aggressive societies. not all conflicts with people and government officials from outside their societies can be avoided, of course, yet they handle conflicts with outsiders in a similar fashion to their handling of internal conflicts - i.e., peacefully. for instance, the anarchistic tristan islanders historically disliked the idea of any outside in- stitutional authority in their midst, but they have always had a knack for resolving conflicts with outsiders in a highly deferential, but still quite effective, fashion. in the late s an english minister on the island tried to run the lives of the people in an imperious, dictatorial manner, which the islanders didn't care for. he estab- lished a storehouse over which he exerted absolute control, in an attempt to bend the is- landers to accepting his will. the tristan islanders never got to the point of openly con- fronting the minister, however, since they could not endure the strain of confrontation with him; they would buckle under to his will with a meek 'yes, father', out of respect for his power and high office. they accepted his orders if they couldn't avoid them, to placate him and ignored everything else that they could get away with. they felt that his antics in trying to run their lives were simply part of the fun he enjoyed being among them. besides, they realized that in a few years he would be replaced by another minister who would have different ideas (munch, ). in the early s the entire population of tristan da cunha was brought to great britain by the british government when a volcano on the island threatened to destroy the settlement. however, when the government decided to make the evacuation permanent, the islanders united for the first time in their history to ex- press their feelings. they affirmed their belief that people should not control the lives of others; they agreed on a dislike for the ag- gression and self-assertion that they witnessed in britain; and they recognized that the violence in british society was too different from their own nonviolent culture for them to tolerate. they decided to return to their island on their this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp conflict resolution among peaceful societies own. faced with this determination, and with a lot of criticism in the media, the colonial office backed down and agreed to return them to tristan da cunha (munch, ). the tristan islanders succeeded in resolving the conflict with the government by confronting it in the most unobtrusive and peaceful manner they could figure out - by trying to find a way to get themselves back without the assistance of the government. the peaceful anabaptist peoples that live in north america - the mennonites, hutterites, and amish - have been persecuted for centuries but, like the tristan islanders, they have tried to settle conflicts with the larger societies in the same spirit of nonviolence that characterizes their internal relationships. for instance, during world war i draftees from these groups were punished, beaten, and tortured in us military prisons (unruh, ; juhnke, ), and civil- ians who refused to contribute money to the war effort through the purchase of war bonds were named in local newspapers, harassed, and physically abused by the local citizens (juhnke, ). as a result of these experiences, the con- troversial civilian public service program (cps) of world war ii (bush, ), and a range of other factors (toews, ), the basic beliefs of most mennonites in nonresistance have been slowly changing. from the s through the s mennonite commitment to 'nonresistance' (taken from matthew . , 'do not resist one who is evil'), has changed into a belief in 'peacemaking', the feeling that they have a responsibility to engage the broader american and canadian societies and work ac- tively for peace, rather than avoid outsiders as nonresistance had previously implied (driedger & kraybill, ; bush, ; nisly, ). the two other anabaptist peoples, the hutterites and the amish, have not developed a spirit of engaging the larger societies of the usa and canada as the mennonites have done; but they still have conflicts or the threats of con- flicts with outsiders to deal with. the hutterite colonies try to prevent conflicts from arising by fostering frequent contacts with their farming neighbors and by generous exchanges of farm produce (bennett, ). the amish have prob- lems resolving individual conflict situations with outsiders since they cannot file lawsuits against others - that would violate their belief in nonresistance. business competitors, buyers, and suppliers, knowing of that prohibition, take advantage of them by cheating and exploiting them (kraybill, ). much as they say they do not deal with the outside society, in fact the amish have devel- oped a pattern of adjustments to external con- flicts. non-amish leaders and supporters of the amish help them informally to resolve their conflicts with outsiders in positions of power and influence, sometimes through helpful advo- cacy, sometimes through finding creative sol- utions to their problems. if an amishman were taken into court, he would never contest charges and hire an attorney because of his belief in non- resistance, but an attorney friend might go along, just to sit there and make sure the courts acted fairly. the lawyer would not be paid, but the amish would give him some garden vegetables or freshly baked bread. when the pennsylvania government passed a new state requirement that all teachers had to be certified and had to meet minimum educational require- ments, which the amish teachers in their one- room schoolhouses couldn't do, the amish got around the regulation by declaring that all their teachers were substitutes, and thus exempt from the regulation. the rural amish people have little concern or interest in these pressures, counterpressures, and maneuverings - they be- lieve in nonresistance and, if necessary, mi- gration to avoid problems. even their leaders do not frame their advocacy in the terms of the out- siders: rather, they see their activity as 'working things out', being helpful in resolving issues, and liberating officials from their constant need to obey rules (kidder & hostetler, ). while their strategies are not precisely the same as those of the tristan islanders, the similarities are striking. conflicts with outsiders are thus resolved by peaceful peoples in a variety of ways, but the conclusion from these examples is that armies, killing, or other forms of violence are never part of their thinking, as they are to the rest of the world. the non-western peaceful peoples like- wise, such as the yanadi (raghaviah, ), try to resolve their conflicts with outsiders in fashions that are consistent with their overall commitments to peacefulness. the cumulative story is thus of peaceful peoples resolving con- this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp bruce d. bonta flicts with larger, more aggressive societies through meekness, active involvement, and at- tempts to resolve difficulties peacefully - in complete accord with their world-views. . conflict is best managed through political structures boulding sees conflict management as extend- ing from the family to the tribe, to the nation, to the superpower, to the evolving world govern- ment. 'conflict control is government', he writes, 'and though government has broader functions than this, conflict control is perhaps its most important single task' (boulding, , p. ). the literature about the peaceful peoples suggests that avoiding governments may also provide a viable model for peacefully resolving conflicts. in many traditional societies, people avoid calling in outside authorities and try to settle their internal conflicts themselves (just, ; nader, ). outside police are to be avoided if at all possible. the peaceful societies likewise try to keep their conflicts to themselves. the idea that an outside government or political structure is an essential part of solving their con- flicts, or would even be helpful in such situ- ations, would be alien to these peoples. they see government agencies as highly threatening and they avoid such outsiders as much as possible during conflicts, though there are some excep- tions (hollan & wellenkamp, ). for instance, a peaceful zapotec town voids having government officials involved in the af- fairs of their community since people feel that they would be treated much as any other mexican town - and they are convinced that their town is different from the rest in its oppo- sition to violence (paddock, ). likewise, nubian communities don't reveal serious prob- lems to outsiders, particularly to authorities such as the egyptian police; they feel that the best chance for their villages to survive is to be ignored by authorities (fernea, ). the amish also settle their conflicts within; an in- stance where an amish man sued his own church officials in court because he was ostra- cized (gruter, ) was exceedingly unusual. in fact, none of the peaceful peoples included in the group of , to judge by the available litera- ture, appear to rely on intervention by outside agencies of any kind, with the possible excep- tion of the mennonites, many of whom today no longer feel the strict need to remain absolutely separate from all government functions, par- ticularly in canada (driedger & kraybill, ). in the peaceful societies, conflicts are handled by the individual parties to the conflict and by the group - rarely by outsiders. individuals are expected to deal with conflict situations by walking away from them, by laughing them off, by displacing their feelings of anger in various ways, by smiling and being pleasant to every- one, by actively socializing with people with whom they may have unpleasant inner feelings, and so on. individuals should try to solve their problems internally if they can. when that doesn't work, the parties to a con- flict should resolve the issues between them- selves, or, more frequently, bring them to larger groups of people or authority figures within the society for discussion and resolution. but even group resolutions of conflicts, such as the semai becharaa', rely on the group to foster the dissi- pation of tensions so that individual, personal controls may keep the peace. none of these so- cieties rely on the power of people as a political body to enforce the peace, with the sole excep- tion of the threat of ostracism. but if the ulti- mate approach to resolving difficult conflicts for western peoples is outward, to the next larger political or governmental body, as boulding as- serts, the ultimate focus for the peaceful peoples (and many other traditional societies) is inward, towards individuals and the group. . world-view of conflict resolution 'conflict is ... inevitable in human life .... eliminating conflict is clearly impossible, and likely undesirable, because of the close link be- tween conflict and creative, constructive change' (augsburger, , pp. , ). two decades earlier, deutsch ( ) expressed simi- lar ideas, and popular writers often reflect this thinking: 'conflict is a necessary part of every marriage.... if there is no conflict... it is a sign that something is wrong with the marriage' (warren, ). other scholars (e.g., ross, b; nader, ), though not necessarily so enthusiastic about conflict as those writers, con- sider it simply a cultural behavior, and as such this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp conflict resolution among peaceful societies not to be judged desirable or undesirable. these ideas reflect the predominant world-views of western societies that proclaim the ideology of love, peace, cooperation, and generosity, but ac- cept conflict, aggression, competition, and viol- ence as inevitable aspects of human nature and human societies. conflict resolution, in this view, is just a process - a strategy or series of strategies for settling disputes. such attitudes toward conflict would not be shared by peaceful peoples. while many of them would recognize that conflict is a problem at times in their societies, none would see it as beneficial. the purpose of this section is to look at the (mostly) positive ways these peaceful so- cieties view their lack of conflict - their world- views of peacefulness - and to compare those views with the thinking of western writers. to start with some western thinking, scholars using cross-cultural data have sought to explain the phenomenon of conflict and conflict resol- ution based on either the structural factors in so- cieties or on psychological/cultural elements (ross a, b). the social structural analysis concentrates on economic, political and social organization as the source of conflict; the psy- chocultural approach focuses on deep-seated 'we-they' conceptions of human opposition. the former argues that stronger ties, such as kinship, will reduce conflicts, while the latter sees ambiguity in social actions, and thus tries to explain why some disputes are far more in- tense than others. based on his own extensive cross-cultural analysis, ross feels that both have validity: psychocultural factors may determine the intensity of a conflict, while structural fac- tors may point out the targets of hostile actions and the ways conflicts are organized. he argues that low-conflict societies are characterized by both a psychocultural atmosphere of warmth and affection and cross-cutting social structures (ross, a). these arguments, and the impressive amount of cross-cultural data assembled, make a lot of sense but are not completely supported by the literature on peaceful societies. ross's descrip- tion ( a, pp. - ) of the strong sense of interpersonal trust that exists in low-conflict so- cieties, with a corresponding lack of fear of iso- lation and abandonment, is contradicted by briggs's ( , a, , ) writings on peaceful inuit groups, lutz's ( , ) descriptions of the ifaluk, wikan's ( ) work on the balinese, and other writings about non- violent peoples. these societies try to eliminate expressions of anger and aggression by devel- oping fears, anxieties, and uncertainties in chil- dren about other people. if others are not to be depended on to love them, if affection and sup- port can never be taken for granted, the children internalize a constant need to live up to the society's peaceful values. aside from that, ross's theory of the culture of conflict is impressive, but his bias is similar to other western thinkers - that conflict is in- evitable, though it can be managed better. his choice of terminology reflects his thinking: he frequently refers to 'the culture of conflict', the title of one of his works ( b); yet nowhere in either volume does he use the phrase, 'the cul- ture of low conflict'. conversely, he refers to a group of five peaceful societies as 'low-conflict societies', but he does not refer to other, more violent, peoples as 'high conflict' or even 'nor- mal conflict' societies. conflict is normative, in this view, while the lack of conflict is the ex- ception. of course, the literature on a wide range of peoples, such as ross has studied, does show that conflict is normative, and 'low-con- flict' societies are the exception. but - and this is the critical point - viewed from within the literature of the peaceful societies, from the per- spective of those peoples, the 'high conflict' so- cieties are the ones that vary from their norm. perhaps this alternative norm should be called 'the culture of peacefulness', or as unesco has designated one of its new programs, the culture of peace (mayor, ). conflict resolution among the peaceful so- cieties, their culture of peacefulness, is based on more than psychocultural and social structures: just as significant are their world-views of peacefulness. gregor ( ) touches on this when he points out that the ideologies and sym- bolic values that societies hold to are also criti- cal elements in providing the basis of a peaceful (or a violent) society. deutsch ( ) makes the same point in his so-called 'crude law of social relations', namely that 'the characteristic pro- cesses and effects elicited by a given type of social relationship (e.g., cooperative or competi- tive) also tend to elicit that type of social relationship'. in other words, cooperation breeds cooperation, competition breeds compe- this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp bruce d. bonta tition. likewise, howell and willis ( b, p. ), introducing the peaceful societies included in their anthology, conclude that these peoples all place an emphasis 'on peaceful interaction among the members of the society, and this emphasis is cosmologically constructed and morally embedded in a cosmological universe of meaning'. the literature on the societies considered for this essay shows that their peace- ful conflict resolution practices are fostered by their beliefs in peacefulness, which are in turn bolstered by the successful practices. to a western analyst, 'the goal of conflict resolution is to shape new political and social arrange- ments . . . ' (kelman, , p. xi). to the members of these peaceful societies, the goal of conflict resolution is to maintain social harmony through traditional means of prompting indi- viduals to remember and act on their shared beliefs. the basic reason for peacefulness in these so- cieties is that the people are strongly opposed to actual physical violence and firmly in favor of nonviolence, in contrast to neighboring, and sometimes very similar, communities that may only pay lip service to the ideals of peace and are, in actual practice, far more violent. the peaceful peoples not only believe fervently in their world-views of nonviolence: in general, they have internalized those beliefs and adhere to them very strictly, using primarily internal controls to prevent and resolve conflicts, as has been discussed earlier. in other societies that claim they have nonviolent values, but have not really internalized them, people rely primarily on external controls for preventing and resolv- ing conflicts. for instance, several scholars have written about a zapotec town in the state of oaxaca, mexico (dubbed 'la paz'), which is much more peaceful, and experiences a lot less violence, than other nearby towns. in la paz, violence is never acceptable: people avoid problems with others, deny that they have interpersonal diffi- culties, and refuse to fight. by way of contrast, in a nearby, more violent community, even though the people talk about themselves as having a peaceful town, they rationalize that sometimes humans get violent and sometimes fighting is understandable, particularly if pro- voked by alcohol or sexual jealousies (fry, ). the semai, as indicated at the beginning of this essay, emphasize and re-emphasize their shared value of peacefulness (robarchek, ). other peoples are highly conscious of, or take active pride in, their peacefulness as the defining characteristic of their societies, e.g., the paliyan (gardner, ), nubians (fernea, ), toraja (hollan, ), mennonites (driedger & kraybill, ), malapandaram (morris, ), tristan islanders (loudon, ), and so on. even in those peaceful so- cieties in which people fear their violent nature (as they conceive it), such as the inuit (briggs, b), strongly held values promote their non- violence. in addition, the point made at the beginning of this essay can't be emphasized too strongly, that the peacefulness of these societies is not based on utopian thinking. people such as the semai do not conceive of nonviolence as an ideal they should strive for; rather, they think of themselves as nonviolent. according to dentan ( b, p. ) the semai would not describe anger as bad in the abstract; instead they would say, 'we do not get angry'. the practice of non- violence of these peoples combines their world- views of peace with a very realistic, pragmatic understanding of the results of violence (thomas, ). for instance, the anabaptist societies and the tristan islanders see a con- stant, practical benefit to themselves in main- taining their meek, non-confrontational, peace- ful relationships with each other and with outsiders. the literature on the peoples who live on the fringes of indian society - the ladakhis, paliyan, malapandaram, birhor, and yanadi - emphasizes the practical ways their economic and social structures are integrated with their peacefulness. to sum up this section, the peaceful peoples are intolerant of internal strife; they do not rationalize conflict and would not accept the possibility that violence is excusable in some circumstances. few individuals in these so- cieties would admit that, while they know they should be peaceful, sometimes they just have to use violence - that's the way humanity is. to them, other peoples are obviously violent, ag- gressive, and filled with conflicts and warfare; but they themselves are peaceful and highly conscious of it. peacefulness is an absolute commitment for them. most of their social, reli- gious, mythical, cultural, psychological, and this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp conflict resolution anmong peaceful societies educational beliefs are derived from this world- view of their own peacefulness. . conclusion attitudes about conflict and approaches to con- flict resolution among of the earth's peaceful peoples differ from those of the other societies on earth. personal development and social life in the peaceful societies is based on striving for - and achieving - an absence of conflicts and violence. people in most of these societies do not view conflict as normal and productive, as westerners often do; they view it as harmful and destructive. they avoid all types of conflicts if they possibly can, and if they can't they almost always resolve them quickly and nonviolently. while these peoples resolve conflicts by using techniques that other societies also use, they emphasize certain strategies in unique ways. for instance, direct negotiation between the parties to a dispute, an important approach in western societies, is not used too often by the peaceful peoples. instead of negotiating, most of them rely on self-restraint to prevent conflicts and to help people settle the disputes that do arise. people in many of the peaceful societies prefer to avoid controversy, to walk away from conflicts, to separate families or communities in order to circumvent hostilities. one-on-one negotiation is too confrontational for many of these peoples. also, bystanders in several of the peaceful societies will intervene enthusiastically to help resolve conflicts - a contrast to modem urban areas where strangers often fear getting involved in confrontations. a number of the peaceful societies depend on community meetings as a technique to help settle disputes, while western societies settle conflicts by relying on formal court trials to de- termine guilt or innocence, right from wrong. the peaceful community meetings exemplify the importance of preventing and resolving con- flicts, while the western belief in trials is founded on abstract conceptions of justice. also, angry individuals in several peaceful so- cieties may talk out problems without specifi- cally addressing other people - a rhetorical discussion of grievances with the community at large which does not directly confront the other parties to the problems. to repeat, in these so- cieties avoiding conflict is more important than confronting it, and resolving disputes by what- ever nonviolent means possible is the highest goal of society. however, conflict resolution in the peaceful societies relies on more than just strategies and techniques. it is based on assumptions about human relations and social patterns that are quite different from those of modern societies. for instance, people in the peaceful societies strongly believe they should avoid, and if they can't avoid then they should quickly resolve, all conflicts. they view nonviolence as absolutely essential to the proper functioning of their so- cieties. in contrast, western social scientists and popular writers believe that conflict is an in- evitable, and to some extent productive, aspect of human societies which we must learn to manage effectively. the peaceful peoples settle conflicts with outsiders by using nonviolent strategies which are quite comparable to the techniques they use for resolving internal dis- putes. western societies, in general, view force and violence as a necessary, and at times justifi- able, aspect of external relations. other ways that the peaceful societies con- trast with the rest of the world are that they do not punish those who violate social norms, ex- cept for the occasional use of ostracism; and they place very little reliance on political struc- tures larger than their own communities for achieving peace. the most peaceful of them have ideologies that encourage meekness and nonresisting behavior. most important of all, the peacefulness in these societies - and their suc- cess in resolving conflicts - is founded on world-views which include nonviolence as one of the defining characteristics of humanity. their world-views are not just ideology: they include, and integrate, psychological, social, re- ligious, and ethical structures that constantly re- inforce their shared beliefs in living peacefully. the natures of these structures, of course, vary widely among all the peaceful societies. how do the conflict-resolution strategies and beliefs of the peaceful peoples relate to the com- plex societies of today's world? on a practical level, professionals in the dispute resolution field might find some of the techniques used by these societies to be applicable at times, such as relying more on humor to defuse tensions, or placing more emphasis on building up individ- ual restraints on hostility in conflict situations. this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp bruce d. bonta but the peaceful societies exemplify a more basic lesson about resolving conflicts without violence. they demonstrate that peaceful con- flict resolution, in order to be an integral part of modern social life, must be based on a fervent commitment to nonviolence. if the examples of the peaceful peoples have any validity, nonviol- ence has to be accepted as one of the highest ideals, one of the most strongly accepted be- liefs, of today's societies. we can gain glimpses of a world which resolves conflicts nonviolently through the vision provided by the peaceful peoples: a vision of individuals who always pre- fer peaceful behavior over aggression, and who always avoid confrontation and conflict; a vision of societies which look to their widely varying ethical, religious, and social traditions to support world-views of peace; and a vision of humanity successfully building and reinforcing peaceful beliefs into nonviolent social lives. unesco has launched a comparable vision, a new culture of peace program, which seeks ways of building nonviolent world-views among nations (mayor, ): the peaceful societies discussed here should provide inspi- ration and support for unesco's work. the example of the peaceful societies cannot be extended too far - they do not provide clear answers to many of the complex issues of con- flict in today's world. the peaceful peoples do, however, provide a basis for understanding successful conflict resolution and they do in- spire a vision of a potentially peaceful world. arguments about the complexity of modem so- cieties (compared to the small-scale peaceful peoples) may try to justify conflict as inevitable, but these are rationalizations which fade under the vision of peacefulness provided by these peoples: that human societies can be peaceful, that people can build virtually fail-safe struc- tures for avoiding and resolving conflict, that punishments and armed conflicts are not es- sential for keeping the peace. the answer is for us to build, in our societies, world-views of peacefulness that are as strong as those of the peaceful peoples. this is the first step. notes . variation of the standard text of matthew . , used in some protestant churches such as the episcopal, methodist, congregational, and others. . i have served twice on criminal court juries, and i base this description of a pennsylvania trial on those experi- ences. . it would be ideal to include in the rest of this essay more descriptions of ethno-concepts such as the semai becharaa'; the analysis to be presented would be con- siderably enriched by looking at peacefulness primarily through the languages of the peoples themselves. unfortunately, that is not possible: there is not enough space to add the additional discussions, and many of the works about these societies are not enriched by that level of detail. . this is not meant to demean the work of researchers within the western tradition on war, conflict, and conflict resolution - much of it is immensely valuable. my point is to argue for a peaceful basis of understanding conflict. . the definitions of 'peacefulness' and 'people' or 'society' are taken from bonta ( ) with some updat- ing and modifications. . the present tense is used throughout this article for peo- ples discussed in the anthropological literature, even though the information may or may not be current; the past tense is used for references that are from the histori- cal literature. . i would define 'world-view' as a system of thoughts and emotions about individual, social, and spiritual life which includes the human actions guided by those thoughts and emotions, while 'ideology' is a system of beliefs which may or may not influence individual acts. . see bonta ( ) for a listing of the literature. . in some of these societies, on rare instances murderers or dangerously insane individuals have been killed by other members of their groups. the people evidently felt they had no other ways to handle these dangerous situations. references augsburger, david. w., . conflict mediation across cultures: pathway's and patterns. louisville, ky: westminster/john knox. bennett, john w., . hutterian brethren: the agricultural economy and social organization of a communal people. stanford, ca: stanford university press. bonta, bruce d., . peaceful peoples: an annotated bibliography. metuchen, nj: scarecrow. boulding, kenneth e., . conflict and defense: a general theory. new york: harper & row. briggs, jean l., . 'the origins of nonviolence: inuit management of aggression', pp. - in ashley montagu, ed., learning non-aggression: the experience of non-literate societies. new york: oxford university press. briggs, jean l., a. 'the creation of value in canadian inuit society', international social science journal, vol. , no. , pp. - . briggs, jean l., b. aspects of inuit value socialization. ottawa: national museums of canada. briggs, jean l.. . 'in search of emotional meaning', ethos, vol. , no. , march, pp. - . briggs, jean l., . 'expecting the unexpected: canadian inuit training for an experimental lifestyle', ethos. vol. , no. . september, pp. - . this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp conflict resolution among peaceful societies briggs, jean l., . '"why don't you kill your baby brother?" the dynamics of peace in canadian inuit camps', pp. - in leslie e. sponsel & thomas gregor, eds, the anthropology of peace and nonviolence. boulder, co: lynne rienner. brown, seyom, . the causes and prevention of war. new york: st. martin's. bush, perry, . '"we have learned to question government'", mennonite life, vol. , no. , june, pp. - . callender, charles, . 'the mehennab: a kenuz tribe', pp. - in robert a. fernea, ed., contemporary egyptian nubia. a svmposium of the social research center, american university in cairo, volume ii. new haven, ct: human relations area files. ceadel, martin, . thinking about peace and war. new york: oxford university press. commonwealth v. peterman, . superior court of pennsylvania, atlantic reporter, vol. , april , pp. - . cong, dachang, . 'amish factionalism and technological change: a case study of kerosene refrigerators and conservatism', ethnology: an international journal of cultural and social anthropology, vol. , no. , july, pp. - . dentan, robert knox, a. 'semai response to mental aberration', bijdragen tot de taal-, land- en volkenkunde, vol. , no. , pp. - . dentan, robert knox, b. the semai: a nonviolent people of malaya. new york: holt, rinehart & winston. dentan, robert knox, . '[response to knauft and otterbein]', current anthropology, vol. , no. , august-october, pp. - . deutsch, morton, . the resolution of conflict. new haven, ct: yale university press. deutsch, morton, . 'subjective features of conflict resolution: psychological, social and cultural influences', pp. - in raimo vayrynen, ed., new directions in conflict theori. conflict resolution and conflict transformation. london: sage. deutsch, morton, . 'constructive conflict resolution: principles, training, and research', journal of social issues, vol. , no. , pp. - . draper, patricia, . 'crowding among hunter- gatherers: the !kung bushmen', science, vol. , no. , october, pp. - . driedger, leo & donald b. kraybill, . mennonite peacemaking, from quietism to activism. scottdale, pa: herald. eckert, penelope & russell newmark, . 'central eskimo song duels: a contextual analysis of ritual ambiguity', ethnology: an international journal of cultural and socialanthropology, vol. , no. , january, pp. - . ember, carol r. & melvin ember, . 'war, socialization, and interpersonal violence', journal of conflict resolution, vol. , no. , december, pp. - . endicott, kirk, . 'the effects of slave raiding on the aborigines of the malay peninsula', pp. - in anthony reid, ed., slavery, bondage and dependency in southeast asia. st. lucia and new york: university of queensland press. endicott, kirk, . 'property, power and conflict among the batek of malaysia', pp. - in tim ingold, david riches & james woodbumrn, eds, hunters and gatherers .: property, power and ideology. oxford: berg. fabbro, david, . 'peaceful societies: an introduction', journal of peace research, vol. , no. , pp. - . ferguson, r. brian, . 'introduction: studying war', pp. - in r. brian ferguson, ed., warfare, culture, and environmtent. orlando, fl: academic. femrnea, robert a., . 'integrating factors in a non-cor- porate community', pp. - in robert a. fernea, ed., contemnlporary egyptian nubia: a sylmposiumnl of the social research center anmerican university of cairo, volume ii. new haven, ct: human relations area files. fernea, robert a., . nubians in egypt: peaceful people. austin: university of texas press. fisher, ronald j. & loraleigh keashly, . 'third party consultation as a method of intergroup and international conflict resolution', pp. - in ronald j. fisher, ed., the social psychology of intergroup and inter- national conflict resolution. new york: springer verlag. fry, douglas p., . 'maintaining social tranquillity: internal and external loci of aggression control', pp. - in leslie e. sponsel & thomas gregor, eds, the anthropology of peace and nonviolence. boulder, co: lynne reinner. gardner, peter m., . 'symmetric respect and memorate knowledge: the structure and ecology of individualistic culture', southwestern journal of anthropology, vol. , no. , winter, pp. - . gardner, peter m., . 'paliyan social structure', pp. - in david damas, ed., contributions to anthropology: band societies. proceedings of the conference on band organization. ottawa, august to september , . ottawa: the national museums of canada. gardner, peter m., . 'the paliyans', pp. - in m. g. bicchieri, ed., hunters and gatherers todav: a socioeconomic study of eleven such cultures in the twentieth century. new york: holt, rinehart & winston. gardner, peter m., . 'bicultural oscillation as a long- term adaptation to cultural frontiers: cases and questions', human ecology, vol. , no. , december, pp. - . gibson, thomas, . 'the sharing of substance versus the sharing of activity among the buid', man, vol. , no. , september, pp. - . gibson, thomas, . sacrifice and sharing in the philippine highlands: religion and society among the buid of mindoro. london: athlone. gibson, thomas, . 'meat sharing as a political ritual: forms of transaction versus modes of subsistence', pp. - in tim ingold, david riches & james woodburn, eds. hunters and gatherers : propert', power and ideology. oxford: berg. gibson, thomas, . 'symbolic representations of tranquility and aggression among the buid', pp. - in signe howell & roy willis, eds, societies at peace: anthropological perspectives. london: routledge. gibson, thomas, . 'raiding, trading and tribal autonomy in insular southeast asia', pp. - in this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp brluce d. bonta jonathan haas, ed., the anthropology of iwar. cambridge: cambridge university press. greenwalt, kent, . 'punishment', pp. - in sanford h. kadish, ed., enclyclopedia of cdrime and justice, vol. . new york: free press. gregor, thomas, . 'symbols and rituals of peace in brazil's upper zingu', pp. - in leslie e. sponsel & thomas gregor, eds. the anthropology of peace and nonviolence. boulder, co: lynne rienner. gruter, margaret, . 'ostracism on trial: the limits of individual rights', social science information, vol. , no. , march, pp. - . gruter, margaret & roger d. masters, . 'ostracism as a social and biological phenomenon: an introduction', ethology and sociobiologv (special issue on ostracism), vol. , nos. , pp. - . gulliver, p.h., . disputes and negotiations: a cross- cultural perspective. new york: academic. hollan, douglas, . 'emotion work and the value of emotional equanimity among the toraja', ethnology: an international journal of cultural and social anthropology, vol. , no. , january, pp. - . hollan, douglas w. & jane c. wellenkamp, . contentment and suffering: culture and experience in toraja. new york: columbia university press. hostetler, john a., . hutterite society. baltimore, md: johns hopkins university press. hostetler, john a., . amish society, rd ed. baltimore, md: johns hopkins university press. howe, l.e.a., . 'peace and violence in bali: culture and social organization', pp. - in signe howell & roy willis, eds. societies at peace: anthropological perspectives. london: routledge. howell, signe, . society and cosmos: chewong of peninsular malaysia. singapore: oxford university press. howell, signe, . "'to be angry is not to be human, but to be fearful is": chewong concepts of human nature', pp. - in signe howell & roy willis, eds, societies at peace: anthropological perspectives. london: routledge. howell, signe & roy willis, eds, a. societies at peace: anthropological perspectives. new york: rout- ledge. howell, signe & roy willis, b. 'introduction', pp. - in signe howell & roy willis, eds, societies at peace: anthropological perspectives. london: routledge. juhnke, james c., . 'mob violence and kansas mennonites in ', kansas historical quarterly, vol. , no. , autumn, pp. - . juhnke, james c., . 'mennonites in world war i', mennonite life, vol. , no. , december, pp. - . just, peter, . 'conflict resolution and moral community among the dou donggo', pp. - in kevin avruch, peter w. black & joseph a. scimecca, eds, conflict resolution: cross-cultural perspectives. new york: greenwood. keashly, loraleigh; ronald j. fisher & peter r. grant, . 'the comparative utility of third party consultation and mediation within a complex simulation of intergroup conflict', human relations, vol. , no. , march, pp. - . kelman, herbert c., . 'foreword', pp. ix-xii in dennis j. d. sandole & h-ugo van der merwe, eds, conflict resolution theoryi' and practice. integration and application. manchester: manchester university press. kidder, robert l. & john a. hostetler, . 'managing ideologies: harmony as ideology in amish and japanese societies', law & society review, vol. , no. . pp. - . knauft, bruce m., . 'reconsidering violence in simple human societies: homicide among the gebusi of new guinea', current anthropology, vol. , no. , august-october, pp. - . knauft, bruce m., . 'culture and cooperation in human evolution', pp. - in leslie e. sponsel & thomas gregor, eds, the anthropology of peace and nonviolence. boulder, co: lynne reinner. kraybill, donald b., . the riddle of amish culture. baltimore, md: johns hopkins university press. lederach, john paul, . 'of nets, nails, and problems: the folk language of conflict resolution in a central american setting', pp. - in kevin avruch, peter w. black & joseph a scimecca, eds, conflict resolution: cross-cultural perspectives. new york: greenwood. lee, richard borshay, . 'male-female residence arrangements and political power in human hunter- gatherers', archives of sexual behavior, vol. , no. , march, pp. - . lee, richard borshay, . the !kung san: men, women and work in a foraging society. cambridge: cambridge university press. levine, robert a., . 'anthropology and the study of conflict', pp. - in richard a. falk & samuel s. kim, eds, the war system: an interdisciplinary approach. boulder, co: westview. levy, robert i., . tahitians: mind and experience in the society islands. chicago, il: university of chicago press. lips, julius e., . 'naskapi law', transactions of the american philosophical society, vol. , no. , pp. - . loudon, j.b., . 'teasing and socialization on tristan da cunha', pp. - in philip mayer, ed., socialization: the approach from social anthropology. london: tavistock. lutz, catherine a., . 'ethnopsychology compared to what? explaining behavior and consciousness among the ifaluk', pp. - in geoffrey m. white & john kirkpatrick, eds, person. self. and experience: exploring pacific ethnopsvchologies. berkeley, ca: university of california press. lutz, catherine a., . unnatural emotions: everyday sentiments on a micronesian atoll & their challenge to western theory. chicago, il: university of chicago press. marshall, lorna, . 'sharing, talking, and giving: relief of social tensions among the !kung', pp. - in richard b. lee & irven devore, eds, kalahari hunter-gatherers: studies of the !kung san and their neighbors. cambridge, ma: harvard university press. mayor, federico, . 'how psychology can contribute to a culture of peace', peace and conflict: journal of peace psychology, vol. , no. , pp. - . this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp conflict resolution among peaceful societies montagu, ashley, ed., . learning non-aggression: the experience of non-literate societies. new york: oxford university press. morris, brian, . forest traders: a socio-economic study of the hill pandaram. london: athlone. morris, brian, . 'hill pandaram', pp. - in paul hockings, eds, encyclopedia of world cultures, volume i, south asia. boston, ma: g. k. hall. munch, peter a., . sociology of tristan da cunha. oslo: det norske videnskaps-akademi. munch, peter a., . 'culture and superculture in a displaced community: tristan da cunha', ethnology: an international journal of cultural and social anthro- pology, vol. , no. , october, pp. - . munch, peter a., . crisis in utopia: the ordeal of tristan da cunha. new york: crowell. nader, laura, . 'harmony models and the construction of law', pp. - in kevin avruch, peter w. black & joseph a. scimecca, eds, conflict resolution: cross- cultural perspectives. new york: greenwood. nisly, hope, . 'witness to the way of peace: the vietnam war and the evolving mennonite view of their relationship to the state', maryland historian, vol. , no. , spring/summer, pp. - . norberg-hodge, helena, . ancient futures: learning from ladakh. san francisco, ca: sierra club books. o'nell, carl w., . 'hostility management and the control of aggression in a zapotec community', aggressive behavior, vol. , no. , pp. - . paddock, john, . 'values in an antiviolent community', humanitas, vol. , no. , may, pp. - . padilla, luis alberto, . 'conflict resolution theory and its application to guatemala's socio-political context', pp. - in kumar rupesinghe, ed, internal conflict and governance. new york: st. martin's. raghaviah, v., . the yanadis. new delhi: bharatiya adimjati sevak sangh. robarchek, clayton a., . semai nonviolence: a systems approach to understanding. phd dissertation, university of california, riverside. robarchek, clayton a., . 'conflict, emotion, and abreaction: resolution of conflict among the semai senoi', ethos, vol. , no. , pp. - . robarchek, clayton a., . 'primitive warfare and the ratomorphic image of mankind', american anthropolo- gist, vol. , no. , december, pp. - . robarchek, clayton a., . 'ghosts and witches: the psychocultural dynamics of semai peacefulness', pp. - in leslie e. sponsel & thomas gregor, eds, the anthropology of peace and nonviolence. boulder, co: lynne rienner. roseman, marina, . 'head, heart, odor, and shadow: the structure of the self, the emotional world, and ritual performance among senoi temiar', ethos, vol. , no. , september, pp. - . ross, marc howard, a. the management of conflict: interpretations and interests in comparative perspective. new haven, ct: yale university press. ross, marc howard, b. the culture of conflict: interpretations and interests in comparative perspective. new haven, ct: yale university press. rubin, jeffrey z., . 'models of conflict management', journal of social issues, vol. , no. , pp. - . schmidt, sabine, . world-system impact on local patterns of conflict and violence: case studies and cross-cultural comparison. cologne: omimee inter- cultural publishers. scimecca, joseph a., . 'conflict resolution in the united states: the emergence of a profession', pp. - in kevin avruch, peter w. black & joseph a. scimecca, eds, conflict resolution: cross-cultural perspectives. new york: greenwood. silberbauer, george b., . 'the glwi bushmen', pp. - in m. g. bicchieri, ed., hunters and gatherers today:. a socioeconomic study of eleven such cultures in the twentieth century. new york: holt, rinehart & winston. sinha, d. p., . 'the birhors', pp. - in m. g. bicchieri, ed, hunters and gatherers today: a socioeconomic study of eleven such cultures in the twentieth century. new york: holt, rinehart & winston. sponsel, leslie e., . 'the mutual relevance of anthropology and peace studies', pp. - in leslie e. sponsel & thomas gregor, eds, the anthropology of peace and nonviolence. boulder, co: lynne rienner. sponsel, leslie e. & thomas gregor, eds, . the anthropology of peace and nonviolence. boulder, co: lynne rienner. thomas, elizabeth marshall, . 'management of violence among the ju/wasi of nyae nyae: the old way and a new way', pp. - in s. p. reyna & r. e. downs, eds, studying war: anthropological perspectives. langhorne, pa: gordon & breach. toews, paul, . 'the impact of alternative service on the american mennonite world: a critical evaluation', mennonite quarterl' review, vol. , no. , october, pp. - . unruh, john d., . 'the hutterites during world war i', mennonite life, vol. , no. , july, pp. - . warren, neil clark, . 'work it out: the triumphant marriage', focus on the family, october, pp. - . wikan, unni, . managing turbulent hearts: a balinese formula for living. chicago, il: university of chicago press. appendix. twenty-four peaceful societies the following list provides a brief description of where and how each of the societies mentioned in this article lives. for a full bibliography of works describing the peacefulness of these societies, as well as the works of detractors who dis- cuss their violence, please consult bonta ( ). amish. over , amish live in canada and the united states, mostly on traditional family farms in the eastern states of pennsylvania, ohio, and indiana, though many are now engaging in small business enterprises. balinese. over two million people, most of whom practice hindu beliefs, live on the indonesian island of bali and work as either farmers or business people. batek. peoples of the mountainous malay peninsula who gather forest products for trade as well as hunt and gather their food. this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp bruce d. bonta birhor. a gathering and hunting people who also trade with other peoples in southern bihar state, east central india. buid. shifting agricultural peoples of the forested highlands of mindoro island in the philippines. chewong. a hunting and gathering people of the mountain- ous interior, peninsular malaysia, who also undertake some swidden agriculture. g/wi. a san people of central botswana, southern africa, who used to live as hunting and gathering nomads in the kalahari desert, but who now mostly work as hired la- borers on ranches. hutterites. an anabaptist people who live in colonies scat- tered across the plains of rural north central united states and central canada. ifaluk. a fishing and agricultural people who live on a pacific atoll in the federated states of micronesia, near the large island of yap. inuit. the anthropologist jean briggs has written many arti- cles and monographs about the strategies that two differ- ent inuit groups, one in the central canadian arctic and the other on baffin island, use to control anger and pre- vent violence from occurring. these peoples traditionally survived on fishing and hunting, though they now are part of the cash economy. !kung. one of the most studied of traditional societies, the !kung, a so-called san people, live in the boundary area of botswana and namibia, in southern africa. traditionally they were nomadic gatherers and hunters. ladakhis. buddhist agricultural and pastoral people who live south of the karakoram range in the northwest cor- ner of india, the state of jammu and kashmir. malapandaram. the malapandaram, or hill pandaram, live in the hills at the southern end of the western ghats in india. mennonites. nearly , mennonites live today in canada and the united states, some as traditional farmers who live without much technology, much as the amish do, and others in quite contemporary businesses, trades, and professional positions. montagnais-naskapi. an indian society of the labrador peninsula, eastern canada, the montagnais-naskapi live on trapping, trading, hunting, gathering and seasonal em- ployment. nubians. before the completion of the aswan high dam in upper egypt in the s, the nubian people lived in tra- ditional farming villages along the nile river, though many of the men had to leave for periods of time to work in cities to the north. paliyan. a gathering people who live in a range of hills at the southern end of the western ghats of india. semai. the semai, people of the mountainous malay peninsula, live (or formerly lived) primarily on their hunt- ing, fishing, gathering, and swidden agriculture. tahitians. residents of the society islands, part of french polynesia in the central pacific, live off their gardening, fishing, trade and business pursuits. temiar. the temiar, primarily agricultural peoples who do some hunting and gathering, live in permanent villages in longhouses built, in the past, for defense from the malay slave raiding. toraja. several hundred thousand toraja, most of whom have converted to christianity, live primarily by farming in the mountains of south sulawesi, in indonesia. tristan islanders. a small population of mixed european and either african or south east asian ancestry who have lived on the isolated island of tristan da cunha, a british dependency in the south atlantic, since the early nine- teenth century. these people have traditionally engaged in fishing, gathering, and agriculture, though in recent decades they have also had cash income from a fishing factory and tourists. yanadi. several hundred thousand yanadi live mostly in the eastern coastal areas of india, where they engage in gath- ering, work for wages, and subsistence hunting. zapotec. while the zapotec, an indigenous agricultural people of oaxaca state, southern mexico, may not be ex- ceptionally peaceful, a few highly nonviolent communi- ties not too far from the city of oaxaca have been studied by a succession of social scientists. bruce d. bonta, b. , mls in library science (university of maine, ); reference librarian at the library of congress, colby college (waterville, me), and the pennsylvania state university (university park, pa), history/area studies librarian, pennsylvania state ( - ); author of peaceful peoples: an annotated bibliography (scarecrow press, ). this content downloaded from . . . on thu, aug : : pm all use subject to jstor terms and conditions http://www.jstor.org/page/info/about/policies/terms.jsp article contents p.[ ] p. p. p. p. p. p. p. p. p. p. p. p. p. p. p. p. p. issue table of contents journal of peace research, vol. , no. (nov., ), pp. - volume information [pp. - ] front matter [pp. - ] focus on antinomies of postmodernism in international studies [pp. - ] united states military intervention and the promotion of democracy [pp. - ] conflict resolution among peaceful societies: the culture of peacefulness [pp. - ] when the individual soldier says 'no' to war: a look at selective refusal during the intifada [pp. - ] explaining territorial disputes: from power politics to normative reasons [pp. - ] the nordic area as a 'zone of peace' [pp. - ] when officers need internal enemies: aspects of civil-military relations in scandinavia between the world wars [pp. - ] the political economy of defense spending in south korea [pp. - ] review essay war termination [pp. - ] book notes untitled [p. ] untitled [p. ] untitled [pp. - ] untitled [p. ] untitled [pp. - ] untitled [p. ] untitled [p. ] untitled [pp. - ] untitled [p. ] untitled [p. ] untitled [pp. - ] untitled [p. ] untitled [p. ] untitled [pp. - ] untitled [p. ] books received [pp. - ] back matter [pp. - ] science magazine april vol science www.sciencemag.org five years ago, a team headed by jeffrey gordon of washington university in st. louis (wustl) in missouri made a surpris- ing discovery: the guts of obese mice and people harbor an array of microbes different from that of their lean counterparts. more provocatively, when they gave lean mice certain gut-dwelling microbes, the rodents became fat (science, may , p. ). the fi ndings sparked headlines and fueled popular speculation that manipulating gut bacteria might keep weight down in people. already, martin blaser had been head- ing down a similar track. blaser, a microbi- ologist at new york university in new york city, was struck by how successful farmers are at increasing the growth rates of livestock by adding low doses of antibiotics to their feed. “the earlier in life they start the antibi- otic, the more profound the effect,” he points out. he began to wonder whether antibiotic use, particularly in children, might affect the long-term establishment of a balanced micro- bial community in the human gut, eliminat- ing bacteria there that could help ward off obesity. he started conducting mouse studies to examine the hypothesis. since then, several other groups have joined in. a raft of intriguing obesity- related fi ndings was presented at a meeting last month on the microbiome, the bacteria that live inside the guts and other tissues of animals. yet many in the fi eld caution that it remains diff icult to determine whether changes in gut microbes drive or contribute to obesity or whether the excess weight itself triggers those changes. “the jury is still out [about] what the role of the gut microbiota may be in obesity in humans,” says claire fraser-liggett, a microbiologist at the uni- versity of maryland school of medicine in baltimore who has studied gut bacteria and obesity in the amish. case of the missing microbes the farm animal–antibiotic connection was one clue that led blaser to wonder about microbial causes of the obesity epi- demic. another was the fact that very few people now harbor the ulcer-causing bacte- rium helicobacter pylori in their stomachs. h. pylori, which has also been linked to stomach cancers, is one of up to differ- ent microbes that call the human body home. once ubiquitous in the human microbiome and still so in the guts of people from devel- oping countries, it is now found in just % of u.s. children. that might seem like good news, as there should be fewer ulcers and cancers. but blaser suspects that it is also bad news, as studies suggest that h. pylori’s presence in the gut helps regulate the stom- ach’s production of the hormone ghrelin, which stimulates food intake. this bacterium may not be the only species disappearing from our microbiome. after a person takes antibiotics, “it has always been pre- sumed that the micro- biota will spring back,” blaser says. but the fate of h. pylori suggests otherwise. its vanishing act and other shifts in the microbiome may con- tribute to an increased risk for weight gain, blaser worries. he has started to investigate this theory by giving mice either low doses of antibiotics over long periods, akin to what farm ani- mals receive, or short-term, high doses, more like what a sick infant or adult would get. he then com- pares the physiology and microbi- omes of these treated rodents with those of mice raised under similar conditions but given no antibiot- ics. in one set of studies, the mice fed low doses of antibiotics long- term wound up with % more body fat than the control mice, blaser reported last month at the international human microbiome congress in vancouver, canada. the chubbier, antibiotic-fed mice also had about % more fat in their livers. the treated mice also had a different set of bacterial species inhabiting their guts. and several hundred bacterial genes, includ- ing ones for fatty acid production, exhibited different levels of activity—some increas- ing, others decreasing—in these mice com- pared with the controls. similar changes occur in the rodents given short pulses of antibiotics, he noted. antibiotics “may be driving the gut microbiome to a place where it shouldn’t be,” fraser-liggett says. “we do not know the functional consequences, but with these miracle drugs now years later, we may be seeing effects that change susceptibility to various diseases.” blaser will examine the gut microbiomes of children to see whether his results are applicable to humans. if so, “that would be a remarkable connection that could have a sig- nifi cant impact on medical care,” says genome scientist george weinstock of wustl. but he’s cautious: “in a lot of cases, the micro- biome in mice doesn’t translate into humans.” patterns in genes s. dusko ehrlich has avoided that issue, bypassing mice and instead directly exam- ining whether patterns in the microbiome of people relate to body mass index and obesity. a microbiologist at the inra microbiology and food chain divi- sion in jouy-en-josas, france, ehrlich is part of a group, the meta- newsfocus c r e d it s ( t o p t o b o t t o m ): r a d e l u k o v ic /t h in k s t o c k ; j a s o n h e go with the gut. antibiotic use may adversely affect the long-term makeup of the intestine’s bacterial communities. girth and the gut (bacteria) mouse, human studies begin to clarify gut bacteria’s role in obesitymouse, human studies begin to clarify gut bacteria’s role in obesity m i c r o b i o l o g y published by aaas o n j a n u a ry , w w w .s ci e n ce m a g .o rg d o w n lo a d e d f ro m http://www.sciencemag.org/ www.sciencemag.org science vol april newsfocus c r e d it : l a u r a k y r o / c e n t e r f o r g e n o m e s c ie n c e s & s y s t e m s b io l o g y hit consortium, investigating connections between microbial genes in human intestines and human health. by comparing such genes from obese and nonobese individuals, he and his colleagues have found that certain sets of bacterial genes and bacteria correlate with excess weight and insulin resistance. the researchers fi rst sequenced all the bac- terial genes in stool samples of danes, who were thin and who were either over- weight or obese. although the researchers concluded that most participants in the study had roughly , distinct bacterial genes in their guts, almost one-third of the obese study participants had only about , such genes, % to % fewer. a similar per- centage of obese french people had a com- parable dearth of gut bacteria genes, ehrlich reported at the vancouver meeting. moreover, the obese people “don’t have as great a bac- terial diversity” in their guts, ehrlich reported. one missing microbe in that group was a methane pro- ducer, leading ehrlich to wonder whether “the car- bon that does not get out [of the body] as gas could be incorporated as fat.” when they looked at medical histories of all their study subjects, ehrlich and his colleagues found that the obese peo- ple with fewer gut bacte- ria genes were more likely to be insulin resistant than were the obese people who had a typical tally of intestinal microbial genes. these obese people also tended to have higher than normal white blood cell counts, suggesting that they were in a state of low-level infl am- mation, ehrlich said. some researchers have found evidence of a link between inflam- mation and obesity (science, december , p. ). ehrlich and his colleagues have also tested whether the types of bacteria in a person’s gut can “diagnose” obesity. using just six meta- species, they were able to correctly predict whether a person was lean or obese more than % of the time, he reported. when research- ers try to make the same predictions by con- sidering all of a person’s genetic risk factors for obesity, they are right only % of the time, ehrlich pointed out. at this point, however, it’s unclear whether the differences in intestinal microbes are “the cause, a contribution to, or the consequence” of obesity, notes ehrlich. “if we can provide evidence that they [at least] provide a contri- bution, then we can go and fi nd a treatment.” help from the amish other work presented at the microbiome meeting indicates that sorting out this cause- and-effect puzzle will be tough. frustrated by the inconsistent results others were getting when they looked for connections between the microbiome and obesity, fraser-liggett and her colleagues examined adult amish liv- ing in pennsylvania. amish marry within their group and have very similar lifestyles, envi- ronment, and eating habits—they even cook in communal kitchens. thus, fraser-liggett hoped to eliminate some of the variables that might have confounded other studies. the body mass index of amish ranged from to ( is obese), and some of the obese ones also had metabolic syndrome. fraser-liggett and her colleagues captured a snapshot of the gut microbiome of each amish by obtaining stool samples, sequenc- ing the dna in them, and using the s ribo- somal subunit gene often used to tell bacteria apart, identifying any microbial components. although the scientists did detect some dif- ferences in certain bacteria between obese and lean amish, they didn’t fi nd the dramatic shifts that gordon had documented between lean and obese mice, fraser-liggett reported at the meeting. one problem may be that simply taking a census of the bacteria present in a person’s gut may not be enough. “ s [analysis] is not very informative,” ehrlich says. “we need to go to more precise measures.” increasingly, micro- biome researchers are looking at what bacte- rial genes are active in a person and not just at which bacteria are there. scientists have found that although the species mix of the micro- biome may vary signifi cantly from one person to the next, those individuals often still have equivalent complements of bacterial genes at work inside them. through such gene analy- ses, researchers can begin to better assess what the bacteria in the gut are really doing to, or for, their host, fraser-liggett notes. gordon suggests that more clarity on the obesity-microbiome issue will also come from using the guts of mice as bioreactors for human microbes. his group has pio- neered the study of germ-free mice, which are grown in a sterile environment from birth, and he is now exposing such mice to bacteria from human guts. once those human microbes have established residence in the guts of the mice, gordon then feeds the animals a variety of human diets. using these rodent proxies, he can thus track how different diets affect the “human” microbiomes, assessing the bacteria as often as he needs to to get a dynamic picture. “you can sample many features between the microbial community and the host,” he says. despite his role in ignit- ing the study of obesity and microbiomes, gordon resists the idea that our gut bacteria are the sole expla- nation for the growing number of obese people. “it’s not the dominant part of the problem; excessive energy intake is,” he con- tends. the simplistic notion of only chang- ing one’s gut bacteria to lose weight has been “hyped a lot,” he complains. others, such as microbial ecologist lip- ing zhao of shanghai jiao tong university in china, are more convinced that the micro- biome will prove important when it comes to obesity. “increased abundance of ‘bad genes’ and [a] decrease of ‘good genes’ in our diet-disrupted gut microbiome [may] be the primary driving force for this obesity epidemic,” zhao says. even if zhao’s prediction proves right, the studies to date make clear that the con- nection between the microbiome and excess weight is complex, fraser-liggett says. for those looking to bacteria to stem the obesity epidemic, she concludes, “there’s clearly no magic formula.” –elizabeth pennisi personalized microbiota. germ-free mice grown in sterile environments and given human gut microbes provide a way to test links between bacteria and obesity. published by aaas o n j a n u a ry , w w w .s ci e n ce m a g .o rg d o w n lo a d e d f ro m http://www.sciencemag.org/ wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ ellis-van creveld syndrome: prenatal diagnosis, molecular analysis and genetic counseling taiwan j obstet gynecol • december • vol • no ■ short communication ■ introduction ellis-van creveld (evc) syndrome (omim ), or chondroectodermal dysplasia, is an autosomal reces- sive ciliary disorder associated with a wide spectrum of developing abnormalities involving the ectoderm, skeleton and heart. evc syndrome is a relatively rare ellis-van creveld syndrome: prenatal diagnosis, molecular analysis and genetic counseling chih-ping chen , , , , , *, yi-ning su , chin-yuan hsu , schu-rern chern , fuu-jen tsai , , pei-chen wu , po-tsang chen , wayseen wang , departments of obstetrics and gynecology and medical research, mackay memorial hospital, institute of clinical and community health nursing, department of obstetrics and gynecology, national yang-ming university, department of medical genetics, national taiwan university hospital, and department of bioengineering, tatung university, taipei; department of biotechnology, asia university, school of chinese medicine, college of chinese medicine, china medical university, and departments of medical genetics and medical research, china medical university hospital, taichung, taiwan. summary objective: to present the perinatal findings and molecular genetic analysis of two siblings with ellis-van creveld (evc) syndrome. materials, methods and results: a -year-old woman, gravida , para , was referred for genetic counseling at gestational weeks because of recurrent fetal skeletal dysplasia. two years previously, she had delivered a , -g dead male baby at gestational weeks with a karyotype of ,xy, postaxial polydactyly of the hands, thoracic narrowness, endocardial cushion defects, transposition of the great arteries, shortening of the long bones, malposition of the toes, and hypoplastic nails. during this pregnancy, prenatal ultrasound at gesta- tional weeks revealed shortening of the long bones (equivalent to weeks), postaxial polydactyly of both hands, thoracic narrowness, and endocardial cushion defects. the pregnancy was subsequently terminated, and a -g female fetus was delivered with a karyotype of ,xx, postaxial polydactyly of the hands, thoracic dysplasia, endocardial cushion defects, shortening of the long bones, and malposition of the toes and hypoplastic nails. the phenotype of each of the two siblings was consistent with evc syndrome. molecular analysis of the evc and evc genes revealed heterozygous mutations in the evc gene. a heterozygous deletion mutation of a -bp deletion of c. - _ del encompassing the junction between intron and exon of the evc gene was found in the mother and two siblings, and a heterozygous nonsense mutation of c. c > t, p.r x in exon of the evc gene was found in the father and two siblings. conclusion: prenatal sonographic identification of endocardial cushion defects in association with shortening of the long bones should alert clinicians to the possibility of evc syndrome and prompt a careful search of hexa- dactyly of the hands. molecular analysis of the evc and evc genes is helpful in genetic counseling in cases with prenatally detected postaxial polydactyly, thoracic narrowness, short limbs and endocardial cushion defects. [taiwan j obstet gynecol ; ( ): – ] key words: ellis-van creveld syndrome, evc, evc , prenatal diagnosis, ultrasound *correspondence to: dr chih-ping chen, department of obstetrics and gynecology, mackay memorial hospital, , section , chung-shan north road, taipei, taiwan. e-mail: cpc_mmh@yahoo.com accepted: september , disorder, but is most prevalent in the amish popula- tion [ , ] and in some arab populations [ ] because of consanguinity. the birth prevalence is estimated to be . per , of live births in the non-amish population [ ], . per , of live births in the united arab emirates [ ], and per , of live births in the amish of lancaster county, pennsylvania, usa [ ]. evc syndrome is characterized by short ribs, short limbs, postaxial polydactyly of the hands, poly- dactyly of the feet (in % of cases), ectodermal dys- plasia such as dysplastic nails and teeth, sparse hair and an absent gingival sulcus, and congenital heart defects (in % of cases) such as a common atrium, atrioventricular septal defects (avsds) and patent ductus arteriosus [ , ]. evc syndrome is caused by mutations in the evc gene (omim ) [ ] or evc gene (omim ) [ ] that encodes cilia- related proteins evc or evc , respectively. mutations in the evc gene or evc gene may also cause weyers acrodental dysostosis (omim ), an autosomal dominant disorder characterized by postaxial poly- dactyly and abnormalities of the lower jaw, dentition taiwan j obstet gynecol • december • vol • no c.p. chen, et al figure . whole body x-ray of proband at gestational weeks. a b figure . postaxial polydactyly of the hands in proband . and oral vestibule. the evc and evc proteins are localized in the basal bodies of primary cilia. evc is a basal body component of hedgehog signaling indis- pensable for normal endochondral growth and normal transcriptional activation of indian hedgehog-regulated genes [ ]. both evc syndrome and weyers acroden- tal dysostosis are caused by hedgehog signaling de- fects in the primary cilia due to mutations in the cilia-related proteins resulting in an aberrant response to the hedgehog ligands [ ]. we previously reported perinatal findings of hexadactyly-associated ciliary dis- orders of meckel syndrome [ ], joubert syndrome [ ], and short rib-polydactyly syndrome (srps) [ – ]. we present the perinatal findings and molecular genetic analysis of two siblings affected by hexadactyly and evc syndrome. materials, methods and results a -year-old woman, gravida , para , was referred for genetic counseling at gestational weeks because of recurrent fetal skeletal dysplasia. she and her hus- band were non-consanguineous. she had experienced one spontaneous abortion and delivered a baby with skeletal dysplasia. two years previously, she had deliv- ered a , -g dead male baby (proband ) at ges- tational weeks with a karyotype of ,xy, postaxial polydactyly of the hands, thoracic narrowness, endo- cardial cushion defects, transposition of the great arteries (tga), shortening of the long bones, malposi- tion of the toes and hypoplastic nails (figures – ). during this pregnancy, prenatal ultrasound at ges- tational weeks revealed shortening of the long bones (equivalent to weeks), postaxial polydactyly of both hands, thoracic narrowness, and endocardial cushion defects (figures – ). the pregnancy was subsequently terminated, and a -g female fetus (proband ) was delivered with a karyotype of ,xx, postaxial poly- dactyly of the hands, thoracic dysplasia, endocardial a b figure . malposition of the toes with hypoplastic nails in proband . cushion defects, shortening of the long bones, malpo- sition of the toes and hypoplastic nails (figures – ). the phenotype of each of the two siblings is consistent with evc syndrome. molecular analysis of the evc and evc genes showed heterozygous mutations in the evc gene. a heterozygous deletion mutation of a - bp deletion of c. - _ del encompassing the junction between intron and exon of the evc gene was found in the mother and two siblings, and a het- erozygous nonsense mutation of c. c > t, p.r x taiwan j obstet gynecol • december • vol • no ellis-van creveld syndrome figure . prenatal ultrasound shows thoracic narrowness in proband . figure . prenatal ultrasound shows hexadactyly of the hands in proband . figure . prenatal ultrasound shows endocardial cushion defects in proband . figure . whole body x-ray of proband at gestational weeks. figure . proband at birth. a b figure . postaxial polydactyly of the hands in proband . in exon of the evc gene was found in the father and two siblings (figure ). discussion the present case prenatally manifested shortening of the long bones, thoracic dysplasia, hexadactyly of the hands, and avsd on the second-trimester ultrasound. prenatal diagnosis of evc syndrome by direct visualiza- tion of the fetus using fetoscopy has previously been reported [ , ]. first-trimester transabdominal embry- ofetoscopy for the detection of limb or facial abnor- malities has recently been applied to detect skeletal dysplasia such as srps [ ]. recurrent evc syndrome can be diagnosed in the first trimester by the ultra- sound findings of avsd, polydactyly and short limbs [ ] as well as increased fetal nuchal translucency thickness [ ]. in the second trimester, the diagnosis of evc syndrome can be made based on a positive family history and the ultrasound findings of shortness of the long bones, hexadactyly of the hands, a narrow thorax and congenital heart defects, especially abnor- malities of atrial septation and avsd [ – ]. our first proband manifested avsd and tga, and our second proband manifested avsd on prenatal ultrasound. congenital heart defects occur in approxi- mately % of patients with evc syndrome with most patients being variants of avsd [ ]. atrioventricular septation of the mammalian heart into four chambers requires sonic hedgehog signaling-dependent cellular contributions from the extracardiac tissues of the dor- sal mesocardium as well as contributions from the muscular and mesenchymal atrial septum and the endocardial cushions [ ]. sund et al [ ] found that the expression of evc and evc mrna and proteins taiwan j obstet gynecol • december • vol • no c.p. chen, et al figure . malposition of the toes with hypoplastic nails in proband . proband proband c. – _ delaggttctgccgcaccacggcctccac c. – _ delaggttctgccgcaccacggcctccac c. – _ delaggttctgccgcaccacggcctccac evc - evc - evc - mother father control wt wt wt e evc - evc - evc - evc - proband proband mother father control c. c > t c. c > t c. c > t e wt wt wt evc - evc - evc - evc - proband proband father mother figure . a heterozygous deletion mutation of the -bp deletion encompassing the junction between intron and exon of the evc gene (c. - _ del ) in proband , proband and the mother, but not in the father, and a heterozygous nonsense mutation in exon of the evc gene (c. c > t, cga > tga, arg stop, r x) in proband , proband and the father, but not in the mother. wt = wild type. was high in the outflow tract and dorsal mesenchymal protrusion and was also present in the mesenchymal structures of the atrial septum and the endocardial cushions. this finding suggested that evc and evc proteins function coordinately in cardiac development and that loss of this coordinate function results in characteristic evc syndrome. in the present case, we identified heterozygous evc mutations in the affected fetuses. the nonsense mutation of c t, r x, has been described pre- viously [ ]. however, the deletion mutation of c. - _ del is novel. sequencing the evc and evc genes has been reported to identify mutations in only two-thirds of evc patients, indicating the possibility of genetic heterogeneity in evc syndrome [ ]. in a study of individuals with evc syndrome, tompson et al [ ] identified evc mutations in cases ( %), all of whom had mutations on each allele, found evc muta- tions in cases ( %), of whom had mutations on each allele, and three had only one mutation, and there was no mutation in either gene in cases ( %). the three patients in their study with an evc mutation on only one allele had a frameshift or a nonsense codon and a more severe phenotype than weyers acrodental dysostosis. there is a risk of % recurrence in subsequent pregnancies in fetal evc syndrome. genetic counseling of fetal evc syndrome should include differential diag- noses of srps, jeune asphyxiating thoracic dystrophy (jatd), and mckusick-kaufman syndrome (mkks). srpss are a heterogeneous group of lethal autosomal recessive skeletal dysplasias. four types of srps have been recognized [ ]. type i srps (saldino-noonan) (omim ) is characterized by flipper-like extrem- ities, polydactyly, polycystic kidneys and pointed meta- physes. type ii srps (majewski) (omim ) is characterized by polydactyly, micromelia, cleft lip/palate, polycystic kidneys, a disproportionately short ovoid tibia and occasionally hypoplastic epiglottis and larynx. type iii srps (verma-naumoff) (omim ) is characterized by polydactyly, micromelia, metaphyseal spurs and occasionally situs inversus totalis. type iv srps (beemer-langer) (omim ) clinically resembles type ii srps other than polydactyly. overlapping clinical and radiological manifestations have led to the hypoth- esis that the different subtypes may be a single genetic disorder with variable expressivity [ – ]. type iii srps is caused by mutations of the dync h gene (omim ) [ , ]. jatd (omim ) is an autoso- mal recessive disorder characterized by thoracic dys- trophy, chondrodysplasia, short ribs, short long bones, inconstant polydactyly and a trident acetabular roof with occasional involvement of the liver, retinal degen- eration, and cystic renal disease. jatd is caused by muta- tions of the ift gene (omim ) and dync h gene [ – ]. jatd and type iii srps have been sug- gested to be variants of a single ciliary disorder [ ]. mkks (omim ) is an autosomal recessive dis- order characterized by polydactyly, congenital heart defects, hydrometrocolpos, and it clinically overlaps with bardet-biedl syndrome (omim ) comprising obesity, retinitis pigmentosa, polydactyly, mental retardation, renal malformation and genital hypoplasia. mkks and bardet-biedl syndrome can be caused by mutations of the mkks gene (omim ) [ , ]. in summary, we have presented prenatal diagnosis, molecular analysis and genetic counseling of recurrent evc syndrome. prenatal sonographic identification of en- docardial cushion defects in association with shortening of the long bones should alert clinicians to the possibil- ity of evc syndrome and prompt a careful search of hexa- dactyly of the hands. molecular analysis of the evc and evc genes is helpful in genetic counseling in cases with prenatally detected postaxial polydactyly, thoracic nar- rowness, short limbs, and endocardial cushion defects. acknowledgments this work was supported by research grants nsc- - -b- - -my and nsc- - -b- - -my from the national science council, and mmh-e- from mackay memorial hospital, taipei, taiwan. references . mckusick va, egeland ja, eldridge r, krusen de. dwarfism in the amish. i. the ellis-van creveld syndrome. bull johns hopkins hosp ; : – . . mckusick va. ellis-van creveld syndrome and the amish. nat genet ; : – . . al-gazali li, bakir m, hamid z, et al. birth prevalence and pattern of osteochondrodysplasias in an inbred high risk pop- ulation. birth defects res a clin mol teratol ; a: – . . stoll c, dott b, roth mp, alembik y. birth prevalence rates of skeletal dysplasias. clin genet ; : – . . zangwill km, boal dk, ladda rl. dandy-walker malformation in ellis-van creveld syndrome. am j med genet ; : – . . baujat g, le merrer m. ellis-van creveld syndrome. orphanet j rare dis ; : . . ruiz-perez vl, goodship ja. ellis-van creveld syndrome and weyers acrodental dysostosis are caused by cilia-mediated diminished response to hedgehog ligands. am j med genet c semin med genet ; c: – . . ruiz-perez vl, ide se, strom tm, et al. mutations in a new gene in ellis-van creveld syndrome and weyers acrodental dysostosis. nat genet ; : – . . galdzicka m, patnala s, hirshman mg, cai jf, nitowsky h, egeland ja, ginns ei. a new gene, evc , is mutated in ellis- van creveld syndrome. mol genet metab ; : – . . ruiz-perez vl, blair hj, rodriguez-andres me, et al. evc is a positive mediator of ihh-regulated bone growth that localises at the base of chondrocyte cilia. development ; : – . . chen cp. meckel syndrome: genetics, perinatal findings and differential diagnosis. taiwan j obstet gynecol ; : – . . chen cp, su yn, huang jk, et al. fetal magnetic resonance imaging demonstration of central nervous system abnor- malities and polydactyly associated with joubert syndrome. taiwan j obstet gynecol ; : – . . chen cp, tzen cy. short rib-polydactyly syndrome type iii (verma-naumoff) in a third-trimester fetus with unusual asso- ciations of epiglottic hypoplasia, renal cystic dysplasia, pyelec- tasia and oligohydramnios. prenat diagn ; : – . taiwan j obstet gynecol • december • vol • no ellis-van creveld syndrome . chen cp, chang ty, tzen cy, lin cj, wang w. sonographic detection of situs inversus totalis, ventricular septal defect, and short rib-polydactyly syndrome type iii (verma- naumoff) in a second-trimester fetus not known to be at risk. ultrasound obstet gynecol ; : – . . chen cp, chang ty, tzen cy, wang w. second-trimester sonographic detection of short rib-polydactyly syndrome type ii (majewski) following an abnormal maternal serum biochemical screening result. prenat diagn ; : – . . chen cp, shih jc, tzen cy, lin yh, wang w. recurrent short-rib polydactyly syndrome: prenatal three-dimensional ultrasound findings and associations with congenital high air- way obstruction and pyelectasia. prenat diagn ; : – . . mahoney mj, hobbins jc. prenatal diagnosis of chon- droectodermal dysplasia (ellis-van creveld syndrome) with fetoscopy and ultrasound. n engl j med ; : – . . bui th, marsk l, eklöf o, theorell k. prenatal diagnosis of chondroectodermal dysplasia with fetoscopy. prenat diagn ; : – . . lee k, lee jw, chay db, et al. transabdominal embryofe- toscopy for the detection of short rib-polydactyly syndrome, type ii (majewski), in the first trimester. j korean med sci ; : – . . dugoff l, thieme g, hobbins jc. first trimester prenatal diagnosis of chondroectodermal dysplasia (ellis-van creveld syndrome) with ultrasound. ultrasound obstet gynecol ; : – . . venkat-raman n, sebire nj, murphy kw, carvalho js, hall cm. increased first-trimester fetal nuchal translucency thickness in association with chondroectodermal dysplasia (ellis-van creveld syndrome). ultrasound obstet gynecol ; : – . . horigome h, hamada h, sohda s, oyake y, kurosaki y. prenatal ultrasonic diagnosis of a case of ellis-van creveld syndrome with a single atrium. pediatr radiol ; : – . . guschmann m, horn d, gasiorek-wiens a, urban m, kunze j, vogel m. ellis-van creveld syndrome: estimation at weeks’ gestation. prenat diagn ; : – . . tongsong t, chanprapaph p. prenatal sonographic diagnosis of ellis-van creveld syndrome. j clin ultrasound ; : – . . george e, desilva s, lieber e, raziuddin k, gudavalli m. ellis van creveld syndrome (chondroectodermal dysplasia, mim ) in three siblings from a non-consanguineous mating. j perinat med ; : – . . sergi c, voigtlander t, zoubaa s, et al. ellis-van creveld syndrome: a generalized dysplasia of enchondral ossification. pediatr radiol ; : – . . parilla bv, leeth ea, kambich mp, chilis p, macgregor sn. antenatal detection of skeletal dysplasias. j ultrasound med ; : – . . witters i, moerman p, fryns jp. skeletal dysplasias: pre- natal cases. genet couns ; : – . . goddeeris mm, rho s, petiet a, davenport cl, johnson ga, meyers en, klingensmith j. intracardiac septation requires hedgehog-dependent cellular contributions from outside the heart. development ; : – . . sund kl, roelker s, ramachandran v, durbin l, benson dw. analysis of ellis van creveld syndrome gene products: implications for cardiovascular development and disease. hum mol genet ; : – . . ruiz-perez vl, tompson swj, blair hj, et al. mutation in two nonhomologous genes in a head-to-head configuration cause ellis-van creveld syndrome. am j hum genet ; : – . . tompson swj, ruiz-perez vl, blair hj, et al. sequencing evc and evc identifies mutations in two-thirds of ellis-van creveld syndrome patients. hum genet ; : – . . lachman rs. skeletal dysplasia. in: taybi h, lachman rs, eds. radiology of syndromes, metabolic disorders, and skeletal dysplasias, th edition. st. louis: mosby, : – . . martínez-frías m-l, bermejo e, urioste m, huertas h, arroyo i. lethal short rib polydactyly syndromes: further evidence for their overlapping in a continuous spectrum. j med genet ; : – . . sarafoglou k, funai ef, fefferman n, et al. short rib- polydactyly syndrome: more evidence of a continuous spec- trum. clin genet ; : – . . ho nc, francomano ca, van allen m. jeune asphyxiating thoracic dystrophy and short-rib polydactyly type iii (verma-naumoff) are variants of the same disorder. am j med genet ; : – . . elçioglu nh, hall cm. diagnostic dilemmas in the short rib-polydactyly syndrome group. am j med genet ; : – . . dagoneau n, goulet m, geneviève d, et al. dync h mutations cause asphyxiating thoracic dystrophy and short rib-polydactyly syndrome, type iii. am j hum genet ; : – . . merrill ae, merriman b, farrington-rock c, et al. ciliary abnormalities due to defects in the retrograde transport protein dync h in short-rib polydactyly syndrome. am j hum genet ; : – . . beales pl, bland e, tobin jl, et al. ift , which encodes a conserved intraflagellar transport protein, is mutated in jeune asphyxiating thoracic dystrophy. nat genet ; : – . . slavotinek am, stone em, mykytyn k, et al. mutations in mkks cause bardet-biedl syndrome. nat genet ; : – . . stone dl, slavotinek a, bouffard gg, banerjee-basu s, baxevanis ad, barr m, biesecker lg. mutation of a gene encoding a putative chaperonin causes mckusick-kaufman syndrome. nat genet ; : – . taiwan j obstet gynecol • december • vol • no c.p. chen, et al deletion of a genomic segment containing the cardiac troponin i gene knocks down expression of the slow troponin t gene and impairs fatigue tolerance of diaphragm muscle* deletion of a genomic segment containing the cardiac troponin i gene knocks down expression of the slow troponin t gene and impairs fatigue tolerance of diaphragm muscle* received for publication, may , , and in revised form, september , published, jbc papers in press, september , , doi . /jbc.m . han-zhong feng, bin wei, and jian-ping jin from the department of physiology, wayne state university school of medicine, detroit, michigan the loss of slow skeletal muscle troponin t (tnt) results in a recessive nemaline myopathy in the amish featured with lethal respiratory failure. the genes encoding slow tnt and cardiac tro- ponin i (tni) are closely linked. ex vivo promoter analysis sug- gested that the �-enhancer region of the slow tnt gene overlaps with the structure of the upstream cardiac tni gene. using trans- genic expression of exogenous cardiac tni to rescue the postnatal lethality of a mouse line in which the entire cardiac tni gene was deleted, we investigated the effect of enhancer deletion on slow tntgeneexpressioninvivoandfunctionalconsequences.thelev- els of slow tnt mrna and protein were significantly reduced in the diaphragm muscle of adult double transgenic mice. the slow tnt-deficient (sstnt-kd) diaphragm muscle exhibited atrophy and decreased ratios of slow versus fast isoforms of tnt, tni, and myosin. consistent with the changes toward more fast myofila- mentcontents,sstnt-kddiaphragmmusclerequiredstimulation at higher frequency for optimal tetanic force production. the sstnt-kd diaphragm muscle also exhibited significantly reduced fatigue tolerance, showing faster and more declines of force with slower and less recovery from fatigue as compared with the wild type controls. the natural switch to more slow fiber contents dur- ing aging was partially blunted in the sstnt-kd skeletal muscle. the data demonstrated a critical role of slow tnt in diaphragm function and in the pathogenesis and pathophysiology of amish nemaline myopathy. troponin t (tnt) is a subunit of the troponin complex in striated muscles. through interactions with troponin c, tropo- nin i (tni), and tropomyosin, tnt anchors the troponin com- plex to actin thin filament and plays a central role in the ca � regulation of muscle contraction ( ). three tnt genes are pres- ent in the vertebrates: cardiac tnt, fast skeletal muscle tnt, and slow skeletal muscle tnt (sstnt). they encode three mus- cle fiber type-specific tnt isoforms with differentiated expres- sion and function ( ). a nonsense mutation at codon glu in the sstnt gene (tnnt ) causes a postnatal lethal form of inherited nemaline myopathy in the amish ( ). this mutation prematurely termi- nates the sstnt polypeptide, and the c-terminally truncated sstnt-( – ) has a much decreased binding affinity for tro- pomyosin and fails to incorporate into the myofilaments ( ). as a result, the truncated sstnt protein was degraded and unde- tectable in the muscle of amish nemaline myopathy patients, consistent with the recessive phenotype of the disease ( ). accordingly, the pathogenesis and muscle pathophysiology of amish nemaline myopathy is due to the loss of slow tnt. the genes encoding the muscle type-specific tni and tnt isoforms are linked in tandem in three pairs in the vertebrate genome ( ). the cardiac tni (ctni) (tnni ) and sstnt genes are very closely linked. shown in ex vivo promoter analysis, the � upstream enhancer region of the sstnt gene overlaps with the structure of the ctni gene ( ). this struc- tural integration of ctni and sstnt genes suggested that a previously developed mouse line in which the entire tnni gene was deleted through embryonic stem cell gene targeting ( ) would have lost a large portion of the �-enhancer region of the tnnt gene (fig. ). although the tnni -deleted mouse line is a potentially useful model to study the phenotypes of sstnt deficiency, a major hurdle is that the tnni -deleted mice die – days after birth from heart failure when the fetal expression of slow skeletal muscle tni in the heart ceases ( ). this postnatal lethality pre- cluded functional examination on adult skeletal muscle for the phenotypes of sstnt deficiency. however, adult skeletal mus- cle is necessary for investigating the pathophysiology of amish nemaline myopathy because the fetal and neonatal expression of cardiac tnt in skeletal muscles ( ) may functionally com- pensate for the loss of sstnt in ( ). we previously developed two transgenic mouse lines overexpressing an n-terminal truncated ctni (ctni-nd) driven by an �-myosin heavy chain (mhc) promoter ( ). ctni-nd was originally found as a product of restricted pro- teolysis in cardiac adaptation to simulated microgravity, which selectively removes the ctni-specific n-terminal extension and leaves the conserved structure intact ( ). ctni-nd transgenic mice exhibit normal base-line life activ- ity with an increased relaxation of the cardiac muscle ( ). using this postnatally up-regulated ( ) transgene allele encoding a non-destructive exogenous tni, we successfully * this work was supported, in whole or in part, by national institutes of health grants ar- and hl- (to j.-p. j.). to whom correspondence should be addressed: dept. of physiology, wayne state university school of medicine, e. canfield, detroit, mi . tel.: - - ; fax: - - ; e-mail: jjin@med.wayne.edu. the abbreviations used are: tnt, troponin t; tni, troponin i; ctni, cardiac tni; ctni-ko, ctni knockout; ctni-nd, n-terminal truncated ctni; mab, mono- clonal antibody; mhc, myosin heavy chain; pbs, phosphate-buffered saline; sstnt, slow skeletal muscle tnt; sstnt-kd, sstnt knockdown. the journal of biological chemistry vol. , no. , pp. – , november , © by the american society for biochemistry and molecular biology, inc. printed in the u.s.a. journal of biological chemistry volume • number • november , this is an open access article under the cc by license. http://creativecommons.org/licenses/by/ . / rescued the postnatal lethality of the tnni gene-deleted mice ( ) to produce adult skeletal muscle for investigating the functional effects of sstnt deficiency. amish nemaline myopathy is a rapidly progressive disorder, with affected children dying primarily from respiratory insufficiency due to weakness of the respiratory mus- cle, usually in the second year of life ( ). these clinical features suggest a critical role of sstnt in diaphragm function. therefore, we examined in the present study the phenotypes of diaphragm muscle of adult dou- ble transgenic mice. the results revealed significantly decreased expression of sstnt mrna and protein. the sstnt deficiency pro- duced atrophy and a change toward more fast fibers in the diaphragm muscle. the slow tnt-defi- cient diaphragm muscle had significantly decreased tolerance to fatigue, demonstrating a critical role of sstnt in respiratory function. materials and methods tnni -deleted/ctni-nd double transgenic mice—as de- scribed recently ( ), we crossed transgenic mouse line ctni- nd# ( ) with heterozygotes of tnni -deleted mice ( ), pro- vided by dr. xupei huang (florida atlantic university). the genotyping of the double transgenic offspring was performed on genome dna isolated from tail biopsies using pcr, and the compensation for the loss of endogenous ctni by ctni-nd in cardiac muscle was confirmed by western blotting as described ( , ) (fig. ). the mice were maintained on a -h light/ -h dark cycle ( : a.m./ : p.m.) and standard pellet diet. except for aging studies, mice at age – months of both sexes were used for phenotype characterization. immediately after euthanasia with pentobarbital (intraperitoneally, mg/kg), diaphragm mus- cle strips were dissected from the o’clock and o’clock sectors with the dorsal side as and o’clock positions ( ) for use in the experiments to avoid the difference between different por- tions of the diaphragm. all animal procedures were approved by the institutional animal care and use committee. quantitative pcr—total rna was extracted from mouse diaphragm muscle samples using the trizol reagent (invitro- gen). integrity of the isolated rna was verified using agarose gel electrophoresis. one �g of each rna was reverse tran- scribed using an anchored oligo(dt) primer (tv ) at °c for h. quantitative pcr was carried out with power sybr green pcr master mix (applied biosystems) to determine the level of sstnt cdna relative to the level of glyceraldehyde- -phos- phate dehydrogenase, using an applied biosystems real time pcr system (applied biosystems, foster city, ca). the pcr primers (fig. a) were designed to target the common sequence for all three alternatively spliced isoforms of sstnt mrna ( ) without cross-reaction with fast skeletal muscle tnt cdna (fig. b). the quantitative pcr was carried out in a -�l volume with a -min preheating at °c followed by cycles of s at °c and s at °c. melting curve analysis was performed at the end to verify that there was no significant figure . targeted deletion of ctni gene in the mouse genome removes the � portion of the sstnt gene promoter-enhancer region. the ctni gene and sstnt gene are very closely linked in the mouse genome with the � portion of the sstnt gene promoter-enhancer region integrated in the structure of the ctni gene ( ). the targeted deletion of the entire ctni gene in a ctni knock-out mouse line ( ) had concurrently removed a segment containing �-enhancer(s) of the sstnt gene promoter, which would reduce transcriptional activity as indicated by significantly decreased transcriptional activity of the � . kb promoter construct versus the � . kb control in previous ex vivo experiments ( ). figure . rescue of ctni gene deletion mice by transgenic expression of ctni-nd. a, the two agarose gels demonstrated the pcr genotyping of dou- ble transgenic mice using two pairs of specific primers recognizing wild type and tnni deletion alleles, respectively ( ), to identify homozygote of ctni gene deletion (top) and the presence of �-mhc promoter-directed transgene encoding ctni-nd (bottom). b, the sds-gel and western blot using mab tni- showed that the cardiac muscle of adult double transgenic mice expressed ctni-nd in the absence of endogenous ctni, demonstrating a successful res- cue of the postnatal lethality of ctni-ko mice. the mab ct western blot showed normal expression of cardiac tnt (ctnt) in the double transgenic mouse cardiac muscle. slow troponin t and diaphragm fatigue november , • volume • number journal of biological chemistry formation of primer dimmers under the pcr conditions. dia- phragm samples from three wild type and three double trans- genic mice were examined, each with triplicate reactions. the results were analyzed using the ���ct method as per the applied biosystems user’s instructions. sds-page and western blot—endogenous ctni and exoge- nous ctni-nd in the heart and tnt and tni isoforms in the diaphragm muscle were examined by sds-page and western blotting. total protein was extracted from freshly isolated mus- cle tissue by homogenization in sds-page sample buffer con- taining % sds to inactivate tissue proteases. the samples were heated at °c for min, centrifuged at top speed in a micro- centrifuge for min to remove insoluble materials, and stored at � °c until use. the protein samples were resolved on % laemmli gels with an acrylamide/bisacrylamide ratio of : . the resulting gels were stained with coomassie blue r or electrically trans- ferred to nitrocellulose membrane using a semidry transfer apparatus (bio-rad). after blocking in tris-buffered saline containing % bovine serum albumin, the membranes were probed using anti-tni monoclonal antibody (mab) tni- , anti- slow and cardiac tnt mab ct ( ), or anti-fast tnt mab t (a gift from prof. jim lin, university of iowa) ( ). the first antibody reactions were in tris-buffered saline containing . % bovine serum albumin at °c overnight. the subsequent washes, alkaline phosphatase-labeled anti-mouse igg second antibody (santa cruz biotechnology, inc., santa cruz, ca) incubation, and -bromo- -chloro- -indolylphosphate/nitro blue tetrazolium substrate reaction were carried out as described previously ( ). the relative amounts of tnt and tni isoforms were quantified by two-dimensional densitometry of the blots. myosin heavy chain isoforms were examined as described previously ( ). the muscle protein samples were resolved on % sds-polyacrylamide gel containing % glycerol run in an icebox overnight. the gels were stained with coomassie blue r , and the relative amounts of mhc isoforms were quanti- fied by two-dimensional densitometry. hematoxylin-eosin staining of paraffin sections—after euthanasia of the mice, diaphragm tissue was rapidly excised and fixed in . % formaldehyde in phosphate-buffered saline (pbs). the diaphragm samples were embedded in paraffin with precise orientation and thin cross sections were cut and pro- cessed with hematoxylin-eosin staining at a service facility for light microscopic examinations. immunohistochemistry—mouse diaphragm muscle samples were rapidly frozen in a small drop of o.c.t. compound in isopentane at � °c and then embedded in o.c.t. for thin frozen cross sectioning. the sections were fixed in % acetone, % ethanol for min. after blocking in pbs containing . % tween (pbs-t) and % bovine serum albumin for min, the sections were incubated with % h o in pbs for min to inactivate endog- enous peroxidases. the sections were then washed with pbs-t three times and incubated with anti-mhc-i mab fa or sp / myeloma culture supernatant at °c overnight. after washes with pbs-t to remove unbound mab, the sections were incu- bated with horseradish peroxidase-labeled anti-mouse second- ary antibody at room temperature for h, washed again, and developed in , �-diaminobenzidine-h o substrate solution in the dark for – s. the substrate reaction was stopped by washes in mm tris-hcl, ph . , for six changes. after they were counterstained with hematoxylin for min and water washes, the sections were immersed in a drop of % glycerol in pbs and mounted with cytoseal. the slides were examined under a zeiss observer microscope and photo- graphed. fa -positive (type ) fibers were counted per unit of cross-sectional area for comparisons. contractility measurements—mouse diaphragm muscle was isolated immediately after euthanasia as above. immersed in krebs solution ( mm nacl, mm nahco , . mm kcl, . mm kh po , . mm mgso , . mm cacl , and mm d-glucose, ph . ) continuously bubbled with % o plus % co at room temperature, -mm-wide diaphragm muscle strips were dissected with a piece of central tendon at one end and a piece of the rib cage tissue at the other end. the rib cage end of the muscle strip was tied to a triangle-shaped stainless steel hook with a # - suture. the muscle strip was then mounted to the bottom pole of a vertical bath (radnoti) con- taining krebs bubbled with % o plus % co at °c, and the tendon end was tied to another stainless steel hook for con- nection to a motorized force transducer (model b-lr, aurora scientific, inc.). isometric twitch contractions were stimulated by -v field electrical pulses of . -ms duration using an aurora b stimulator. force of the muscle strip was measured, and length was controlled through the b-lr transducer, and data were collected via a digital controller a/d interface (model c, aurora scientific inc.). the mounted muscle strip was adjusted to an optimal length for the production of maximal twitch force during min of equilibration. -ms tetanic contractions were then stimu- lated every min with -hz -v field electrical pulses of . -ms duration for min. the force-frequency relationship was determined from isometric tetanic contractions stimulated with electrical pulses at various frequencies ( – hz). high frequency and intermittent fatigue protocols—the dia- phragm muscle was examined for high frequency fatigability in which tetanic contractions were stimulated with -v field electrical pulses of . -ms duration at the optimal frequency for s, followed by stimulations with electrical pulses of . -ms duration for s to bypass the membrane electrical fatigability ( ). the effect of bypassing membrane electrical fatigability was verified by pulse stimulations of . -ms duration for s followed by . -ms pulses for s. one minute after the high frequency fatigue contractions, -ms tetanic contractions were stimulated every min with -v field electrical pulses of . -ms duration at the optimal frequency for min to monitor the recovery. fatigability of the diaphragm muscle was also examined with intermittent tetanic contractions in which ms of tetanic contraction was evoked every s (a duty cycle of . %), as described previously ( , ) with -v field electrical pulses of . -ms duration at the optimal frequency for min. one minute after the intermittent fatigue contractions, min of recovery was monitored as above. slow troponin t and diaphragm fatigue journal of biological chemistry volume • number • november , all muscle strips used for the functional studies were recov- ered at the end of the experiment and examined by sds-page and western blot to verify sstnt and other myofilament pro- tein contents. data analysis—two-dimensional densitometry was used to quantify the sds-gel and western blots scanned at dots/ inch using image j software. using image j software, the average thickness of the diaphragm was measured in -�m intervals along the tissue sections, and the cross-sectional area of muscle fibers was calculated. the data are shown as mean � s.e., and statistical significance was determined using two-tailed unpaired student’s t test. difference was considered significant when p was � . . results decreased sstnt mrna in diaphragm muscle of adult dou- ble transgenic mice—quantitative pcr with primers recogniz- ing all three alternatively spliced isoforms of sstnt but not fast tnt mrna showed significantly decreased expression of sstnt mrna in diaphragm muscle of adult ctni-ko/ ctni-nd double transgenic mice as compared with that in wild type mouse diaphragm muscles (fig. ). therefore, the deletion of the � portion of the sstnt gene enhancer-promoter region integrated in the ctni gene resulted in a knockdown effect on the transcription of the sstnt gene in vivo. decreased sstnt protein in diaphragm muscle of young adult double transgenic mice—western blots using mab ct detected decreased sstnt protein (down by � %) in dia- phragm muscle of ctni-ko/ctni-nd double transgenic mice as compared with that in wild type control (fig. a). together with the decreased sstnt mrna, the results demonstrated that the double transgenic mice provide a model of sstnt deficiency for investigating the function of sstnt in adult diaphragm muscle. the double transgenic mice are referred as sstnt-kd in the follow- ing phenotype characterizations. corresponding to the decreased sstnt, western blots using mab t showed that fast tnt in the sstnt-kd diaphragm muscle was increased by � % as compared with the level in wild type mouse diaphragm muscle (fig. a). decreases in the slow isoforms of tni and mhc in sstnt-kd diaphragm—in – -month-old young adult sstnt-kd mice, western blots with mab tni- recognizing all tni isoforms showed that slow tni was signifi- cantly decreased (down by � %) and fast tni increased as com- pared with the wild type controls (fig. a). glycerol sds-page showed decreases of mhc-i in the adult sstnt-kd diaphragm muscle (� . % of total mhc versus � . % in wild type control diaphragm) (fig. b). trends of reduction of mhc-iia and potentially compensatory increases in mhc-iix and mhc-iib were also observed (fig. b). decreased number of type slow fibers and atrophy in sstnt-kd diaphragm muscle—type slow fibers in mouse diaphragm muscle were identified by staining frozen thin cross- sections using anti-mhc-i mab fa . the results detected a significantly decreased number of type fibers in – -month- old sstnt-kd mouse diaphragm muscle (� % of the wild type control normalized to unit area) (fig. a). correspond- ingly, fa -negative type fibers were increased by � % in the sstnt-kd diaphragm muscle as compared with that in wild type control. these changes resulted in a significant decrease in the ratio of slow/fast fiber in the young adult sstnt-kd dia- phragm muscle (� . ) versus that in wild type control (� . ) (fig. a). microscopic measurement of hematoxylin-eosin-stained paraffin cross-sections showed that the young adult sstnt-kd mouse diaphragm was thinner than that of wild type control (� . versus � . mm; fig. b), indicating muscle atrophy. comparing the cross-sectional area of type and type fibers, we further observed significant atrophy of type fibers (� % of the wild type control; fig. b). interestingly, the cross-sec- tional area of type fibers was also decreased in sstnt-kd diaphragm muscle although less severely than that of the type fibers (� % of the wild type controls; fig. b). higher stimulating frequency required for the production of maximum tetanic force in sstnt-kd diaphragm muscle—we studied the force-frequency relationships in tetanic contraction of wildtypeandsstnt-kdmousediaphragmmusclestrips.aright- figure . decreased expression of sstnt mrna in diaphragm muscle of double transgenic mice. a, for quantitative pcr, a pair of oligonucleotide primers were designed for a region identical in the three alterna- tively spliced isoforms of sstnt mrna. b, the agarose gel verified the specificity of the primers in pcr on cloned sstnt and fast skeletal muscle tnt (fstnt) cdna templates. c, quantifications using real-time pcr detected a significantly decreased level of sstnt mrna in the diaphragm muscle of ctni-ko/ctni-nd double transgenic mice in comparison with the wild type control. values are shown as mean � s.e., n � mice in each group. ***, p � . in two-tailed student’s t test. slow troponin t and diaphragm fatigue november , • volume • number journal of biological chemistry ward shift of the force-frequency relationship curve was found in young adult sstnt-kd diaphragm muscle as compared with wild type control (fig. ). the optimal frequencies at which the maxi- mal tetanic force was generated in wild type and sstnt-kd dia- phragm muscles were around and hz, respectively. this shift indicates an increased dependence of the sstnt-kd dia- phragm muscle on stimulating frequency in tetanic force produc- tion, consistent with a faster muscle phenotype. whereas most of the twitch contraction parameters did not show significant difference between the sstnt-kd and wild type mouse diaphragm muscle strips, the shorter time of ten- sion development (tpt and tp ) of the sstnt-kd diaphragm muscle was also consistent with a faster muscle phenotype (table ). although sstnt-kd diaphragm muscle produced lower tetanic force at the stimulating frequency optimal for wild typediaphragmmuscle(fig. ),tetaniccontractileforcegenerated at its own optimal frequency of stimulation was not significantly different from that of the wild type control (table ). unchanged electrical fatigability and increased myofila- ment fatigability of sstnt-kd diaphragm muscle—because electrical pulses of short duration induce skeletal muscle con- traction dependent on the propagation of action potential along the plasma membrane, we used a high frequency fatigue protocol to study the membrane electrical fatigability of the mouse diaphragm muscle strips. the results in fig. a showed that wild type and sstnt-kd young adult mouse diaphragm muscles had no difference in membrane fatigability during a -s tetanic contraction stimulated with field electrical pulse of . -ms duration at the optimal frequencies. switching to elec- trical pulse stimulations of -ms duration at the end of the pro- tocol significantly increased the tetanic force production of both wild type and sstnt-kd groups to the same extent (fig. a). the similar increases in force production upon bypassing membrane fatigability using brief wider electrical pulse stimu- lations ( ) indicated similar extents of myofilament fatigability in the wild type and sstnt-kd mouse diaphragm muscle strips when the contractile apparatus was protected by membrane fatigability. consistently, both wild type and sstnt-kd dia- phragm muscle strips completely recovered from the electrical fatigue treatment (data not shown). in a modified high frequency fatigue protocol using pulse stimuli of . -ms duration followed by a switch to . -ms pulse duration, we further investigated the fatigability of mouse dia- phragm muscle bypassing the membrane electrical depend- ence. the results in fig. b revealed a significant difference between sstnt-kd diaphragm muscle strips and the wild type controls. the faster and more extensive decreases in tetanic force of sstnt-kd diaphragm muscle indicated increased myofilament fatigability in comparison with the wild type con- trol. when the duration of electrical pulses was switched from . to . ms, there were small increases in tetanic force in both sstnt-kd and wild type groups, suggesting that the calcium mobilization capacity ( ) was not exhausted in the diaphragm muscle fibers when stimulated by -v field pulses of . -ms duration. increased fatigability and decreased recovery of sstnt-kd diaphragm muscle in intermittent tetanic contractions—the increased myofilament fatigability in sstnt-kd diaphragm muscle was further examined using a -min intermittent fatigue protocol. the results in fig. a showed that cycles of intermittent tetanic contraction at . % duty cycle ( -ms trains) stimulated with . -ms electrical pulses at optimal fre- quency exhibited force decreases to � . % of the prefatigue level in sstnt-kd diaphragm muscle as compared with figure . decreased sstnt and the slow isoforms of tni and mhc in dia- phragm muscle of young adult sstnt-kd mice. a, sds-gel and mab ct western blot densitometry detected significantly lower levels of sstnt pro- tein in diaphragm muscle of the sstnt-kd mice as compared with the wild type controls (down by . � . % normalized to the level of actin in accom- panying gels). correspondingly, mab t western blot and densitometry analysis detected higher levels of fast skeletal muscle tnt (fstnt) in the sstnt-kd diaphragm muscle than the wild type controls (up by . % nor- malized to the level of actin in accompanying gels). densitometry analysis of mab tni- western blot normalized to the amount of total tni found decreased the slow versus fast isoform ratio of tni in the sstnt-kd diaphragm muscle as compared with the wild type controls. b, glycerol-sds-gel and den- sitometry analysis normalized to total mhc showed a decreased level of mhc-i in sstnt-kd diaphragm muscle ( . % of total mhc versus . % in wild type control). *, p � . by two-tailed student’s t test. slow troponin t and diaphragm fatigue journal of biological chemistry volume • number • november , � . % in wild type control muscle strips. the -min recovery from fatigue treatment showed that tetanic force went back to � . % of the prefatigue level in wild type diaphragm muscle but only to � . % in the sstnt-kd group (fig. b). the data indicated that the slow tnt deficiency resulted in significantly increased myofilament fatigability in the young adult dia- phragm muscle of sstnt-kd mice. effects of sstnt-kd on contractility and myofilament pro- tein isoform contents of aging diaphragm—we further exam- ined diaphragm muscle from – -month-old mice for con- tractility and myofilament protein isoform expression to investigate the effect of sstnt-kd. the results in fig. a showed that aging wild type and sstnt-kd diaphragm muscles both switched toward slower fiber type, whereas the sstnt-kd group remained faster than the wild type control, consistent with the previous observation that aging skeletal muscles undergo a shift to more aerobic-oxidative metabolism in a slower twitching fiber population ( , ). slow tnt and slow tni remained low in aging sstnt-kd diaphragm muscle (fig. b). consistent with the shift toward slower muscle type, the slow/fast isoform ratio of tni increased in aging wild type diaphragm muscle but was insignificant in sstnt-kd diaphragm (fig. b). the level of mhc-iia increased in aging diaphragm muscles of wild type mice with a lesser degree in sstnt-kd group (fig. b). mhc-iix decreased during aging in both groups (fig. b). figure . atrophy and type fiber reduction of sstnt-kd diaphragm muscle. a, immunostaining of frozen sections using anti-mhc-i mab fa showed . � . % decrease in type fibers and . � . % increase of type fibers in sstnt-kd diaphragm muscle as compared with the wild type control. accordingly, the ratio of type /type fibers was much lower in sstnt-kd mouse diaphragm muscle ( . � . %) than that in wild type control muscles ( . � . %). b, hematoxylin-eosin-stained cross-sections showed that the thickness of adult sstnt-kd mouse diaphragm was smaller ( . � . mm) than that of wild type controls ( . � . mm), indicating muscle atrophy. morphological analysis further found that the cross-sectional area (csa) of type fibers was significantly decreased by . � . % in sstnt-kd diaphragm as compared with the wild type control. the cross-sectional area of type fibers in sstnt-kd diaphragm was also decreased, although by a lesser extent ( . � . %), as compared with the wild type control. *, p � . by two-tailed student’s t test. figure . shift of force-frequency relationship in sstnt-kd diaphragm muscle. tetanic force production was examined with electrical pulse stimu- lations of . -ms duration at – hz in -hz increments. the results showed that sstnt-kd diaphragm muscle had optimal frequency for maxi- mum force at hz, increased from hz for the wild type mouse dia- phragm muscle, consistent with increased fast fiber content. *, p � . by two-tailed student’s t test, n � mice in each group. table parameters of twitch and tetanic contractions data are presented as mean � s.e. n � mice for wild type and n � mice for sstnt-kd groups. mn, millinewtons; dt/dt, develop tension; tp , time to reach % peak tension; tpt, time to reach peak tension; tr , time to reach % relaxation. wild type sstnt-kd developed twitch tension (mn/mm ) . � . . � . �dt/dt (mn/s) . � . . � . �dt/dt (mn/s) � . � . � . � . tp (ms) . � . . � . a tpt (ms) . � . . � . b tr (ms) . � . . � . optimal tetanic tension (mn/mm ) . � . . � . a p � . in two-tailed student’s t test. b p � . in two-tailed student’s t test. slow troponin t and diaphragm fatigue november , • volume • number journal of biological chemistry in contrast to the significant decrease in mhc-iib in aging wild type mouse diaphragm muscle, the level of mhc-iib increased in sstnt-kd mouse diaphragm during aging (fig. b). although determination of its functional significance requires follow up studies, this finding indicated that the decrease in slow tnt induced adaptive gene regulations for the expression of other myofilament proteins with differentiated effects in young and aging skeletal muscles. discussion troponin t abnormalities have been found in causing dis- eases in both cardiac and skeletal muscles ( ). we and others have extensively studied the biochemical mechanisms for the structure-function relationship of tnt isoforms ( , ). it has been shown that slow tnt has differentiated binding affinity for tni and tropomyosin and confers higher ca � sensitivity in comparison with that of fast tnt ( , ). the present study demonstrated the importance of slow tnt in the function of skeletal muscle. our findings provide some new insights into the following aspects. the structural linkage of ctni and sstnt genes—cardiac tni and sstnt genes are very closely linked in the vertebrate genome. we previ- ously detected in ex vivo promoter analysis that the kb � . to � . upstream region of the sstnt gene, which overlaps with the � region of the ctni gene, contained major enhancer activity required for high level transcription of the sstnt gene ( ). the present study further demonstrated that deletion of the ctni gene between the two bamhi sites (fig. a) ( ), equivalent to the � . kb deletion of the upstream region of sstnt gene tested ex vivo, had a destructive effect in vivo on the promoter activity of the sstnt gene. because a single copy of a functional sstnt gene was sufficient in sustaining muscle function in heterozygote careers of amish nemaline myopathy ( ), the decreased level of sstnt in the diaphragm muscle of sstnt-kd mice indicated a more than % decrease of sstnt gene promoter activity due to deletion of the � . kb upstream genomic enhancer segment. although the sstnt gene is iden- tified to be the newest member evolved among the three muscle type tnt isoform genes ( ), its function is indispensable, and the loss of sstnt causes a lethal phenotype in amish nemaline myopathy ( ). this functional importance might have been responsible for the sstnt gene remaining closely linked to the upstream ctni gene during evolution, because a destruc- tion of either the �-coding exons of the ctni gene or the �-enhancer region of the sstnt gene would cause infantile lethality ( , ). the effects of sstnt deficiency on myofilament protein iso- forms and atrophy of diaphragm muscle—the primary sstnt deficiency resulted a series of secondary changes in the dia- phragm muscle of young adult sstnt-kd mice. in addition to an increased ratio of fast tnt, sstnt-kd diaphragm muscle showed decreased slow tni and a trend of increase in fast tni. mhc-i was decreased together with trends of increases in mhc-iix and mhc-iib. therefore, the primary deficiency of sstnt resulted in reductions of the slow isoforms of both thin and thick filament proteins. the decreased slow/fast isoform figure . high frequency fatigue analysis. a, a high frequency fatigue protocol was tested on diaphragm muscle strips with field electrical stimuli of . -ms duration for s followed by . -ms stimuli for s. the results showed no difference in electrical fatigability between the sstnt-kd and wild type diaphragm muscles. switch of the electrical pulses from . -ms duration to . -ms duration generated similar partial recovery of the contractile force in both groups, suggesting similar protection of the muscle by electrical fatigue. b, high frequency fatigue analysis was modified to bypass the membrane dependence using electrical stimuli of . -ms duration for s followed by stimuli of . -ms duration for s. the results showed significantly higher myofilament fatigability of sstnt-kd diaphragm muscle as compared with the wild type control. *, p � . by two-tailed student’s t test, n � mice in each group. figure . intermittent fatigability analysis. a, an intermittent fatigue protocol was applied to examine wild type and sstnt-kd mouse diaphragm muscle strips. tetanic contractions stimulated at optimum frequency with -ms/ -s trains for min demonstrated force declines to . � . % in wild type and to . � . % in sstnt-kd diaphragm muscle strips. b, during a -min recovery, the force of wild type diaphragm muscle returned to . � . % of the prefatigue level, whereas that of sstnt-kd diaphragm muscle returned to . � . % of the prefatigue level. *, p � . by two-tailed student’s t test, n � mice in each group. slow troponin t and diaphragm fatigue journal of biological chemistry volume • number • november , ratio of myofilament proteins formed a basis of the fast-ward change of fiber types. because the diaphragm is a mixed fiber muscle ( ), the decreases in the slow isoform myofilament proteins could reflect decreases in the number and/or size of slow fibers as well as increases in the number and/or size of fast fibers as a com- pensation for the decreases in sstnt. our results first showed reductions of both number and size of type slow muscle fibers, which would directly contribute to the atrophy of sstnt-kd mouse diaphragm. although the number of type fibers increased to compensate for the decreased number type fibers, the cross-sectional area of type fibers in sstnt-kd diaphragm was decreased (fig. b). therefore, the atrophy of type fibers that are the major fiber type in mouse diaphragm muscle (fig. a) further contributed to the atrophy of sstnt-kd diaphragm muscle. the mechanism for sstnt defi- ciency to cause atrophy of fast type fibers in diaphragm muscle remains to be investigated. the effects of slow tnt defi- ciency on diaphragm myofilament protein contents exhibited aging related changes. although both wild type and sstnt-kd diaphragm muscles turned toward a slower fiber type in aging (fig. ), an inter- esting adaptation to sstnt-kd was that mhc-iib was significantly decreased in wild type but increased in sstnt-kd diaphragm muscle. this adaptive sustainment of mhc- iib that produces the fastest in vitro motility among mhc isoforms ( ) mayhavecontributedtothelessslow- wardshiftoftheagingsstnt-kddia- phragm muscle (fig. a). the finding that decreased expression of slow tnt resulted in a series of decreases in slow tni and mhc-i indicated a consequence of fiber type switching. the finding that a change in one thin filament protein in skeletal muscle would cause multiple secondary changes in gene regulation suggests an experimental model to investigate the highly plastic nature of skeletal muscle during physiological and pathological adaptations. slow tnt deficiency reduces fatigue tolerance of diaphragm muscle—it has been established that stimulating skeletal muscle contraction with an electrical pulse of short duration ( . – . ms) significantly depends on the propagation of action potential along the plasma membrane ( ). in contrast, electrical pulses with longer duration of . ms can propagate directly to the transverse tubular membranes, in which a majority of the l-type calcium channels are pres- ent, to activate calcium mobilization mechanisms with less dependence on plasma membrane action potential propaga- tion, thus bypassing the fatigue mechanism of plasma mem- brane inexcitability ( ). therefore, we applied a high fre- quency fatigue stimulation protocol to dissect plasma membrane electrical fatigability and myofibril fatigability. the results clearly demonstrated that sstnt deficiency significantly increased myofilament fatigability with un- changed plasma membrane excitability. the increased myofilament fatigability of the sstnt-kd mouse diaphragm muscle was further demonstrated using an intermittent tetanic fatigue protocol mimicking the respiratory contractions. the results confirmed the physiological impor- figure . effects of sstnt-kd in aging diaphragm muscle. a (left), twitch and tetanic force measurements found no significant difference between young and aging diaphragm muscles from wild type and sstnt-kd mice. right, normalized twitch contraction curves revealed that wild type and sstnt-kd mouse diaphragm muscles both shifted toward slower fiber type in aging, whereas the sstnt-kd group remained faster than the wild type control. b (top), densitometry analysis of ct , t , and tni- mab western blots showed that slow tnt remained low in aging diaphragm muscle of sstnt-kd mice along with the trend of higher fast tnt contents and decreased slow versus fast isoform ratio of tni as compared with the wild type controls. bottom, glycerol- sds-gel and densitometry analysis showed that mhc-i went down in aging diaphragm muscle with much more severity in the sstnt-kd group than in the wild type control. mhc-iia was increased during aging to a lesser degree in sstnt-kd than that in wild type diaphragms. there was a trend of decrease in mhc-iix in both wild type and sstnt-kd diaphragm during aging. mhc-iib was significantly decreased in aging wild type mouse diaphragm muscle, whereas aging sstnt-kd diaphragm had an increase in mhc-iib. *, p � . aging versus young groups of the same genotype; #, p � . , sstnt-kd versus wild type in the aging group, analyzed by two-tailed student’s t tests. mn, millinewtons. slow troponin t and diaphragm fatigue november , • volume • number journal of biological chemistry tance of sstnt in diaphragm function. the fatigability of sstnt-kd diaphragm muscle shown by normalized force pro- duction (fig. ) demonstrated that in addition to the overall muscle atrophy, the qualitative changes of decreased number of slow fibers and slow isoforms of myofilament proteins severely impaired the fatigue tolerance of diaphragm muscle. in addi- tion to explaining the terminal respiratory failure seen in virtu- ally all amish nemaline myopathy patients, the ctni-ko/ ctni-nd double transgenic mouse model provides a highly valuable experimental system to study the pathogenesis, patho- physiology, and treatment of this devastating and lethal genetic disease. acknowledgments—we thank hui wang for pcr genotyping of trans- genic mice, dr. xupei huang (florida atlantic university) for provid- ing the ctni-ko mouse line, dr. jim lin (university of iowa) for pro- viding the t mab, and dr. jeffrey robbins (university of cincinnati) for the mouse cardiac �-mhc gene promoter used in the construction of ctni-nd transgenic mouse lines. references . perry, s. v. ( ) j. muscle res. cell motil. , – . jin, j. p., zhang, z., and bautista, j. a. ( ) crit. rev. eukaryot. gene expr. , – . johnston, j. j., kelley, r. i., crawford, t. o., morton, d. h., agarwala, r., koch, t., schäffer, a. a., francomano, c. a., and biesecker, l. g. ( ) am. j. hum. genet. , – . wang, x., huang, q. q., breckenridge, m. t., chen, a., crawford, t. o., morton, d. h., and jin, j. p. ( ) j. biol. chem. , – . jin, j. p., brotto, m. a., hossain, m. m., huang, q. q., brotto, l. s., nosek, t. m., morton, d. h., and crawford, t. o. ( ) j. biol. chem. , – . huang, q. q., and jin, j. p. ( ) j. mol. evol. , – . huang, x., pi, y., lee, k. j., henkel, a. s., gregg, r. g., powers, p. a., and walker, j. w. ( ) circ. res. , – . jin, j. p. ( ) biochem. biophys. res. commun. , – . barbato, j. c., huang, q. q., hossain, m. m., bond, m., and jin, j. p. ( ) j. biol. chem. , – . yu, z. b., zhang, l. f., and jin, j. p. ( ) j. biol. chem. , – . subramaniam, a., gulick, j., neumann, j., knotts, s., and robbins, j. ( ) j. biol. chem. , – . feng, h. z., hossain, m. m., huang, x., and jin, j. p. ( ) arch. biochem. biophys. , – . brotto, m. a., biesiadecki, b. j., brotto, l. s., nosek, t. m., and jin, j. p. ( ) am. j. physiol. cell physiol , c –c . jin, j. p., chen, a., and huang, q. q. ( ) gene , – . lin, j. j. ( ) proc. natl. acad. sci. u.s.a. , – . feng, h. z., biesiadecki, b. j., yu, z. b., hossain, m. m., and jin, j. p. ( ) j. physiol. , – . feng, h. z., chen, m., weinstein, l. s., and jin, j. p. ( ) j. biol. chem. , – . cairns, s. p., chin, e. r., and renaud, j. m. ( ) j. appl. physiol , – . yu, z. b., gao, f., feng, h. z., and jin, j. p. ( ) am. j. physiol. cell physiol. , c –c . van lunteren, e., and moyer, m. ( ) respiration , – . larsson, l., grimby, g., and karlsson, j. ( ) j. appl. physiol. , – . gannon, j., doran, p., kirwan, a., and ohlendieck, k. ( ) eur j. cell biol. , – . gomes, a. v., barnes, j. a., harada, k., and potter, j. d. ( ) mol. cell. biochem. , – . reiser, p. j., westfall, m. v., schiaffino, s., and solaro, r. j. ( ) am. j. physiol. , h –h . chong, s. m., and jin, j. p. ( ) j. mol. evol. , – . degens, h., and larsson, l. ( ) j. musculoskelet. neuronal interact. , – . cairns, s. p., taberner, a. j., and loiselle, d. s. ( ) j. appl. physiol. , – slow troponin t and diaphragm fatigue journal of biological chemistry volume • number • november , deletion of a genomic segment containing the cardiac troponin i gene knocks down expression of the slow troponin t gene and impairs fatigue tolerance of diaphragm muscle* materials and methods results discussion references wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ wp-p m- .ebi.ac.uk params is empty sys_ exception wp-p m- .ebi.ac.uk no params is empty exception params is empty / / - : : if (typeof jquery === "undefined") document.write('[script type="text/javascript" src="/corehtml/pmc/jig/ . . /js/jig.min.js"][/script]'.replace(/\[/g,string.fromcharcode( )).replace(/\]/g,string.fromcharcode( ))); // // // window.name="mainwindow"; .pmc-wm {background:transparent repeat-y top left;background-image:url(/corehtml/pmc/pmcgifs/wm-nobrand.png);background-size: auto, contain} .print-view{display:block} page not available reason: the web page address (url) that you used may be incorrect. message id: (wp-p m- .ebi.ac.uk) time: / / : : if you need further help, please send an email to pmc. include the information from the box above in your message. otherwise, click on one of the following links to continue using pmc: search the complete pmc archive. browse the contents of a specific journal in pmc. find a specific article by its citation (journal, date, volume, first page, author or article title). http://europepmc.org/abstract/med/ research open access modeled nitrate levels in well water supplies and prevalence of abnormal thyroid conditions among the old order amish in pennsylvania briseis aschebrook-kilfoy , , , sonya l heltshe , john r nuckols , mona m sabra , alan r shuldiner , , braxton d mitchell , matt airola , theodore r holford , yawei zhang and mary h ward * abstract background: nitrate is a widespread contaminant of drinking water supplies, especially in agricultural areas. nitrate intake from drinking water and dietary sources can interfere with the uptake of iodide by the thyroid, thus potentially impacting thyroid function. methods: we assessed the relation of estimated nitrate levels in well water supplies with thyroid health in a cohort of , old order amish residing in lancaster, chester, and lebanon counties in pennsylvania for whom thyroid stimulating hormone (tsh) levels were measured during - . nitrate measurement data ( - ) for , wells in the study area were obtained from the u.s. geological survey and we used these data to estimate concentrations at study participants’ residences using a standard linear mixed effects model that included hydrogeological covariates and kriging of the wells’ residuals. nitrate levels estimated by the model ranged from . mg/l to . mg/l n-no -, with a median value of . mg/l, which was used as the cutpoint to define high and low nitrate exposure. in a validation analysis of the model, we calculated that the sensitivity of the model was % and the specificity was %. tsh levels were used to define the following outcomes: clinical hyperthyroidism (n = ), clinical hypothyroidism (n = ), subclinical hyperthyroidism (n = ), and subclinical hypothyroidism (n = ). results: in women, high nitrate exposure was significantly associated with subclinical hypothyroidism (or = . ; % ci: . - . ). nitrate was not associated with subclinical thyroid disease in men or with clinical thyroid disease in men or women. conclusions: although these data do not provide strong support for an association between nitrate in drinking water and thyroid health, our results do suggest that further exploration of this hypothesis is warranted using studies that incorporate individual measures of both dietary and drinking water nitrate intake. keywords: nitrate, thyroid conditions, tsh, old order amish, water pollution, drinking water background nitrate is a widespread contaminant of drinking water supplies, especially in agricultural areas. the thyroid can concentrate univalent anions such as nitrate (no -), which subsequently interferes with the uptake of iodide (i-) by the thyroid and may cause reduced production of thyroid hormones [ - ]. the result of the reduced thyr- oid hormone production is a compensatory increase in thyroid stimulating hormone (tsh), a sensitive indicator of thyroid function. high and low tsh levels reflect hypo- and hyperfunction of the thyroid gland, respec- tively. chronic stimulation of the thyroid gland by excessive tsh has been shown in animals to induce the development of hypertrophy and thyroid disease, as well as hyperplasia, followed by adenoma and carcinoma [ ]. at least two epidemiological studies have shown high nitrate intake to be associated with thyroid dysfunction, * correspondence: wardm@mail.nih.gov occupational and environmental epidemiology branch, division of cancer epidemiology and genetics, national cancer institute, national institutes of health, department of health and human services, rockville, md, usa full list of author information is available at the end of the article aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / © aschebrook-kilfoy et al; biomed central ltd. this is an open access article distributed under the terms of the creative commons attribution license (http://creativecommons.org/licenses/by/ . ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. mailto:wardm@mail.nih.gov http://creativecommons.org/licenses/by/ . including hypertrophy and changes in tsh levels [ , ]; however, the impact of nitrate intake on specific thyroid conditions, including hyperthyroidism and hypothyroid- ism is not clear. elevated concentrations of nitrate in groundwater ori- ginate from a number of sources, including leaking sep- tic tanks, animal waste, and overuse of nitrogen fertilizers [ ]. nitrate is very soluble and it readily migrates to groundwater. nitrate contamination of groundwater is an exposure of interest as groundwater serves as the primary drinking water supply for over % of the rural population and % of the total popu- lation of north america [ ]. although the u.s. environ- mental protection agency (epa) maximum contaminant level (mcl) for nitrate as nitrogen (nitrate-n) is mg/ l in public water sources [ ], the levels in private wells are not regulated and the task of monitoring is left to residential owners, presenting opportunities for high levels of human exposure. the u.s. geological survey (usgs) estimates that nitrate concentrations exceed the epa’s standard in approximately % of agricultural and rural areas, exposing over million people in the united states [ ]. the mcl for nitrate in drinking water was established to protect against methemoglobinemia, or “blue baby syndrome,” to which infants are especially susceptible. however, this health guideline has not been thoroughly evaluated for other health outcomes such as thyroid disease and cancer. the old order amish community is a population characterized by a homogeneous lifestyle, including intensive farming practices and low mobility, and has been relatively unchanged across generations [ ]. in areas where many large dairy and poultry farms are con- centrated, the land area for disposal of animal wastes is limited. this situation often results in overloading the available land with manure, with considerable nitrogen ending up in groundwater or surface water [ , ]. lan- caster county in southeastern pennsylvania is an exam- ple of such an area where extensive dairy enterprises with high stocking rates prevail. high levels of nitrate in the groundwater [ ] suggest that the amish are a poten- tially highly exposed population. given the biological effects of nitrate intake on the thyroid, investigation of whether the amish in this area exhibit an increased pre- valence of thyroid dysfunction and thyroid disease is of interest. the aim of this study is to assess whether nitrate con- centrations in well water are associated with levels of tsh and thyroid disease. our goal was to use survey data on nitrate levels in well-water obtained from the usgs to conduct a cross-sectional analysis of the asso- ciation between nitrate exposure and thyroid health. this study builds upon several ongoing studies of dia- betes, obesity, osteoporosis, hypertension, and cardiovascular disease in the amish, initiated in at the university of maryland [ - ]. methods study population subjects included in this analysis were , old order amish aged years and older from lancaster, chester, and lebanon counties, pennsylvania, for whom thyroid health was assessed through measure- ment of thyroid stimulating hormone (tsh) levels in their prior participation in one or more studies of health by investigators at the university of maryland, baltimore [ - ]. we excluded participants whose residences were located outside of lancaster, chester, or lebanon counties (n = ) due to sparse nitrate measurement data, and persons who reported use of thyroid medication (n = ) leaving a total of , persons ( , females and , males) in the final analysis. nearly all of the enrolled individuals are des- cendants of a small number of amish who settled in lancaster county, pennsylvania, in the mid-eighteenth century [ , , ]. this study was approved by the institutional review boards of the university of mary- land and the national cancer institute. all subjects included in this analysis received a stan- dardized examination at the amish research clinic in strasburg, pennsylvania or in the participant’s home during the time period - . as part of this exam- ination, a fasting blood sample was collected from which tsh levels were measured with the siemens tsh assay (immulite ; deerfield, il) according to the manufacturer’s instructions. the method is a solid- phase, chemiluminescent, competitive analog immu- noassay and has analytical sensitivity of . μiu/ml and upper limit of μiu/ml of tsh. residential street addresses were geocoded using the teleatlas (lebanon, nh) matchmaker sdk profes- sional version . (october ), a spatial database of roads, and a modified version of a microsoft visual basic version . program issued by teleatlas to match input addresses to the spatial database. we assigned residence location using an offset of ft from the street centerline. addresses that were not successfully geocoded were checked for errors using interactive geocoding techniques. where only a street intersection was available for the residential location ( . % of residences), we assigned the geographic loca- tion of the residence to the middle of the intersection. where only a zip code was available for the residential location ( . % of residences), we assigned the geo- graphic location of the residence to the centroid of the zip code. the geocoded location of the residences and the geographic boundary of our study area is shown in figure . aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of historical assessment of nitrate levels a survey of nitrate levels in well water in lancaster, chester, and lebanon counties was carried out from - by the usgs. the usgs collected data from active monitoring wells in the county and from a well- owner monitoring program conducted by the state department of natural resources in collaboration with pennsylvania state university. water samples ( - ul) from all programs were measured for nitrate using ion chromatography with a detection limit of . mg/ l as nitrate-n [ ]. a total of , unique wells were measured in our study area during the survey period. the measurements were not from wells chosen at random but included monitoring data reported by the usgs and samples from individual well owners. a total of , wells had measurement; wells had measurements; wells had measurements; and wells had more than measurements. figure shows the geographic distribution of the wells in our study area in relation to the location of the , participant residences the median distance between a residence and the closest measured well was . m (interquartile range: . - . m). the median nitrate concentration by season ranged from . mg/l as nitrate-nitrogen (hereafter mg/ l) for summer months (interquartile range: - . mg/l) to . mg/l in spring months (interquartile range: - . mg/l). for wells with multiple measures, the median difference between the maximum and minimum value was . mg/l (iqr: . - . ). the mean of the measure- ments was used for wells with multiple measurements when we did the exposure modeling (see below). prediction of nitrate levels in well water of participants’ residences we assumed the drinking water supply for participants to be a well located at their reported residence. to esti- mate nitrate levels at this location, we first determined whether nitrate concentrations in the usgs wells varied across the types of aquifers in the study area (table ). maps of the primary aquifers were obtained from the usgs (created from m pixel satellite imagery) [ ]. there are five principal aquifers in the study area (fig- ure ). the differentiation of aquifer type is important because the transport of contaminants in groundwater is generally confined to within these hydrogeologic figure location of participant residences and wells with nitrate measures in study area. aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of boundaries. using the usgs national land cover data set (nlcd) [ ], we also evaluated nitrate levels in the usgs wells across thirteen types of land use (pas- ture, deciduous forest, row crops, low intensity residen- tial, mixed forest, commercial or industrial, evergreen forest, high intensity residential, water, quarries/gravel pits, transitional, urban grasses, and woody wetlands) (table and figure ). we found limited temporal var- iation by season and by decade within each of the five aquifer types over the well measurement period, as well as across the land use classifications used in our analysis (figure ). we used a standard linear mixed effects statistical model to develop a predictive model including the vari- ables principal aquifer and land use. nitrate levels were log normally distributed so we modeled the natural logarithm of the concentration. spatial correlation existed in the nitrate measurements even after covariate adjustment [ ], so we performed kriging on the wells’ residuals from the predictive nitrate model. if a well had more than one measurement, the mean of the measure- ments and its residual was used in the modeling. we assumed that the residuals in the model have a single, normally distributed mean structure centered at zero, allowing for universal kriging across the study area. the kriging procedure predicts a ‘residual’ for each study participant based on a weighted average of the neigh- boring wells’ residuals (within the respective aquifer and land use category). for comparison, we also applied the kriging procedure based on the weighted average of the five neighboring wells’ residuals. for example, if for a particular region of our study area, the regression model tends to underestimate the true observed log nitrate values (positive residuals) then individuals in this region will be given a representative positive residual prediction that is added to the log nitrate estimate based on the individuals’ covariates and the regression parameters. the antilog gives an unbiased predictor of median nitrate value resulting in estimates that are more robust to outlier observations than a mean estimator. nitrate levels estimated by the model ranged from . mg/l to . mg/l, with a median of . mg/l and a mean of . mg/l (sd = . mg/l). the predicted nitrate level mean was similar to the mean of the measured values used for modeling ( . mg/l; sd = . mg/l) although the standard deviation was smaller. model validation the validity of the predictive model was assessed for validation wells by comparing the predicted nitrate table distribution of nitrate concentration in us geological survey wells by aquifer type and categories of land use in lancaster, lebanon, and chester counties, from - well location nitrate mg/l (no -n) aquifer n median mean std. dev. minimum maximum piedmont and blue ridge crystaline-rock . . . < . . piedmont and blue ridge carbonate rock . . . . . early mesozoic basin . . . < . . valley and ridge carbonate rock . . . < . . valley and ridge . . . . . land use n median mean std. dev. minimum maximum pasture . . . < . . deciduous forest . . . . . row crop . . . . . low intensity residential . . . . . mixed forest . . . < . . commercial or industrial . . . . . evergreen forest . . . . . high intensity residential . . . . . water . . . . . quarry mine gravel pit . . . . . transitional . . . . . urban grasses . . . . . woody wetland . . . . . overall . . . < . . spatial classification is based on the national land cover data set; , usgs [ref ]. aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of concentration to the observed nitrate concentrations. the validation wells were randomly selected from wells with usgs measurements from - . the limited date range was chosen to be consistent with the time frame of the nlcd land use database used in our analyses. we evaluated model sensitivity, specificity, and percent agreement using the median of the predicted nitrate level ( . mg/l as nitrate-n) as a cutpoint for high and low exposure categories. the sensitivity of the model was % and the specificity was %. the spear- man’s rank correlation between the continuous pre- dicted and measured concentrations was . . cross tabulation of predicted and observed nitrate concentra- tions by quartiles of the measured nitrate concentrations demonstrated a percent agreement of % (table ). data analysis we used generalized linear regression to assess the asso- ciation between estimated nitrate levels in well water and continuous tsh measures. tsh levels were also used to define disease status based on clinical guidelines [ ]. a “normal” range for tsh was defined as . - miu/ml. a tsh level of > miu/ml- miu/ml was defined as subclinical hypothyroidism (n = ) and more than miu/ml was defined as clinical hypothyr- oidism (n = ). a tsh value of . miu/ml to . miu/ml was defined as subclinical hyperthyroidism (n = ) and less than . miu/ml was defined as clinical hyperthyroidism (n = ). all of the disease definitions are based on the assumption that tsh was marking pri- mary disease in the thyroid since other causes of tsh abnormalities, e.g., primary pituitary disease, thyroid hormone resistance, are very uncommon by comparison [ ]. estimated nitrate levels in participants’ drinking water were categorized into quartiles and by the median of the predicted well nitrate level ( . mg/l). we evaluated the association of the nitrate levels with each thyroid disease group using unconditional logistic regression to com- pute the odds ratio (or) and % confidence intervals. all models were adjusted for potential confounding fac- tors including age (continuous) and bmi ((normal (< figure principle aquifers in the three study area counties in southeastern pennsylvania. data from principal aquifers of the conterminous united states, hawaii, puerto rico, and the u.s. virgin islands: u.s. geological survey. madison, wi; aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of kg/m ), overweight ( - kg/m ), and obese (> kg/ m )). we conducted analyses stratified by gender as well as for men and women combined. tests of linear trend were performed by modeling the continuous nitrate esti- mates. a p-value < . was considered significant and all data analyses were conducted using sas version . . we conducted two sensitivity analyses. in the first analysis, we excluded participants whose residences were located within boundaries of the u.s. census places (uscb ) and were therefore possibly con- nected to public water supplies with nitrate levels below the mcl ( % of study population). in the second ana- lysis, we excluded those whose residence was greater than m from the nearest well with measurement data ( %) to reduce the probability of measurement error. we recomputed the or for subclinical hypothyr- oidism after correcting for exposure misclassification (i. e. by reclassifying false positives and false negatives) using our estimates of sensitivity and specificity and the prevalence of exposure ( %). results the mean tsh level was . miu/ml ( . miu/ml for women and . miu/ml for men). based on the tsh measures, the prevalence of clinical hyperthyroidism was . % and the prevalence of subclinical hyperthyroidism was . %. the prevalence of clinical hypothyroidism was . % and the prevalence of subclinical hypothyroidism was . %. the mean age of participants was years (range: - ). the mean bmi was . kg/m for men and . figure land use in in the three study area counties in southeastern pennsylvania. data from principal aquifers of the conterminous united states, hawaii, puerto rico, and the u.s. virgin islands: u.s. geological survey. madison, wi; table comparison of quartiles of the predicted nitrate concentration by quartiles of the measured nitrate concentrations, wells used for the model validation quartiles of the predicted nitrate concenytration quartiles of measured nitrate concentration q q q q total q q q q total percent agreement = % aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of kg/m for women (table ). the average bmi of males with clinical hyperthyroidism was lower than that of those in the general study population but females with clinical hyperthyroidism had a slightly higher average bmi than the general study population. the average age of persons with thyroid disease was higher in all cate- gories compared to the group with normal tsh levels. although smoking data was not available for the entire study population, among those for whom these data were collected, less than % of women ( of ) and % of males ( of ) reported ever smoking tobacco. adjusting for age and bmi, and modeling tsh con- centration as the outcome, we observed no significant relationship with nitrate concentration. the b coefficient for men and women combined was - . (p-value = . ), - . for men (p-value = . ), and - . for women (p-value = . ). modeling the dichotomized high/low nitrate predictor, the b coefficient for men and women combined was - . (p-value = . ), - . for men (p-value = . ), and - . for women (p-value = . ). neither clinical or subclinical hyperthyroidism were associated with nitrate concentrations (table ), although the number of cases was low (n = cases of clinical hyperthyroidism and n = cases of subclinical hyperthyroidism). the results for hypothyroidism are presented in table . overall, there was a borderline significant positive association between subclinical hypothyroidism and high nitrate exposure (age- and bmi-adjusted or = . ; % ci: . - . ), with further analyses revealing the association to be present in women (or = . ; % ci: . - . ), but not in men (or = . ; % ci: . - . ). however, the association among women did not increase monotonically with increasing quartiles of esti- mated nitrate concentrations in their water supply expo- sure. the interaction for gender and nitrate was not significant (p-interaction = . ). no significant associations were observed for clinical hypothyroidism. the results were consistent when stratified by age and bmi. the results were unchanged in a sensitivity analysis that excluded participants whose residences were possi- bly connected to public water supplies (data not shown). the exclusion of persons who reside more than m from the nearest well also did not result in a material change in our results (data not shown), although it did decrease the odds ratio for high nitrate intake and sub- clinical hypothyroidism in women from . - . . we also estimated the or for subclinical hypothyroidism among women in the absence of exposure misclassifica- tion as . (versus . observed). discussion our results provide limited support for an association between nitrate levels in private wells and subclinical hypothyroidism among women but not men. with esti- mated exposure to nitrate in drinking water at or above . mg/l, we observed a significantly increased preva- lence of subclinical hypothyroidism in women, although there was not a monotonic increase with increasing quartiles of nitrate. these findings of an increased pre- valence of hypothyroidism among women are consistent with our hypothesis, namely that the competitive inhibi- tion of iodide uptake associated with increased nitrate exposure would result in decreased systemic active thyr- oid hormone (as indicated by increased tsh levels). we did not observe an association for clinical hypothyroid- ism, but the number of cases in this group was much lower. the mean tsh level in our study population was . μiu/ml in women and . μiu/ml in men. these levels are higher than tsh levels in the general us population surveyed by the national health and nutrition examina- tion survey (nhanes) from - [ ], in which the means among women and men were . μiu/ml and . μiu/ml, respectively. the prevalence of table characteristics of the study population by thyroid disease status normal subclinical hyperthyroidism clinical hyperthyroidism subclinical hyperthyroidism clinical hyperthyroidism total overall (n, %) ( . %) ( . %) . %) ( . %) ( . %) , male (%) . . . . . age in years (mean) . . . . . . bmi males kg/m (mean) . . . . . . bmi females kg/m (mean) . . . . . . ever smoker (%)* . . . . . . includes persons who reside in lancaster, chester, or lebanon counties and excludes persons younger than or who report use of thyroid medications. *smoking status is based on . % of the study population aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of hypothyroidism and hyperthyroidism in the us popula- tion is estimated to be . % ( . % clinical and . % sub- clinical) and . % ( . % clinical and . % subclinical), respectively [ ], compared with . % and . % in our study population. however, as the risk of thyroid disease increases with age, the higher prevalence in the amish could be partially due to the older age distribution in this study (mean = . years) population compared to the age distribution of the nhanes study population (mean = . years). when hypothyroidism is compared by sex in this study population and the nhanes popu- lation, the prevalence is . -times more common in amish women than men whereas it is - times more common in women than men in the us population [ ]. in previous epidemiological studies, investigators have identified a relationship between nitrate contamination of water supplies and thyroid dysfunction and thyroid disease. in a cross-sectional study of school children liv- ing in areas of slovakia with high and low nitrate expo- sure via drinking water, children in the high nitrate area had increased thyroid volume and increased frequency of signs of subclinical thyroid disorders (thyroid hypoe- chogenicity by ultrasound, increased tsh level and positive anti-thyroid peroxidase (tpo)) [ ]. the nitrate levels ranged from . to . mg/l (as nitrate-nitro- gen) in the highly polluted area and were < . mg/l nitrate-nitrogen in the low nitrate area. similarly, inves- tigators in the netherlands conducted a cross-sectional table odds ratios (ors) and % confidence intervals (cis) for the prevalence of hyperthyroidism associated with estimated nitrate levels in residential wells overall men women mg/l nitrate-nitrogen cases or %ci cases or %ci cases or %ci clinical hyperthyroidism low nitrate (< . ) . . . high nitrate (= > . ) . ( . - . ) . ( . - . ) . ( . - . ) subclinical hyperthyroidism low nitrate (< . ) . . . high nitrate (= > . ) . ( . - . ) . ( . - . ) . ( . - . ) subclinical hyperthyroidism q [ . - . ] . . . q [ . - . ] . ( . - . ) . ( . - . ) . ( . - . ) q [ . - . ] . ( . - . ) . ( . - . ) . ( . - . ) q [ . - . ] . ( . - . ) . ( . - . ) . ( . - . ) p-trend . . . models adjusted for age and bmi; model with men and women combined is also adjusted for gender table odds ratios (ors) and % confidence intervals (cis) for the prevalence of hypothyroidism associated with nitrate levels in residential wells overall men women mg/l nitrate-nitrogen cases or %ci cases or %ci cases or %ci clinical hypothyroidism low nitrate (< . ) . . . high nitrate (= > . ) . ( . - . ) . ( . - . ) . ( . - . ) subclinical hypothyroidism low nitrate (< . ) . . . high nitrate (= > . ) . ( . - . ) . ( . - . ) . ( . - . ) subclinical hypothyroidism q [ . - . ] . . . q [ . - . ] . ( . - . ) . ( . - . ) . ( . - . ) q [ . - . ] . ( . - . ) . ( . - . ) . ( . - . ) q [ . - . ] . ( . - . ) . ( . - . ) . ( . - . ) p-trend . . . models adjusted for age and bmi; model with men and women combined is also adjusted for gender; nitrate concentrations in mg/l aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of study of women who obtained their drinking water from public supplies and private wells with varying nitrate levels [ ]. they observed a dose-dependent increase in the volume of the thyroid associated with increasing nitrate concentrations in drinking water from a combi- nation of public and private supplies, with nitrate levels ranging from . mg/l to . mg/l (as nitrate-nitro- gen). women with nitrate levels exceeding . mg/l as nitrate-nitrogen had a significant increased prevalence of thyroid gland hypertrophy. our results for women are consistent with the findings in slovakia and indir- ectly support the associations observed in the nether- lands. however, the reason for our finding of in women but not men is unclear particularly since men consume more water than women on average [ ]. it is possible that women may be more sensitive to exposures that perturb the thyroid as indicated by their higher preva- lence of thyroid disease [ ]. a previous epidemiologic investigation of the associa- tion of nitrate intake from public water supplies and diet with the risk of self-reported hypothyroidism and hyperthyroidism was conducted in a cohort of , older women in iowa [ ]. the investigators found no association between the prevalence of hypo- or hyperthyroidism and nitrate concentrations in public water supplies; nor was there an association for those who were using private wells. however, intake of nitrate from the diet can be a primary source of exposure when drinking water nitrate levels are below the mcl of mg/l nitrate-n [ - ]. in the iowa study, increasing intake of nitrate from dietary sources was associated with an increased prevalence of hypothyroidism (or q = . ; % ci = . - . , p for trend = . ) while no association was observed with hyperthyroidism [ ]. in addition to consumption of tap water, people living in areas with high nitrate concentration in their water supplies may be exposed through their use of water for cooking, irrigation of crops used as a food source, and through milk products from local farm animals. nitrate is a natural component of plants and is found at high concentrations in leafy vegetables, such as lettuce and spinach, and some root vegetables, such as beets [ ]. the lack of dietary questionnaire data in our study is a limitation since estimates of well-water nitrate were below the mcl of mg/l for % of participants [ - ]. the lack of dietary information in general likely resulted in exposure misclassification in our study population. a strength of this study is the availability of valid mea- sures of tsh using study participant serum samples. although only one measure was available for each study participant, the use of tsh rather than self-reported thyroid disease is likely to more accurately define thyr- oid disease. although factors such as pregnancy and obesity can affect tsh, the levels are a reliable index of the biological activity of thyroid hormones. anti-tpo was not available, which can also be helpful in the diag- nosis of thyroid disease as an autoimmune disease. in addition to measuring tsh and anti-tpo in blood, future studies would be further strengthened by the use of ultrasound technology to determine thyroid volume, which could provide insight into nitrate exposure levels that may cause hypertrophy of the thyroid. an additional strength of our study was that we vali- dated our exposure metric and characterized the sensi- tivity and specificity based on the median observed versus predicted nitrate level in wells monitored by the usgs in our study area. specificity was high ( %) indi- cating that our model classified those with lower nitrate levels accurately. the lower sensitivity ( %) indicated that the model underestimated nitrate concentrations for those with higher levels. the result of this misclassi- fication, if nondifferential by disease status [ ], would be to attenuate ors as we demonstrated for subclinical thyroid disease. our study was limited by a lack of information about the study population’s complete residential history. however, we know that the majority of this amish cohort reside in rural areas, with low relocation rates, and that it is typically the women who relocate to live in the homes or on the same land as their husband’s family [ ]. most amish men would subsequently have a stable residential history and exposure to nitrate con- tamination of well water over time. it is not clear to what degree a complete residential history would have affected our findings for both men and women. it is possible that the association we observed between sub- clinical hypothyroidism in women was attenuated due to this source of misclassification. the well measurements were also not randomly selected but represent data col- lected by usgs and individuals that potentially reside in areas with higher levels of nitrate than those who did not receive monitoring attention from usgs or who were not aware of a problem in their well. we identified a large standard deviation for the wells with repeat mea- sures and were unable to fully explore the reasoning beyond having a small proportion ( %) of repeat sam- ples. additional data on well depth, other hydrogeologi- cal factors, or why multiple samples were taken could provide more insight into this observed variation, but was not available. our study is also limited by the fact that we did not have data on actual water supply source to the resi- dence, nor personal water consumption. because most residences were located outside of areas served by public water utilities, we assumed the drinking water supply for participants was a well located at their residence. we did not have data on tap water consumption, and thus aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of the approximate daily intake, which can be an important variable in determining exposure. most people in the united states drink about . - l of water per day [ ]. similarly, because of the attention given to water con- tamination in the lancaster area, it is possible that some study participants obtain their water from sources that have been purified via reverse osmosis or from bottled water. these limitations would clearly affect the expo- sure estimates and result in misclassification of the exposure. future work in this area would be enhanced by the assessment of multiple contaminants present in water sources and the general environment that could be simultaneously affecting thyroid health. multiple envir- onmental pollutants from industrial as well as agricul- tural activities may be an important consideration for future investigation. of particular interest is pesticides as there is increasing evidence of their ability to alter thyroid hormone homeostasis, causing thyroid dysfunc- tion and thyroid disease [ , ]. the varied effects of these chemicals on thyroid function could affect study findings. determination of these exposures should be a future study design consideration. furthermore, the effect of contamination from other univalent anions which interfere with the uptake of iodide by the thyroid should be considered in future investigation into the effects of nitrate in drinking water. for example, perchlorate, the oxidizer for solid rocket fuel and a component of some fertilizers, is found in both food and water [ ], and interferes with iodide uptake much like nitrate. similarly, thiocyanate, another univalent anion that causes thyroid dysfunction, is a metabolite from tobacco smoke and is found in certain foods [ - ]. conclusions the present study provides limited evidence that nitrate in residential well water is associated with subclinical hypothyroidism in women but not men. future studies that include validated biomarkers, as well as individual level nitrate exposure estimates of dietary and drinking water intakes, and an assessment of co-contaminants, are needed to provide information about the relevance of nitrate intake and thyroid disease. list of abbreviations tsh: thyroid stimulating hormone; no -: nitrate; epa: u.s. environmental protection agency; mcl: maximum contaminant level; nitrate-n: nitrate as nitrogen; usgs: united states geological survey; nlcd: national land cover data set; nhanes: national health and nutrition examination survey acknowledgements we gratefully acknowledge our amish liaisons and field workers and the extraordinary cooperation and support of the amish community, without whom these studies would not be possible. the study was supported by research grants from the american federation of aging research (f.s.c.), nih r dk (a.r.s.) the american diabetes association (a.r.s.), the baltimore veterans administration geriatric research and education clinical center (grecc), and the university of maryland general clinical research center, grant m rr , the general clinical research centers program, national center for research resources (ncrr), nih. this research was supported in part by the intramural research program of the nih/national cancer institute, including an interagency personnel agreement between nci and colorado state university. partial funding was also provided by the mid-atlantic nutrition and obesity research center (grant p dk ). briseis aschebrook-kilfoy was supported by nih training grant tu ca . author details occupational and environmental epidemiology branch, division of cancer epidemiology and genetics, national cancer institute, national institutes of health, department of health and human services, rockville, md, usa. yale school of public health, yale university, new haven, connecticut, usa. biostatistics branch, division of cancer epidemiology and genetics, national cancer institute, national institutes of health, department of health and human services, rockville, md, usa. department of environmental and radiological health sciences, colorado state university, fort collins, co, usa. endocrine service, department of medicine, memorial sloan-kettering cancer center, new york, ny, usa. division of endocrinology, diabetes and nutrition, department of medicine, university of maryland school of medicine, baltimore, md, usa. geriatrics research and education clinical center, veterans administration medical center, baltimore, md, usa. westat, rockville, md, usa. department of health studies, university of chicago, chicago, il, usa. authors’ contributions ba-k: participated in the conceptualization of the study and the exposure assessment design; conducted data analysis and drafted the manuscript; sh: conducted the nitrate modeling work and gave important intellectual input for the data analysis, and helped draft the manuscript; jn: conceptualized the exposure assessment approach, advised in the creation of the hydrogeological covariates and exposure modeling, and provided important intellectual content; ms: advised on the medical interpretation of the findings, and provided important intellectual content; as: as the pi of the cohort study, as designed the study, oversaw the recruitment of subjects and conducted much of the primary data gathering; bm: as a co-pi, bm participated in the design of the study and ongoing study efforts, the interpretation of the results for the nitrate investigation, and drafting of the manuscript; ma: obtained the hydrogelogical dataset, gis analysis, reviewed the manuscript, and revised it critically for important intellectual content; th: helped conceptualize the study, provided statistical support and modeling guidance, and provided important intellectual content for the manuscript; yz: helped conceptualize the study and provided important intellectual content for the manuscript; mw: mentored in the conceptualization of the study, participated in study design, method development and data analysis, helped in the drafting of the manuscript. all authors assisted in the interpretation of results and contributed towards the final version of the manuscript. all authors read and approved the final manuscript. competing interests the authors declare that they have no competing interests. received: september accepted: february published: february references . dai g, levy o, carrasco n: cloning and characterization of the thyroid iodide transporter. nature , : - . . eskandari s, loo dd, dai g, levy o, wright em, carrasco n: thyroid na symporter. mechanism, stoichiometry, and specificity. the journal of biological chemistry , : - . . van sande j, massart c, beauwens r, schoutens a, costagliola s, dumont je, wolff j: anion selectivity by the sodium iodide symporter. endocrinology , : - . . tonacchera m, pinchera a, dimida a, ferrarini e, agretti p, vitti p, santini f, crump k, gibbs j: relative potencies and additivity of perchlorate, thiocyanate, nitrate, and iodide on the inhibition of radioactive iodide aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract uptake by the human sodium iodide symporter. thyroid , : - . . hiasa y, kitahori y, kitamura m, nishioka h, yane k, fukumoto m, ohshima m, nakaoka s, nishii s: relationships between serum thyroid stimulating hormone levels and development of thyroid tumors in rats treated with n-bis-( -hydroxypropyl)nitrosamine. carcinogenesis , : - . . tajtáková m, semanová z, tomková z, szökeová e, majoros j, rádiková z, seböková e, klimes i, langer p: increased thyroid volume and frequency of thyroid disorders signs in schoolchildren from nitrate polluted area. chemosphere , : - . . van maanen jm, van dijk a, mulder k, de baets mh, menheere pc, van der heide d, mertens pl, kleinjans jc: consumption of drinking water with high nitrate levels causes hypertrophy of the thyroid. toxicology letters , : - . . power jf, schepers js: nitrate contamination of groundwater in north america. agriculture, ecosystems & environment , : - . . u.s. epa (u.s. environmental protection agency): national primary drinking water regulations, final rule. fed reg , : - . . nolan bt, hitt kj, ruddy bc: probability of nitrate contamination of recently recharged groundwaters in the conterminous united states. environ sci technol , : - . . braxton mitchell, personal communication. . . ward mh, dekok tm, levallois p, brender j, gulis g, nolan bt, vanderslice j, international society for environmental epidemiology: workgroup report: drinking-water nitrate and health–recent findings and research needs. environmental health perspectives , : - . . hsueh wc, mitchell bd, aburomia r, pollin t, sakul h, gelder-ehm m, michelsen bk, wagner mj, st jean pl, knowler wc, burns dk, bell cj, shuldiner ar: diabetes in the old order amish: characterization and heritability analysis of the amish family diabetes study. diabetes care , : - . . streeten ea, ryan ka, mcbride dj, pollin ti, shuldiner ar, mitchell bd: the relationship between parity and bone mineral density in women characterized by a homogeneous lifestyle and high parity. the journal of clinical endocrinology and metabolism , : - . . mitchell bd, mcardle pf, shen h, rampersaud e, pollin ti, bielak lf, jaquish c, douglas ja, roy-gagnon mh, sack p, naglieri r, hines s, horenstein rb, chang yp, post w, ryan ka, brereton nh, pakyz re, sorkin j, damcott cm, o’connell jr, mangano c, corretti m, vogel r, herzog w, weir mr, peyser pa, shuldiner ar: the genetic response to short-term interventions affecting cardiovascular function: rationale and design of the heredity and phenotype intervention (hapi) heart study. the american heart journal , : - . . allen em, hsueh wc, sabra mm, pollin ti, ladenson pw, silver kd, mitchell bd, shuldiner ar: a genome-wide scan for autoimmune thyroiditis in the old order amish: replication of genetic linkage on chromosome q . -q . . the journal of clinical endocrinology and metabolism , : - . . agarwala r, biesecker lg, hopkins ka, francomano ca, schaffer aa: software for constructing and verifying pedigrees within large genealogies and an application to the old order amish of lancaster county. genome research , : - . . cross he: population studies and the old order amish. nature , : - . . methods of analysis by the u.s. geological survey national water quality laboratory–determination of inorganic and organic constituents in water and fluvial sediments: u.s. geological survey open-file report. edited by: fishman mj , - , p. . vogelmann je, howard sm, yang l, larson cr, wylie bk, van driel jn: completion of the ’s national land cover data set for the conterminous united states. photogrammetric engineering and remote sensing , : - . . moran p: notes on continuous stochastic phenomena. biometrika , : - . . surks mi, ortiz e, daniels gh, sawin ct, col nf, cobin rh, franklyn ja, hershman jm, burman kd, denke ma, gorman c, cooper rs, weissman nj: subclinical thyroid disease: scientific review and guidelines for diagnosis and management. jama , : - . . food and nutrition board; panel on dietary reference intakes for electrolytes and water: dietary reference intakes for water, potassium, sodium, chloride, and sulfat. washington, dc: national academy press; . . hollowell jg, staehling nw, flanders wd, hannon wh, gunter ew, spencer ca, braverman le: serum tsh, t( ), and thyroid antibodies in the united states population ( to ): national health and nutrition examination survey (nhanes iii). the journal of clinical endocrinology and metabolism , : - . . ward mh, kilfoy ba, weyer pj, anderson ke, folsom ar, cerhan jr: nitrate intake and the risk of thyroid cancer and thyroid disease. epidemiology , : - . . gangolli sd, van den brandt pa, feron vj, janzowsky c, koeman jh, speijers gj, spiegelhalder b, walker r, wisnok js: nitrate, nitrite and n- nitroso compounds. european journal of pharmacology , : - . . chilvers c, inskip h, caygill c, bartholomew b, fraser p, hill m: a survey of dietary nitrate in well-water users. int j epidemiol , : - . . gustafson p, le nd, saskin r: case-control analysis with partial knowledge of exposure misclassification probabilities. biometrics , : - . . mcknight gm, duncan cw, leifert c, golden mh: dietary nitrate in man: friend or foe? the british journal of nutrition , : - . . heller ke, sohn w, burt ba, eklund sa: water consumption in the united states in - and implications for water fluoridation policy. j public health dent , : - . . boas m, feldt-rasmussen u, skakkebaek ne, main km: environmental chemicals and thyroid function. eur j endocrinol , : - , review. . goldner ws, sandler dp, yu f, hoppin ja, kamel f, levan td: pesticide use and thyroid disease among women in the agricultural health study. . srinivasan a and viraraghavan t. perchlorate: health effects and technologies for its removal from water resources. int j environ res public health , : - . . gibbs jp, van landingham c: urinary perchlorate excretion does not predict thyroid function among pregnant women. thyroid , : - . . charnley g: perchlorate: overview of risks and regulation. food and chemical toxicology , : - . . steinmaus c, miller md, howd r: impact of smoking and thiocyanate on perchlorate and thyroid hormone associations in the - national health and nutrition examination survey. environmental health perspectives , : - . . braverman le, he x, pino s, cross m, magnani b, lamm sh, kruse mb, engel a, crump ks, gibbs jp: the effect of perchlorate, thiocyanate, and nitrate on thyroid function in workers exposed to perchlorate long-term. the journal of clinical endocrinology and metabolism , : - . . vogelmann je, howard sm, yang l, larson cr, wylie bk, van driel jn: completion of the ’s national land cover data set for the conterminous united states. photogrammetric engineering and remote sensing , : - . doi: . / - x- - cite this article as: aschebrook-kilfoy et al.: modeled nitrate levels in well water supplies and prevalence of abnormal thyroid conditions among the old order amish in pennsylvania. environmental health : . submit your next manuscript to biomed central and take full advantage of: • convenient online submission • thorough peer review • no space constraints or color figure charges • immediate publication on acceptance • inclusion in pubmed, cas, scopus and google scholar • research which is freely available for redistribution submit your manuscript at www.biomedcentral.com/submit aschebrook-kilfoy et al. environmental health , : http://www.ehjournal.net/content/ / / page of http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract http://www.ncbi.nlm.nih.gov/pubmed/ ?dopt=abstract abstract background methods results conclusions background methods study population historical assessment of nitrate levels prediction of nitrate levels in well water of participants’ residences model validation data analysis results discussion conclusions acknowledgements author details authors' contributions competing interests references original paper growth charts for children with ellis–van creveld syndrome sabine verbeek & paul h. c. eilers & kate lawrence & raoul c. m. hennekam & florens g. a. versteegh received: july /accepted: august /published online: september # the author(s) . this article is published with open access at springerlink.com abstract ellis–van creveld (evc) syndrome is a congenital malformation syndrome with marked growth retardation. in this study, specific growth charts for evc patients were derived to allow better follow-up of growth and earlier detection of growth patterns unusual for evc. with the use of observations of evc patients ( males, females), growth charts for males and females from to years of age were derived. longitudinal and cross-sectional data were collected from an earlier review of growth data in evc, a database of evc patients, and from recent literature. to model the growth charts, the gamlss package for the r statistical program was used. height of evc patients was compared to healthy children using dutch growth charts. data are presented both on a scale for age and on a scale for the square root of age. compared to healthy dutch children, mean height standard deviation score values for male and female evc patients were − . and − . , respectively. the present growth charts should be useful in the follow-up of evc patients. most importantly, early detection of growth hor- mone deficiency, known to occur in evc, will be facilitated. keywords growth . body height . ellis–van creveld syndrome . growth charts introduction ellis–van creveld syndrome (evc) (omim # ) is a skeletal dysplasia characterized by short limbs, short ribs, postaxial polydactyly, and dysplastic nails and teeth. sixty percent of affected individuals have a congenital cardiac defect, most commonly an atrial septum defect [ , ]. the syndrome is named after the physicians ellis and van creveld, who described the first cases in [ ]. evc is uncommon, the incidence in the general population being per , , live births [ ]. in the old amish population, the incidence is much higher, with per , live births and as many as % of the amish people are carrier of the mutation [ ]. the disorder follows an autosomal recessive pattern of inheritance. mutations in two genes (evc and evc ) on chromosome p have been identified to be responsible for the evc phenotype [ ]. after birth, children with evc present with short limbs. the shortening of the limbs increases from proximal to distal, with the most pronounced shortening of the distal interphalangeal bones. a recent study showed that growth hormone deficiency can play a role in the retarded growth in at least some evc patients [ ]. the same study showed variation of the growth retardation from − . to − . standard deviation score (sds) of average height. the s. verbeek (*) : f. g. a. versteegh department of pediatrics, groene hart ziekenhuis, p.o. box , gouda, the netherlands e-mail: sabineverbeek@hotmail.com f. g. a. versteegh e-mail: florens.versteegh@ghz.nl p. h. c. eilers department of medical statistics, erasmus medical centre, rotterdam, the netherlands k. lawrence springburn health centre, glasgow, scotland, uk r. c. m. hennekam institute for child health, great ormond street hospital for children, ucl, london, uk r. c. m. hennekam department of pediatrics, academic medical center, amsterdam, the netherlands eur j pediatr ( ) : – doi . /s - - - authors argued that growth charts specifically for evc patients would be useful, as has been found for other entities that go along marked growth retardation, such as down syndrome, turner syndrome, and achondroplasia [ , , , ]. such dedicated growth charts allow better follow-up of growth and earlier detection of growth patterns unusual for the entity involved. this urged us to create growth charts specifically for children with evc. methods patients growth data of evc patients were available for analysis. data were gathered from different sources. for our previous study [ ], we gathered measurements of patients. from these studies, four patients were known to receive therapy for growth hormone deficiency and were therefore excluded. all cases from literature that were molecularly proven were added; patients of whom molec- ular results were not available were included if the diagnosis was thought to be right by an experienced clinical geneticist. one hundred and three measurements of patients from these studies were used for analysis. secondly, we used the database of an evc website (www.ellisvancreveld.co.uk). this database provided data points of subjects with evc. in all latter patients, the diagnosis was molecularly proven. there was no overlap between subjects of this database and subjects from our previous studies. thirdly, we added data from literature published after our study was concluded [ , , ]. this provided us eight measurements of six patients. in total, usable data were available of patients— data points of males and data points of females. statistical analysis to model the growth charts, the gamlss package for the r statistical program (r development core team, ) was used [ ]. gamlss models the conditional distribu- tion of height for a given age by means of three curves: one for the mean, one for the (logarithm of the) standard deviation, and one for a power transformation to normality. to find the best balance between complexity and fit to the data, transformation to normality was not performed, and linear trends (in the square root of age) were taken for the mean curve and the logarithm of the standard deviation. with this model, percentile curves were computed. to compare height of evc patients with height in healthy children, we presented the data in digital dutch growth curves [ ]. results a total of measurements on subjects were used for the analysis. of subjects, we gathered more than , and of subjects, we gathered more than measurements (table ). of the female subjects, were aged between and years and subjects were above years. we assumed height of these patients would be comparable with -year-old patients and therefore treated these data points as such. indeed, if leaving these data points outside the analysis, the growth curves did not change. of the male subjects, were aged between and years and were above years of age. again, we treated the data of these patients as if they were -year-old patients. as in the females, the growth curve did not change if these data points were left out of the analysis. data from the literature were published between and . ethnicity differed since data were gathered from all over the world. most of the patients (n= ) were of caucasian descent, were hispanic, patients had other ethnic backgrounds (african-american, jewish, turkish, chinese, mongolian, japanese, indian), and of patients from literature, the ethnicity was not known. consanguinity of parents in patients collected from the literature was mostly unknown to us. in the uk database, none of the parents was consanguineous. the growth charts were derived for males from to years of age (figs. , , and ) and females from to (figs. , , and ). transformation of age to a different scale, by taking square roots, led to almost linear curves (figs. and ). figures and show growth charts for boys and girls, respectively, with all the collected data points. figures and show the same growth charts without these data points, to allow use for patient care purposes. curves are made for the specific age group. the statistical program used here does not make it possible to extrapolate data points to adulthood. height sds values for evc patients are shown on dutch growth charts for boys (fig. ) and girls (fig. ) of – table patient characteristics age group (years) male data points (n)/ male patients in age group (n) female data points (n)/ female patients in age group (n) – / / – / / – / / – / / > / / total / / data points of male and female patients per age group eur j pediatr ( ) : – http://dx.doi.org/http://www.ellisvancreveld.co.uk years. sds values vary between + . and − . , with a mean of − . sd for male evc patients and − . sd for female evc patients [ ]. discussion syndrome-specific growth charts have been developed for several syndromes, such as down syndrome, turner syndrome, and williams syndrome [ , , ]. these charts have proven to be a helpful tool in the medical care of these children. growth in evc is known to be impaired, with an estimated deviation of − . to − . from standard growth [ ]. until recently, it was assumed to be explainable merely because of the skeletal dysplasia. however, growth hormone deficiency has been reported in patients with evc and its frequency remains uncertain [ ]. this may aggravate the growth retardation. to detect growth hor- mone deficiency and other disorders that cause additional growth deviation in evc patients, specific growth charts for square root of age (in years) h e ig h t (c m ) males . . age fig. growth chart for boys from to years of age with ellis–van creveld syndrome (n= ). curves presented as height (centimeters) versus square root of age (years) age [years] h e ig h t (c m ) males fig. growth chart for boys from to years of age with ellis–van creveld syndrome (n= ). curves presented as height (centimeters) versus age (years) square root of age (in years) h e ig h t (c m ) females . . age fig. growth chart for girls from to years of age with ellis–van creveld syndrome (n= ). curves presented as height (centimeters) versus square root of age (years) h e ig h t (c m ) females age [years] fig. growth chart for girls from to years of age with ellis–van creveld syndrome (n= ). curves presented as height (centimeters) versus age (years) eur j pediatr ( ) : – children with evc should be of great value. we present here growth charts for males and females with evc. since the data set was small, a simple model was aimed for. transformation of age to a different scale, by taking square roots, led to almost linear curves. furthermore, it spreads out the data for the younger age group, which makes it more clarifying. we treated the data as cross-sectional although a number of measurements come from the same individuals. there is no provision in the statistical program gamlss for grouped data. the alternative would be to select one measurement per individual or leave repeated measure- ments out completely. both choices were unattractive. because our analysis is mainly descriptive, we believe that little harm was done by using all data. to compare growth of evc patients to healthy children, data were shown in dutch growth charts. mean growth deviation was − . sd for male patients and − . sd for female patients, comparable to our previous study [ ]. a drawback of the present study is the possible influence of the secular trend in growth. data were gathered from h e ig h t (c m ) males age [years] fig. growth chart for boys from to years of age with ellis–van creveld syndrome age [years] h e ig h t (c m ) females fig. growth chart for girls from to years of age with ellis–van creveld syndrome age [years] h e ig h t (c m ) males fig. dutch growth charts for boys ( – years, blue line) with height sds of boys with ellis–van creveld syndrome ( – years, dotted line) age [years] h e ig h t (c m ) females fig. dutch growth charts for girls ( – years, blue line) with height sds of girls with ellis–van creveld syndrome ( – years, dotted line) eur j pediatr ( ) : – publications between and . nowadays, boys and girls are taller than in the s [ , ]. although the proportion of data from more than years ago is relatively small ( data points), the influence of the secular trend cannot be ruled out. another drawback is that data were gathered from all over the world. consequently, the here presented growth charts represent different cultures and ethnicities, which can differ greatly [ , , ]. we reasoned, however, that in evc the growth retardation would be that extreme that this would easily outweigh the ethnic growth differences and we therefore used all data. when compared to regular growth charts, the here presented growth charts differ in form. it seems that growth does not slow down to a complete horizontal curve after puberty. the reason for this is the statistical approach used in this study. since the data set was small, the formation of a splined curve was not possible. regular growth charts show an s-shaped or “splined” curve. these curves flatten in adolescence, leading to an end height or target height. the here presented growth charts are developed with the use of another statistical approach, used for smaller databases [ ]. this method does not allow extrapo- lation of the curve. hence, the here presented growth charts can only be used in a specific age group. more research with a larger database would be necessary to develop growth charts with a splined curve. open access this article is distributed under the terms of the creative commons attribution noncommercial license which per- mits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. references . abeles ai, tobias jd ( ) anaesthetic implications of ellis– van creveld syndrome. j clin anesth : – . de onis m, onyango aw, borghi e et al ( ) development of a who growth reference for school-aged children and adolescents. bull world health organ : – . digilio mc, marino b, ammirati a et al ( ) cardiac malforma- tions in patients with oral–facial–skeletal syndromes: clinical similarities with heterotaxia. am j med genet : – . ellis rw, van creveld sa ( ) syndrome characterized by ectodermal dysplasia, polydactyly, chondro-dysplasia and con- genital morbius cordis: report of three cases. arch dis child : – . gawlik a, gawlik t, augustyn m et al ( ) validation of growth charts for girls with turner syndrome. int j clin pract : – . gohlke b, woelfle j ( ) growth and puberty in german children: is there still a positive secular trend? dtsch arztebl int : – . growth analyser junior ( ) . ide se, ortiz ri, francomano ca, polymeropoulos mh ( ) exclusion of the msx homeobox gene as the gene for the ellis–van creveld syndrome in the amish. j human genet : – . lejarragaa h, del pinoa m, fanoa v et al ( ) growth references for weight and height for argentinian girls and boys from birth to maturity. incorporation of data from the world health organisation from birth to years and calculation of new percentiles and lms values. arch argent pediatr : – . martin nd, smith wr, cole tj, preece ma ( ) new height, weight and head circumference charts for british children with williams syndrome. arch dis child : – . ogden cl, kuczmarski rj, flegal km et al ( ) centers for disease control and prevention growth charts for the united states: improvements to the national center for health statistics version. pediatrics : – . polymeropoulos mh, ide se, wright m et al ( ) the gene for the ellis van creveld syndrome is located on p . genomics : – . rigby ra, stasinopoulos dm ( ) generalized additive models for location, scale and shape. appl statist : – . roelants m, hauspie r, hoppenbrouwers k ( ) references for growth and pubertal development from birth to years in flanders, belgium. ann hum biol : – . stoll c, dott b, roth mp, alembik y ( ) birth prevalence rates of skeletal dysplasias. clin genet : – . styles m, cole t, dennis j, preece m ( ) new cross sectional stature, weight, and head circumference references for down’s syndrome in the uk and republic of ireland. arch dis child : – . thapa r, mukhopadhyay m, bhattacharya a ( ) discordance for ellis–van creveld syndrome in twins. singapore med j : – . trotter tl, hall jg, committee on genetics ( ) health supervision for children with achondroplasia. pediatrics : – . versteegh fga, buma sa, costin g et al ( ) growth hormone analysis and treatment in ellis–van creveld syndrome. am j med genet a: – growth data of children with proven evc can be sent to evc@crydee.plus.com. eur j pediatr ( ) : – http://evc@crydee.plus.com growth charts for children with ellis–van creveld syndrome abstract introduction methods patients statistical analysis results discussion references << /ascii encodepages false /allowtransparency false /autopositionepsfiles true /autorotatepages /none /binding /left /calgrayprofile (gray gamma . ) /calrgbprofile (srgb iec - . ) /calcmykprofile (iso coated v % \ eci\ ) /srgbprofile (srgb iec - . ) /cannotembedfontpolicy /error /compatibilitylevel . /compressobjects /off /compresspages true /convertimagestoindexed true /passthroughjpegimages true /createjdffile false /createjobticket false /defaultrenderingintent /perceptual /detectblends true /detectcurves . /colorconversionstrategy /srgb /dothumbnails true /embedallfonts true /embedopentype false /parseiccprofilesincomments true /embedjoboptions true /dscreportinglevel /emitdscwarnings false /endpage - /imagememory /lockdistillerparams true /maxsubsetpct /optimize true /opm /parsedsccomments true /parsedsccommentsfordocinfo true /preservecopypage true /preservedicmykvalues true /preserveepsinfo true /preserveflatness true /preservehalftoneinfo false /preserveopicomments false /preserveoverprintsettings true /startpage /subsetfonts false /transferfunctioninfo /apply /ucrandbginfo /preserve /useprologue false /colorsettingsfile () /alwaysembed [ true ] /neverembed [ true ] /antialiascolorimages false /cropcolorimages true /colorimageminresolution /colorimageminresolutionpolicy /warning /downsamplecolorimages true /colorimagedownsampletype /bicubic /colorimageresolution /colorimagedepth - /colorimagemindownsampledepth /colorimagedownsamplethreshold . /encodecolorimages true /colorimagefilter /dctencode /autofiltercolorimages true /colorimageautofilterstrategy /jpeg /coloracsimagedict << /qfactor . /hsamples [ ] /vsamples [ ] >> /colorimagedict << /qfactor . /hsamples [ ] /vsamples [ ] >> /jpeg coloracsimagedict << /tilewidth /tileheight /quality >> /jpeg colorimagedict << /tilewidth /tileheight /quality >> /antialiasgrayimages false /cropgrayimages true /grayimageminresolution /grayimageminresolutionpolicy /warning /downsamplegrayimages true /grayimagedownsampletype /bicubic /grayimageresolution /grayimagedepth - /grayimagemindownsampledepth /grayimagedownsamplethreshold . /encodegrayimages true /grayimagefilter /dctencode /autofiltergrayimages true /grayimageautofilterstrategy /jpeg /grayacsimagedict << /qfactor . /hsamples [ ] /vsamples [ ] >> /grayimagedict << /qfactor . /hsamples [ ] /vsamples [ ] >> /jpeg grayacsimagedict << /tilewidth /tileheight /quality >> /jpeg grayimagedict << /tilewidth /tileheight /quality >> /antialiasmonoimages false /cropmonoimages true /monoimageminresolution /monoimageminresolutionpolicy /warning /downsamplemonoimages true /monoimagedownsampletype /bicubic /monoimageresolution /monoimagedepth - /monoimagedownsamplethreshold . /encodemonoimages true /monoimagefilter /ccittfaxencode /monoimagedict << /k - >> /allowpsxobjects false /checkcompliance [ /none ] /pdfx acheck false /pdfx check false /pdfxcompliantpdfonly false /pdfxnotrimboxerror true /pdfxtrimboxtomediaboxoffset [ . . . . ] /pdfxsetbleedboxtomediabox true /pdfxbleedboxtotrimboxoffset [ . . . . ] /pdfxoutputintentprofile (none) /pdfxoutputconditionidentifier () /pdfxoutputcondition () /pdfxregistryname () /pdfxtrapped /false /description << /chs